ID: 977217311

View in Genome Browser
Species Human (GRCh38)
Location 4:94297739-94297761
Sequence GCGGCAAGTCCTGCTTTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1325
Summary {0: 68, 1: 346, 2: 425, 3: 284, 4: 202}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977217311_977217318 -3 Left 977217311 4:94297739-94297761 CCTAGAAAAGCAGGACTTGCCGC 0: 68
1: 346
2: 425
3: 284
4: 202
Right 977217318 4:94297759-94297781 CGCTAAGGGTGAAGGAGAAGGGG 0: 202
1: 356
2: 150
3: 62
4: 232
977217311_977217315 -5 Left 977217311 4:94297739-94297761 CCTAGAAAAGCAGGACTTGCCGC 0: 68
1: 346
2: 425
3: 284
4: 202
Right 977217315 4:94297757-94297779 GCCGCTAAGGGTGAAGGAGAAGG 0: 197
1: 354
2: 164
3: 42
4: 162
977217311_977217320 4 Left 977217311 4:94297739-94297761 CCTAGAAAAGCAGGACTTGCCGC 0: 68
1: 346
2: 425
3: 284
4: 202
Right 977217320 4:94297766-94297788 GGTGAAGGAGAAGGGGTTGAGGG 0: 375
1: 236
2: 100
3: 101
4: 1002
977217311_977217317 -4 Left 977217311 4:94297739-94297761 CCTAGAAAAGCAGGACTTGCCGC 0: 68
1: 346
2: 425
3: 284
4: 202
Right 977217317 4:94297758-94297780 CCGCTAAGGGTGAAGGAGAAGGG 0: 201
1: 360
2: 460
3: 354
4: 240
977217311_977217321 5 Left 977217311 4:94297739-94297761 CCTAGAAAAGCAGGACTTGCCGC 0: 68
1: 346
2: 425
3: 284
4: 202
Right 977217321 4:94297767-94297789 GTGAAGGAGAAGGGGTTGAGGGG 0: 407
1: 144
2: 39
3: 71
4: 574
977217311_977217322 24 Left 977217311 4:94297739-94297761 CCTAGAAAAGCAGGACTTGCCGC 0: 68
1: 346
2: 425
3: 284
4: 202
Right 977217322 4:94297786-94297808 GGGGTACTTGCCCCTGCCCCAGG 0: 146
1: 46
2: 15
3: 24
4: 226
977217311_977217319 3 Left 977217311 4:94297739-94297761 CCTAGAAAAGCAGGACTTGCCGC 0: 68
1: 346
2: 425
3: 284
4: 202
Right 977217319 4:94297765-94297787 GGGTGAAGGAGAAGGGGTTGAGG 0: 458
1: 207
2: 56
3: 137
4: 1396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977217311 Original CRISPR GCGGCAAGTCCTGCTTTTCT AGG (reversed) Intergenic
900840548 1:5045687-5045709 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
900840588 1:5045875-5045897 GTGGCAAGTCCCGCTTTCCTAGG + Intergenic
902800841 1:18829040-18829062 GCCTCAAGACCTGCCTTTCTGGG - Intergenic
904711405 1:32433201-32433223 GCTGCAAGTCCCGCTTTTCTGGG + Intergenic
904711439 1:32433322-32433344 GCAGCAAGTCCCACTTTTCTAGG + Intergenic
904996670 1:34636646-34636668 GCAGCAAGTCCCGCTTTTCTGGG - Intergenic
905060750 1:35137139-35137161 GCGGCAAGTACCGCTTTTCTGGG - Intergenic
905499548 1:38425975-38425997 GCGGCAAGTCCCACTTTTCTGGG + Intergenic
905499578 1:38426096-38426118 GCGGCAAGTACCACTTTTCTGGG + Intergenic
906080680 1:43086373-43086395 GCGGCAAGTCCCACTTTTCTGGG + Intergenic
906253188 1:44327323-44327345 GAGGCAGGCCCTGCTTCTCTGGG - Intronic
906744743 1:48213815-48213837 TAGGCAAGTCCCGCTTTTCTAGG - Intergenic
906744776 1:48213940-48213962 GTGGCAAGTCCCGCTTTTCTGGG - Intergenic
907292401 1:53425207-53425229 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
907292432 1:53425332-53425354 GCAGCAAGTCCCGCTTTTCTAGG + Intergenic
907503776 1:54902603-54902625 GTGGCAAGTCCTGCTTTTCTAGG - Intergenic
907503810 1:54902724-54902746 GTGGCAAGTCCCGCTTTTCTGGG - Intergenic
907521045 1:55023620-55023642 GCGGCAAGTCCCGCTTTCCTAGG + Intergenic
908461917 1:64354730-64354752 GTGGCAAGTCCTGCTTTTCTGGG - Intergenic
908461951 1:64354855-64354877 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
908592199 1:65646755-65646777 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
908592210 1:65646818-65646840 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
908592224 1:65646882-65646904 GCGGCAAGTTCTGCTTTCCTGGG - Intergenic
908592286 1:65647129-65647151 GCGGCAAGTCTCGCTTTTCTGGG - Intergenic
908852103 1:68386889-68386911 GCGGCAAGTCCCACTTTTCTGGG + Intergenic
908852181 1:68387197-68387219 GTGGCAAGTCCCGCTTTCCTGGG + Intergenic
908852198 1:68387261-68387283 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
908852213 1:68387325-68387347 GTGACAAGTCCTGCTTTTCTAGG + Intergenic
909035246 1:70589246-70589268 GTGGCAAGTCCCGCTTTTCTGGG + Intergenic
909035278 1:70589371-70589393 GTGGCAAGTCCCACTTTTCTAGG + Intergenic
909222846 1:72984504-72984526 GCGGCAAGTCCCGTTTTCCTAGG - Intergenic
909222863 1:72984567-72984589 GCAGCAAGTCCCGCTTTCCTGGG - Intergenic
909223862 1:72992551-72992573 GTGGCAAGTCCCACTTTCCTGGG - Intergenic
909223881 1:72992615-72992637 GTGGCAAGTCCCACTTTCCTGGG - Intergenic
909223900 1:72992679-72992701 GTGGCAAGTCCCGCTTTCCTGGG - Intergenic
909551221 1:76899504-76899526 GCGGCAAGTCCCGCTTTTCTGGG - Intronic
909776895 1:79493235-79493257 GAGGCAAGTCCCGCTTTTCTAGG - Intergenic
909788467 1:79643489-79643511 GCAGCAAGTCCCACTTTTCTAGG - Intergenic
909793177 1:79701036-79701058 GTGGCAAGTCCCGCTTTTCTAGG - Intergenic
909793211 1:79701160-79701182 GCGGCAAGTCCCGCTTTTCTAGG - Intergenic
909909703 1:81246180-81246202 GCGGCAAGTCCCACTTTTCTGGG + Intergenic
909978637 1:82072144-82072166 GCGGCAAGTCCCGCTTTCCTAGG - Intergenic
909978669 1:82072269-82072291 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
910136020 1:83970979-83971001 ATGGCAATTCCTGCTCTTCTGGG + Intronic
911510813 1:98805943-98805965 GTGGCAAGTACTGCTTTTCTGGG - Intergenic
911570147 1:99510399-99510421 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
911570178 1:99510524-99510546 GTGGCAAGACCCGCTTTTCTGGG + Intergenic
912296245 1:108473836-108473858 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
918346918 1:183614706-183614728 GCAACAAGTCCCACTTTTCTAGG + Intergenic
918567880 1:185953031-185953053 GTGGCAAGTCCCGCTTTTCTAGG - Intronic
918567898 1:185953095-185953117 GTGGCAAGTCCCGCTTTTCTGGG - Intronic
918567945 1:185953284-185953306 GCAGCAAGTCTTGCTTTTCTGGG - Intronic
918714598 1:187770168-187770190 GTGGCAAGTCCCACTTTCCTAGG - Intergenic
918714615 1:187770232-187770254 GTGGCAACTCCCACTTTTCTGGG - Intergenic
919476135 1:198035509-198035531 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
919476167 1:198035630-198035652 GAGGCAAGTCCCACTTTTCTAGG + Intergenic
920829132 1:209449697-209449719 GTGGCAAGTCCTGCTTTTCTGGG + Intergenic
920829167 1:209449824-209449846 GTGGCAAGTCCTGCTTTCCTGGG + Intergenic
920829184 1:209449888-209449910 GTGGCAAGTCCCGCTTTCCTGGG + Intergenic
920829203 1:209449952-209449974 GCGGCAAGTCCCACTTTCCTGGG + Intergenic
921212203 1:212910465-212910487 GCAGCAAGTCCCGCTTTCCTGGG + Intergenic
921212220 1:212910528-212910550 GCGGCAAGTCCCACTTTCCTAGG + Intergenic
921460008 1:215414766-215414788 GCAGCAAGTCCCGCTTTTCTAGG - Intergenic
921509064 1:216008993-216009015 GCAGCAAGTCCCACTTTTCTGGG + Intronic
921519913 1:216146502-216146524 GCGCCAAGTCCCGCTTTCCTGGG + Intronic
921519932 1:216146566-216146588 GCGGCAAGTCCCGCTTTCCTAGG + Intronic
921733175 1:218598481-218598503 GCGACAAGTCCTGCTTTTCTAGG - Intergenic
921733191 1:218598545-218598567 GCGCCAAGTCCCGCTTTTCTGGG - Intergenic
921733209 1:218598609-218598631 GTGGCAAGTCCAGCTTTCCTGGG - Intergenic
921733343 1:218599161-218599183 GCAGCAAGTCCCACTTTTCTGGG - Intergenic
922048178 1:221966806-221966828 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
922048211 1:221966931-221966953 GCAGCAAGTCCCGCTTTTCTGGG + Intergenic
922049767 1:221977921-221977943 CTGGCAAGTCCCACTTTTCTAGG - Intergenic
922049797 1:221978045-221978067 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
922154273 1:223029115-223029137 GCAGCAAGTCCCGCTTTCCTAGG - Intergenic
922154299 1:223029239-223029261 GCGGCAAGTCCTGCTTTTCTGGG - Intergenic
922363761 1:224845212-224845234 GCGGCAAGCACCACTTTTCTGGG - Intergenic
922906155 1:229175219-229175241 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
922934577 1:229413256-229413278 GCAGCAAATCCCGCTTTTCTGGG + Intergenic
922934609 1:229413374-229413396 GCGGCAAGTCCTGCTTTTCTGGG + Intergenic
922934640 1:229413499-229413521 GTGGCAAGTCTCACTTTTCTAGG + Intergenic
923064404 1:230504767-230504789 TCGAGATGTCCTGCTTTTCTAGG - Intergenic
923074975 1:230602099-230602121 GCAGCAAGTCCCACTTTTGTGGG + Intergenic
923075007 1:230602220-230602242 GCAGCAAGTCCCACTTTTCTGGG + Intergenic
923214363 1:231834774-231834796 GTGGCAAGTACAGCTTTTCTAGG - Intronic
923244510 1:232119005-232119027 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
923257512 1:232234087-232234109 GCTGCAAGTCCCGCTTTTCCGGG - Intergenic
923408818 1:233688167-233688189 GCAGCAAATCTCGCTTTTCTAGG - Intergenic
923408835 1:233688250-233688272 GCGGCAAGTCCTGTTTTTCTGGG - Intergenic
923408855 1:233688333-233688355 GTGGCAAGTCCCACTTTTCTGGG - Intergenic
923408874 1:233688397-233688419 GTGGCAAGTCCCGCTTTTCTGGG - Intergenic
923408908 1:233688522-233688544 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
923770912 1:236936837-236936859 GCGGCAAGTCCTGCTTTTCTAGG - Intergenic
923962530 1:239102069-239102091 GTGGCAAGTCCCACTTTTCTGGG + Intergenic
923962560 1:239102193-239102215 GCGGCAAGTCCCGCTTTTCTAGG + Intergenic
924180426 1:241434866-241434888 GCAGCAAGTCCCGCTTTTCTAGG + Intergenic
1063362871 10:5471629-5471651 GTGGCAAGTCCCACTTTTCTGGG + Intergenic
1063362903 10:5471754-5471776 GTGGCAAGTCCCGCTTTTCTAGG + Intergenic
1063507869 10:6617962-6617984 GAGGCGAGTCCTGGGTTTCTGGG + Intergenic
1063509831 10:6634433-6634455 GCGACAAGTCCCGCTTTTCTGGG - Intergenic
1063509877 10:6634619-6634641 GCAGCAATTCCCGCTTTTCTGGG - Intergenic
1063527928 10:6802029-6802051 GCGGCAATTTCCGCTTTTCTGGG - Intergenic
1064664000 10:17631457-17631479 GAGGCAAGTCCCGCTTTCCTAGG - Intergenic
1064664034 10:17631583-17631605 GCGGCAAGTCCTGCTTTTCTGGG - Intergenic
1064887211 10:20123950-20123972 GCAGCAAGTCCCGCTTTTCTAGG - Intronic
1065361236 10:24890910-24890932 GCTGCAGTTCCTGCTTTTCCTGG - Intronic
1065437394 10:25717269-25717291 GCGGCAAGTACCGCTTTTCTAGG + Intergenic
1065443398 10:25773898-25773920 GCGGCAAGTCCCGCTTTCCTAGG - Intergenic
1065443416 10:25773962-25773984 GCGGCAAGTCCCGCTTTCCTGGG - Intergenic
1065809213 10:29425837-29425859 GTTGCAAATTCTGCTTTTCTGGG - Intergenic
1068058583 10:52038649-52038671 GCAGCAAGTCCCACTTTTCTGGG - Intronic
1068179849 10:53503722-53503744 GCGGCAAGTCCCGCTTTCCTAGG - Intergenic
1068179878 10:53503847-53503869 GCGGCAAGTCCTCCTTTTCTGGG - Intergenic
1068230725 10:54167563-54167585 GCGGCAAGTCCTGCTTTTCTGGG + Intronic
1068592542 10:58865713-58865735 GCGGCAAGTCCCGCTTTCCTAGG - Intergenic
1068592559 10:58865777-58865799 GTGGCAAGTCCCGCTTTCCTGGG - Intergenic
1068592592 10:58865902-58865924 GCAGCAAATCCTGCTTTTCTGGG - Intergenic
1070474603 10:76819159-76819181 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
1070474623 10:76819223-76819245 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
1070474643 10:76819287-76819309 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
1070474662 10:76819351-76819373 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
1070474682 10:76819415-76819437 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
1070474701 10:76819479-76819501 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
1070474720 10:76819543-76819565 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
1070474737 10:76819607-76819629 GCAGCAAGTCCCGCTTTCCTAGG + Intergenic
1070481375 10:76886142-76886164 GCTGCAGATCATGCTTTTCTAGG - Exonic
1070771435 10:79084840-79084862 GAGGGAAGTCCTGCTTTCCAGGG + Intronic
1071897963 10:90085882-90085904 GCAGCAAGTCCCGCTTTTCTGGG - Intergenic
1071915971 10:90295860-90295882 GCAGCAAGTCCCGCTTTTCTGGG + Intergenic
1071916015 10:90296042-90296064 GCGGCAAGTCCCGCTTTCCTAGG + Intergenic
1071960853 10:90808178-90808200 GCGGCAAGTCCCACTTTTCTGGG + Intronic
1071960913 10:90808417-90808439 GCGGCAAGTCCTGCTTTTCTGGG + Intronic
1072011519 10:91306390-91306412 GCGGCAAGTAGTGCTTTTCTAGG - Intergenic
1072011534 10:91306450-91306472 GCAGCAAGTACCTCTTTTCTGGG - Intergenic
1073709658 10:106022177-106022199 GCGGCAAGTACCGCTTTTCTGGG - Intergenic
1074018814 10:109563308-109563330 GCAGCAAGTACCGCTTTTCTGGG + Intergenic
1074740539 10:116481535-116481557 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1074740571 10:116481656-116481678 GCGGCAAGTCCCACTTTTCTAGG + Intergenic
1075248492 10:120845846-120845868 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
1075248510 10:120845910-120845932 GCGGCAAGTCCCGCTTTCCTAGG + Intergenic
1075898617 10:126019878-126019900 GCGGCAGGCCCTGCTTCTCAGGG - Intronic
1077572742 11:3353862-3353884 GCTGTAAGTTCTGCTTTTTTGGG + Intronic
1077590075 11:3484365-3484387 GCAGCAAGTCCTGCTTTTCTGGG - Intergenic
1077611969 11:3648883-3648905 GCGGCAAGTCCCGCTTTTCTAGG + Intronic
1077679347 11:4224403-4224425 GTGGCAAGTACCACTTTTCTGGG - Intergenic
1077688768 11:4320987-4321009 GTGGCAAGTACCACTTTTCTGGG - Intergenic
1077851057 11:6074846-6074868 GTGGCAAGTCCCGCTTTTCTGGG - Intergenic
1077851083 11:6074971-6074993 GCGGCAAGTCCCACTTTTCTGGG - Intergenic
1077883169 11:6366887-6366909 GTGGCAAGTACTGCTTTTCTGGG + Intergenic
1078046358 11:7917005-7917027 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1078154885 11:8790823-8790845 TCGCTAAATCCTGCTTTTCTCGG + Intronic
1079447256 11:20568764-20568786 GCGGCAAGTCCTGCTTTCCTGGG + Intergenic
1079447272 11:20568828-20568850 GTGGCAAGTCCCACTTTCCTAGG + Intergenic
1079672814 11:23188819-23188841 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1079727289 11:23891931-23891953 GCGGCAAGTCCCACTTTTCTGGG - Intergenic
1080028137 11:27633895-27633917 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1080028171 11:27634020-27634042 GCGGCAGGTCCCGCTTTTCTGGG - Intergenic
1080227150 11:29974242-29974264 GCGGCAAGCATTGCTTTTCTGGG + Intergenic
1080746547 11:35113059-35113081 GCAGCAAGTCCTGCTTGCATGGG - Intergenic
1080924747 11:36744606-36744628 GAAGCAAATCCTGCTTTCCTGGG + Intergenic
1081159433 11:39735004-39735026 GCGGCAAGCACTGCTTTTCTGGG + Intergenic
1081356601 11:42121548-42121570 GCAGCAAGTCCCGCTTTCCTGGG + Intergenic
1081356617 11:42121612-42121634 GCAGCAAGTCCCACTTTCCTAGG + Intergenic
1084046965 11:66574604-66574626 GTGGCAAGTCCTGCTTTTCTGGG + Intergenic
1084232095 11:67760657-67760679 GTGGCAAGACCCACTTTTCTTGG + Intergenic
1084245793 11:67856137-67856159 GCAGCAAGTCCTGCTTTTCTGGG - Intergenic
1084353797 11:68623651-68623673 GCGGCAAGTCCCACTTTTCTGGG + Intergenic
1084613476 11:70219040-70219062 GCAGCAAGTCCCATTTTTCTGGG - Intergenic
1084613507 11:70219161-70219183 GCAGCAAGTCCCACTTTTCTAGG - Intergenic
1084613535 11:70219282-70219304 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1084804373 11:71568780-71568802 GCTGCAAGTCCTGATGTTCCCGG + Intronic
1084804378 11:71568810-71568832 GCTGCAAGTCCTGCTGTTCCCGG + Intronic
1084826876 11:71738377-71738399 GCAGCAAGTCCCGCTTTTCTTGG + Intergenic
1084826891 11:71738441-71738463 GCAGCAAGTCCCACTTTTCTGGG + Intergenic
1085153131 11:74268125-74268147 GGGGTAAGTCTTGCCTTTCTGGG - Exonic
1085200000 11:74696212-74696234 GCAGCACCTCCTGCTTTTCCGGG - Intergenic
1085987804 11:81807138-81807160 GCAGCAAGTACTGCTTTTCTAGG + Intergenic
1086136503 11:83447711-83447733 GTGGCAAGTCCCGCTTTTCTGGG - Intergenic
1087127570 11:94642447-94642469 GCAGCAAGTCCCGCTTTTCTGGG + Intergenic
1087127604 11:94642567-94642589 GCGGCAAGTCCCGCTTTTCTAGG + Intergenic
1087196653 11:95310340-95310362 GCGGCAAGTCCCACTTTTCTGGG + Intergenic
1087196704 11:95310526-95310548 GTGGCAAGTCCCACTTTCCTGGG + Intergenic
1087196722 11:95310590-95310612 GTGGCAAGTCCCACTTTCCTAGG + Intergenic
1087314385 11:96588526-96588548 GTGGCAAGTCCCGCTTTTCTGGG + Intergenic
1087314416 11:96588651-96588673 GCGGCAAGTCCCGCTTTTGTGGG + Intergenic
1087314433 11:96588715-96588737 GCGGCAAGTCCTGCTTTTCTGGG + Intergenic
1087839758 11:102908905-102908927 GTGGCAAGTCCCACTTTTCTAGG - Intergenic
1087839785 11:102909027-102909049 GTGGCAAGTCCCACTTTTCTGGG - Intergenic
1089289236 11:117427852-117427874 GAAGCAACTCCTGGTTTTCTTGG + Exonic
1089348906 11:117810320-117810342 GTGGCAAGTCCCGCTTTTCTAGG + Intronic
1089472282 11:118730856-118730878 GCGGCAAGTACCACTTTTCTGGG - Intergenic
1089472316 11:118730977-118730999 GCGGCAAGTCCCACTTTTCTGGG - Intergenic
1089867262 11:121642644-121642666 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1089953022 11:122547478-122547500 GCAGCAAGTCCCACTTTTCTGGG + Intergenic
1089987184 11:122825404-122825426 GTGGCAAGTCCCGCTTTTCCAGG + Intergenic
1090850787 11:130568994-130569016 GCGGCAAGTCCCGCTTTCCTAGG - Intergenic
1090850805 11:130569058-130569080 GTGGCAAGTCCCGCTTTCCTGGG - Intergenic
1090872142 11:130758138-130758160 GCGGCAAGTCCCGCTTTCCTAGG - Intergenic
1090872159 11:130758202-130758224 GCGGCAAGTCCTGCTTTCCTGGG - Intergenic
1090872176 11:130758263-130758285 GCGGCAAGTCCTGCTTTCCTGGG - Intergenic
1090927171 11:131259274-131259296 GCGGCAAGTACCGCTTTTCTAGG - Intergenic
1090927194 11:131259393-131259415 GCAGCAAGTACTGCTTTTCTGGG - Intergenic
1091691255 12:2598964-2598986 GCGGCAAAACCTGCTTTCCATGG + Intronic
1091886287 12:4019432-4019454 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1091886316 12:4019557-4019579 GCGGCAAGTCCCGCTTTCCTAGG + Intergenic
1092474230 12:8805722-8805744 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1092592914 12:9967631-9967653 GCGGCAAGTACCGCTCTTCTTGG - Intronic
1092592956 12:9967805-9967827 GCGACAAGTACTGCTTTTCTTGG - Intronic
1092626973 12:10337730-10337752 GCAGCAAGTCCCGCTTTTCTGGG - Intergenic
1092723963 12:11467097-11467119 CTGGCAAGTCCCACTTTTCTGGG - Intronic
1092739520 12:11614387-11614409 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1092789475 12:12059229-12059251 GCGGCAAGTCCCGCTTTTCTGGG + Intronic
1092924230 12:13259032-13259054 TCTGCGAGTCCTGCTTTTCCAGG - Intergenic
1092925045 12:13264646-13264668 GCGGCAAGTCCCACTTTTCTAGG - Intergenic
1093071358 12:14709562-14709584 GCGGCAAGTCCCGCTTTCCTAGG - Intergenic
1093071385 12:14709684-14709706 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1093268232 12:17026461-17026483 GTGGCAAGTCCCACTTTTCTGGG - Intergenic
1093578500 12:20763810-20763832 GCAGAAAGTCCCGCTTTTCTGGG + Intergenic
1093578530 12:20763935-20763957 GTGGCAAGTCCCACTTTTCTGGG + Intergenic
1093584690 12:20821588-20821610 GTGGCAAGTCCCGCTTTTCTAGG - Intronic
1093584726 12:20821713-20821735 GCCGCAAGTCCCGCTTTTCTGGG - Intronic
1093813026 12:23510653-23510675 GCGGCAAGTACCGCTTTTCTGGG - Intergenic
1094316258 12:29139706-29139728 GCAGCAAGTACTGCTTTTCTAGG - Intergenic
1094316300 12:29139884-29139906 GTGGCAAGTACCACTTTTCTGGG - Intergenic
1094400453 12:30056941-30056963 GTGGCAAGTACCACTTTTCTGGG + Intergenic
1094400486 12:30057062-30057084 GCAGCAAGTACTGCTTTTCTGGG + Intergenic
1094400500 12:30057122-30057144 GAGGCAAGTACCACTTTTCTAGG + Intergenic
1094825529 12:34266494-34266516 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1094825559 12:34266619-34266641 GCATCAAGTCCCGCTTTTCTAGG + Intergenic
1095073612 12:37890291-37890313 GAGGTAAGTCCTTCTTTTATTGG - Intergenic
1095075915 12:37924732-37924754 GAGTTAAGTCCTGCTTTTATTGG - Intergenic
1097235924 12:57539555-57539577 GTGGTATGTCCTGCCTTTCTAGG + Intronic
1097398307 12:59102527-59102549 GCAGCAAGTCCCACTTTTCTAGG + Intergenic
1097398384 12:59102835-59102857 GCAGCAAGTCCCGCTTTTCTAGG + Intergenic
1097417244 12:59327903-59327925 GCGGCAAGTCCCGCTTTCCTAGG - Intergenic
1097417263 12:59327967-59327989 GCGGCAAGTCCCGCTTTCCTGGG - Intergenic
1097417278 12:59328031-59328053 GTGGCAAGTCTCGCTTTCCTGGG - Intergenic
1097542416 12:60956745-60956767 GAGGCAAGTCCCACTTTTCTGGG - Intergenic
1097592190 12:61587934-61587956 GCGGCAAGCACTGCTTTTCTGGG + Intergenic
1097693947 12:62759655-62759677 GCAGCAAGCACCGCTTTTCTGGG + Intronic
1097950876 12:65427189-65427211 GTGGAAAGTCCTTCTTTTATTGG + Intronic
1098173853 12:67771432-67771454 GCGGCAAGTCCTGCTTTTCTGGG - Intergenic
1098401978 12:70086179-70086201 GCGACAAGTCCCGCTTTCCTGGG + Intergenic
1098401997 12:70086243-70086265 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
1098402016 12:70086307-70086329 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
1098402034 12:70086371-70086393 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
1098402052 12:70086435-70086457 GCGGCAAGTCCCGCTTTCCTAGG + Intergenic
1098628818 12:72704113-72704135 TCAGCAAGTCCCACTTTTCTGGG + Intergenic
1098654009 12:73006608-73006630 GCAGCAAATACTGCTTTTCTAGG - Intergenic
1098654038 12:73006727-73006749 GTGGCAAGTACCGCTTTTCTAGG - Intergenic
1099188478 12:79540739-79540761 GCAGCAAGTCCCGCTTTTCTGGG + Intergenic
1099292341 12:80788024-80788046 GCAGCAAGTCCTGCTTTTCTGGG - Intergenic
1099762340 12:86939582-86939604 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1100201671 12:92305492-92305514 GGGGAAAGTACAGCTTTTCTTGG - Intergenic
1100561048 12:95749723-95749745 GTGGCAAGTCCTGCTTTTCTGGG + Intronic
1100561080 12:95749848-95749870 GCGGCAAGTCCCGCTTTTCTGGG + Intronic
1100561097 12:95749912-95749934 GTGGCAAGTCCCGCTTTTCTGGG + Intronic
1100561116 12:95749976-95749998 GTGGCAAGTCCCGCTTTTCTGGG + Intronic
1100855104 12:98751074-98751096 GCAGCAGGTACTGCTGTTCTTGG - Intronic
1100940063 12:99716046-99716068 GCAGCAAGTCCCGCTTTTCTGGG + Intronic
1100964659 12:99999394-99999416 GCTGCAAAACCTGCTTTTCTGGG - Intergenic
1101278655 12:103227643-103227665 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1102217122 12:111169456-111169478 GTGGCCATCCCTGCTTTTCTGGG - Intronic
1105031983 12:132890417-132890439 GTGGCAAGTAATGCTTTTTTGGG + Intronic
1105869895 13:24495545-24495567 GCGGCACTTTCTGCTCTTCTGGG + Intronic
1105891908 13:24688169-24688191 GAGGCACGGTCTGCTTTTCTCGG + Intronic
1106943216 13:34799576-34799598 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
1106943234 13:34799640-34799662 GCGGCAAGTCCTGCTTTCCTGGG + Intergenic
1106943250 13:34799704-34799726 GCAGCAAGTCCCGCTTTCCTAGG + Intergenic
1107075325 13:36317219-36317241 GCGGCAAGTCCCGCTTTTCTGGG + Intronic
1107220515 13:37973960-37973982 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1107220549 13:37974085-37974107 GCGGCAAGTCCTGCTTTTCTGGG - Intergenic
1107683337 13:42872104-42872126 GCGGCAAGTCCCGCTTTCCTAGG - Intergenic
1107683353 13:42872168-42872190 GCAGCAAGTGCTGCTTTCCTGGG - Intergenic
1107683373 13:42872232-42872254 GCGGCAAGTCCCGCTTTCCTGGG - Intergenic
1108202444 13:48057216-48057238 GCGGCAAGTCCCACTTTTCTGGG + Intronic
1108512760 13:51170767-51170789 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
1108512793 13:51170895-51170917 GTGGCAAGTCCCGCTTTCCTAGG + Intergenic
1108913637 13:55583050-55583072 GTGGCAAGTCCCGCTTTTCTGGG - Intergenic
1108913670 13:55583175-55583197 GCGACAAGTCCCGCTTTTCTGGG - Intergenic
1108947202 13:56041142-56041164 GCAGCAAGTTCCGCTTTTCTGGG + Intergenic
1109343369 13:61089315-61089337 GCGGCAAGTCCCACTTTTCTAGG + Intergenic
1109499050 13:63213970-63213992 GCAGCAAGTCCCACTTTTCTGGG + Intergenic
1109499084 13:63214090-63214112 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1109709852 13:66146005-66146027 GCGGCAAGTCCCACTTTCCTAGG - Intergenic
1109709883 13:66146130-66146152 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1109716982 13:66231238-66231260 GCGGCAAGTCCCACTTTTCTGGG - Intergenic
1109717000 13:66231302-66231324 TCAGCAAGTCCCGCTTTTCTGGG - Intergenic
1109717030 13:66231427-66231449 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1110650729 13:77938445-77938467 GCAGCAAGTACCACTTTTCTAGG - Intergenic
1110650745 13:77938505-77938527 GCGGCAAGTACCACTTTTCTGGG - Intergenic
1110765222 13:79274939-79274961 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1110765253 13:79275060-79275082 GCAGCAAGTCCCGCTTTTCTAGG + Intergenic
1110845090 13:80184411-80184433 GCTGCAAGTCCTGCTTTTCTGGG + Intergenic
1110845121 13:80184532-80184554 GCAGCAAGTCCCACTTTTCTAGG + Intergenic
1110978226 13:81866957-81866979 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1111126235 13:83912939-83912961 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1111301769 13:86359068-86359090 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1111362312 13:87191103-87191125 GCGGCAAGTCCCGCTTTTCTAGG - Intergenic
1111362345 13:87191228-87191250 GTGGCAAGTCCCACTTTTCTGGG - Intergenic
1111459054 13:88517566-88517588 GTGGCAAGTCCCACTTTTCTAGG - Intergenic
1111459086 13:88517694-88517716 GCGGCAAGTCCTGCTTTCCTGGG - Intergenic
1111459120 13:88517819-88517841 GCGGCAAGTCCCACTTTTCTGGG - Intergenic
1111630244 13:90840443-90840465 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1111630273 13:90840568-90840590 GCGGCAAGTCCCGCTTTTCTAGG + Intergenic
1111631905 13:90853304-90853326 GCGGCAAGTCCCGCTTTTCTAGG - Intergenic
1112236599 13:97643165-97643187 GCGGCAAGTCCTGCTTTTCTGGG + Intergenic
1112392677 13:98999515-98999537 GAGCCAAGTCCTGCGTGTCTGGG + Intronic
1112889565 13:104212952-104212974 GCAGCAAGTACTGGTTTTCTGGG - Intergenic
1113324032 13:109265971-109265993 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1113324096 13:109266218-109266240 GTGGCAAGTCCCACTTTTCTGGG + Intergenic
1113324114 13:109266282-109266304 GTGGCAAGTCCCGCTTTTCTAGG + Intergenic
1113874611 13:113586186-113586208 GCAGCGAATCCTGCATTTCTTGG + Intronic
1115240786 14:31249956-31249978 GCAGCAAGTCCCGCTTTCCTAGG - Intergenic
1115240801 14:31250020-31250042 GCGGCAAGTCCTGCTTTCCTGGG - Intergenic
1115240818 14:31250076-31250098 GCGGCAAGTCCTGCTTTCCTGGG - Intergenic
1115240838 14:31250140-31250162 GCGGCAAGTCCTGCTTTCCTGGG - Intergenic
1115240859 14:31250204-31250226 GCGGCAAGTCCCACTTTCCTGGG - Intergenic
1115643752 14:35352522-35352544 GCCTCCATTCCTGCTTTTCTGGG - Intergenic
1115904549 14:38191535-38191557 GCGGCAAGTCCCACTTTTCTGGG + Intergenic
1116179431 14:41516763-41516785 GTGTCAAGTCCCACTTTTCTGGG + Intergenic
1116534978 14:46017105-46017127 GCGGCAAGTCCCACTTTTCGGGG - Intergenic
1116535014 14:46017226-46017248 GCAGCAAGTCCCGCTTCTCTGGG - Intergenic
1116573279 14:46545050-46545072 GCAGCAAGTCCCACTTTTCTAGG + Intergenic
1116613300 14:47105132-47105154 GCGGCAAGTCCCGCTTTCCTGGG + Intronic
1116613318 14:47105196-47105218 GTGGCAAGTCCTGCTTTCCTAGG + Intronic
1116702595 14:48260067-48260089 GCGGCAAGTCCCGCATTTCTAGG - Intergenic
1116703523 14:48267279-48267301 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1116703549 14:48267400-48267422 GCGGCAAGTCCTGCTTTTCTGGG - Intergenic
1116952678 14:50894062-50894084 GCGGCAAGTCCCGCTTTTCTGGG + Intronic
1116952712 14:50894187-50894209 GTGGCAAGTCCCGCTTTCCTGGG + Intronic
1116952730 14:50894251-50894273 GCGGCAAGTCCCGCTTTCCTAGG + Intronic
1117958117 14:61138157-61138179 GCGGCAAGTCCTGCTTTTCTGGG - Intergenic
1117958153 14:61138282-61138304 GCGGCAAGTCCCACTTTTCTGGG - Intergenic
1118937552 14:70301069-70301091 GCGGCAAGTCCTGCTTTTCTGGG - Intergenic
1119022158 14:71125067-71125089 GCAGCAAGTCCCACTTTTCTAGG + Intergenic
1119022191 14:71125188-71125210 GTGGCAAGTCCCACTTTTCTAGG + Intergenic
1119022226 14:71125306-71125328 GCAGCAAGTCCCGCTTTTCTGGG + Intergenic
1119316928 14:73704220-73704242 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1119316981 14:73704424-73704446 GCGGCAAGTCCCGCTTTTCTAGG + Intergenic
1120438270 14:84504984-84505006 GCGGCAAGTACCACTTTTCTGGG - Intergenic
1120438301 14:84505101-84505123 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1120539746 14:85737603-85737625 GCGGCAAGTACCCCTTTTCTGGG - Intergenic
1120539778 14:85737716-85737738 GCGGCAAGTACCACTTTTCTGGG - Intergenic
1120660175 14:87239792-87239814 GTGGCAAATCCCGCTTTTCTAGG - Intergenic
1120660209 14:87239913-87239935 GCGCCAAGTCCCACTTTTCTGGG - Intergenic
1121703425 14:95973858-95973880 GTGGCAAGTCCCACTTTTCTGGG + Intergenic
1121703441 14:95973922-95973944 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1121703458 14:95973986-95974008 GCGGCAAATCCTTCTTCTCTGGG + Intergenic
1122040774 14:98986136-98986158 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
1122040792 14:98986200-98986222 GCGGCAAGTCCCGCTTTCCTAGG + Intergenic
1123882666 15:24690153-24690175 GCGGCAAGTACTGCTTTTCTGGG - Intergenic
1125045500 15:35239512-35239534 GCGGCAAGTCCCGCTTTTCTGGG + Intronic
1125045534 15:35239638-35239660 GCGGCAAGTCCCGCTTTCCTGGG + Intronic
1125045553 15:35239702-35239724 GTGGCAAGTCCTGCTTTCCTGGG + Intronic
1125045569 15:35239766-35239788 GCAGCAAGTCCCGCTTTCCTAGG + Intronic
1125131807 15:36290776-36290798 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1126530366 15:49703875-49703897 GCGGCAAGTACCACTTTTCTAGG - Intergenic
1126843509 15:52739440-52739462 GCGGCAAGTCCCGCTTTTCAAGG + Intergenic
1126843542 15:52739559-52739581 GCGGCAAGTCCCATTTTTCTGGG + Intergenic
1126912579 15:53431465-53431487 GTGGCAAGTCCCGCTTTTCTAGG - Intergenic
1129390684 15:75219215-75219237 GCGGCTTGTCCTGCTATACTGGG - Intergenic
1130854845 15:87831996-87832018 GTGGCAAGTCCCACTTTTCTGGG + Intergenic
1130947714 15:88561338-88561360 GCGGCAAGTCTCGCTTTTCTGGG - Intergenic
1131447462 15:92512222-92512244 GCAGCAAGTACCACTTTTCTGGG + Intergenic
1131447491 15:92512340-92512362 GCGGCAAGTACCGCTTTTCTAGG + Intergenic
1131683949 15:94751612-94751634 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1131882728 15:96876626-96876648 GCGGCAAGTCCCGCTTTCCTAGG - Intergenic
1131882746 15:96876690-96876712 GCGGCAAGTCCCGCTTTCCTGGG - Intergenic
1131882765 15:96876754-96876776 GCGGCAAGTCCCGCTTTCCTGGG - Intergenic
1132262759 15:100441060-100441082 GCGGCAAGTCCCGCTTTTCTGGG + Intronic
1132340176 15:101073390-101073412 GCGGCAAGTCCCGCTTTTCTGGG + Intronic
1133651158 16:7815536-7815558 GCGGCAATTCCCACTTTTCTGGG + Intergenic
1133766904 16:8844438-8844460 GCGGCAAGTCCCGCTTTTCTGGG - Intronic
1134342370 16:13357209-13357231 GCGGCAAGTCCCGCTTTCCTAGG - Intergenic
1137014731 16:35363690-35363712 GCGGCTCTTCCTTCTTTTCTGGG + Intergenic
1138804656 16:60079437-60079459 GCAGCAAGTCCTGCTTTTCTGGG + Intergenic
1138926078 16:61592853-61592875 GCTGCAACTCCTGCTGCTCTTGG + Intergenic
1139039414 16:62983763-62983785 GCGGCAAGTCCCGCTTTTCTAGG - Intergenic
1139039450 16:62983886-62983908 GCGGCAAGTCCCGTTTTCCTGGG - Intergenic
1139039487 16:62984011-62984033 GCGGCAAGTCCCGTTTTCCTGGG - Intergenic
1139039523 16:62984136-62984158 GCGGCAAGTCCCGTTTTCCTGGG - Intergenic
1139039542 16:62984200-62984222 GTGGCAAGTCCCGCTTTTCTGGG - Intergenic
1139039559 16:62984261-62984283 GTGGCAAGTCCCGCTTTTCTGGG - Intergenic
1139039576 16:62984322-62984344 GTGGCAAGTCCCGCTTTTCTGGG - Intergenic
1139039593 16:62984383-62984405 GTGGCAAGTCCCGCTTTTCTGGG - Intergenic
1139039623 16:62984505-62984527 GTGGCAAGTCCCGCTTTTCTGGG - Intergenic
1139039642 16:62984569-62984591 GTGGCAAGTCCCGCTTTTCTGGG - Intergenic
1139039659 16:62984630-62984652 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1139226107 16:65234507-65234529 GTGGCAAGTCCCGCTTTCCTAGG - Intergenic
1139226125 16:65234571-65234593 GCGGCAAGTCCCGCTTTCCTGGG - Intergenic
1139943225 16:70621088-70621110 GCGACAAGTCCCGCTTTCCTAGG - Intronic
1139943241 16:70621152-70621174 GCGGCAAGTCCTGCTTTCCTGGG - Intronic
1139943909 16:70625418-70625440 GCGGCAAGTCCCGCTTTTCTAGG - Intronic
1139943942 16:70625541-70625563 GCAGCAAGTCCCGCTTTTCTGGG - Intronic
1140452396 16:75081253-75081275 AAGGCCAGTCCTGTTTTTCTAGG + Intronic
1141796485 16:86278733-86278755 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
1141796505 16:86278797-86278819 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
1141796525 16:86278861-86278883 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
1141796545 16:86278925-86278947 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
1141796565 16:86278989-86279011 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
1141796584 16:86279053-86279075 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
1141865422 16:86746732-86746754 GCGACAAGTCCCGCTTTCCTGGG - Intergenic
1142120032 16:88382760-88382782 GCAGCAAGGCCTGCCATTCTGGG + Intergenic
1143681518 17:8479548-8479570 GCCGCGAGCCCTGCATTTCTGGG + Intronic
1144104394 17:11972639-11972661 GTGGCAAGTCCCGCTTTTCTGGG + Intergenic
1144104425 17:11972761-11972783 GCGGCAAGTCCCGCTTTCCTAGG + Intergenic
1144642687 17:16946300-16946322 TCGGCCTGTCCTGCTCTTCTTGG - Intronic
1145263414 17:21367924-21367946 GCAGCAAGTCCTCCTGGTCTAGG + Intergenic
1146597639 17:34184062-34184084 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1146597671 17:34184187-34184209 GCGGCAAGTCCCACTTTCCTGGG + Intergenic
1146597688 17:34184251-34184273 GTGGCAAGTCCTGCTTTTCTAGG + Intergenic
1148902527 17:50889040-50889062 GAGGCAATTCCTTTTTTTCTTGG - Intergenic
1151244247 17:72782227-72782249 GCAGCAAGTCTTGGTGTTCTTGG - Intronic
1151622258 17:75253492-75253514 GCGGCAAGTCCTGCTTTTCTGGG + Intronic
1151622290 17:75253617-75253639 GCGGTAAGTCCCGCTTTTCTAGG + Intronic
1153498717 18:5726135-5726157 GCAGAAATTGCTGCTTTTCTTGG - Intergenic
1155173621 18:23285081-23285103 GTGGCAAGTCCTGCTTTTCTGGG + Intronic
1155697211 18:28697789-28697811 GTGGCAAGTCCCGCTTTTCTAGG - Intergenic
1155697261 18:28697977-28697999 GCGGCAAGTCCTGCTTTTCTGGG - Intergenic
1155941305 18:31804623-31804645 GCAGCAAGTCCCGCTTTTCTAGG + Intergenic
1155941338 18:31804744-31804766 GTGGCAAGTCCCGCTTTTCTGGG + Intergenic
1156924261 18:42557218-42557240 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1156989578 18:43392427-43392449 GCTGCAAGTTCTGTTTTTATTGG + Intergenic
1158336115 18:56416336-56416358 GTGGCAAGTCCCGCTTTTCTGGG + Intergenic
1158336180 18:56416586-56416608 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1158394896 18:57071575-57071597 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1159164253 18:64682589-64682611 GCGGCAAGTCCCACTTTTCTGGG + Intergenic
1159164283 18:64682711-64682733 GTGGCAAGTCCCGCTTTTCTAGG + Intergenic
1159834800 18:73325486-73325508 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1161661506 19:5549466-5549488 GTGGCAAGTCCCGCTTTCCTGGG + Intergenic
1161661524 19:5549530-5549552 GTGGCAAGTCCCGCTTTCCTAGG + Intergenic
1162187421 19:8916801-8916823 GGGGCAGCTCCTGCTTTGCTTGG + Intronic
1162187652 19:8918379-8918401 GGGGCAGCTCCTGCTTTGCTTGG + Intronic
1162242389 19:9365544-9365566 GCGGCAAGTACTGCTTTTCTGGG - Intronic
1162648047 19:12064580-12064602 GCGGTCAGTCCTGCTCTGCTTGG + Intergenic
1162854709 19:13459474-13459496 TCGGCAAGGCCGGCTTTTGTTGG - Intronic
1163900493 19:20095736-20095758 GCGGCAAGTCCCACTTTTCTAGG - Intronic
1163900525 19:20095863-20095885 GCGGCAAGTCCCGCTTTTCTGGG - Intronic
1163906829 19:20155540-20155562 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
1163906847 19:20155604-20155626 GTGGCAAGTCCTGCTTTCCTAGG + Intergenic
1164152757 19:22569203-22569225 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
1164152775 19:22569267-22569289 GTGGCAAGTCCCACTTTCCTAGG + Intergenic
1164459422 19:28434562-28434584 GAGGCAAGTCCCGCTTTTCTGGG - Intergenic
1164459437 19:28434626-28434648 GCAGCAAGTCCCGCTTTTCTGGG - Intergenic
1164459451 19:28434690-28434712 GCAGCAAGTCTCACTTTTCTGGG - Intergenic
1164459464 19:28434754-28434776 ATGGCAAGTCCCACTTTTCTGGG - Intergenic
1164459497 19:28434879-28434901 GTGGCAAGTCCTGCTTTTCTGGG - Intergenic
1164468190 19:28505977-28505999 GAGTCAAGTCGAGCTTTTCTGGG + Intergenic
1164602140 19:29569322-29569344 GATGCAACTCCTGCTTTTCCTGG + Intergenic
1165497180 19:36159988-36160010 GTGGTAAGTCCCACTTTTCTAGG - Intergenic
1165497210 19:36160110-36160132 GTGGCAAGTCCCGCTTTTCTCGG - Intergenic
1165510490 19:36264077-36264099 GCAGCAAGTCCCACTTTTCTAGG - Intergenic
1165510521 19:36264198-36264220 GTGGCAAGTCCCACTTTTCTAGG - Intergenic
1165510553 19:36264323-36264345 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1165835133 19:38750506-38750528 GTGGCAAGTCCCGCTTTTCTGGG + Intronic
1166037230 19:40177666-40177688 GCTGTAACTCCTGCTGTTCTTGG + Intergenic
1166499146 19:43328244-43328266 GCGGTAAGTCCCGCTTTCCTAGG - Intergenic
1166499212 19:43328490-43328512 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1166596534 19:44055187-44055209 GAGGCAAGTCCTACTTACCTTGG - Exonic
1166678579 19:44754237-44754259 GCTGCAAGTCCTCCTTATCCCGG - Intronic
1166918036 19:46209109-46209131 GCTCCAGGCCCTGCTTTTCTGGG - Intergenic
1167046787 19:47054382-47054404 GTGGCAAGTCCCGCTTTTCTAGG - Intergenic
1167046818 19:47054505-47054527 GTGGCAAGTCCCGCTTTTCTGGG - Intergenic
1167099205 19:47393722-47393744 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1167829889 19:52011081-52011103 CTGGCAAGTCCTGCTTGGCTAGG - Intergenic
1167901921 19:52628644-52628666 GCAGCAAGTTCCGCTTTTCTAGG + Intronic
1167901947 19:52628764-52628786 GCAGCAAGTCCCACTTTTCTAGG + Intronic
1168051387 19:53832306-53832328 GCGGCAAGTCCCGCTTTCCTAGG + Intergenic
1168212317 19:54899606-54899628 GTGGCAAGTACCGCTTTTCTAGG - Intergenic
1168212348 19:54899724-54899746 GTGGCAAGTACTGCTTTTCTGGG - Intergenic
1168228209 19:55011555-55011577 GTGGCAAGTCCCACTTTTCTGGG - Intergenic
925544273 2:5001657-5001679 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
925829030 2:7877397-7877419 GTAGCAAGTCCCGCTTTCCTAGG - Intergenic
925829045 2:7877461-7877483 GTGGCAAGTCCTGCTTTTCTGGG - Intergenic
925829062 2:7877525-7877547 GTGGCAAGTCCTGCTTTTCTGGG - Intergenic
925829080 2:7877589-7877611 GTGGCAAGTCCTGCTTTTCTGGG - Intergenic
925829097 2:7877653-7877675 GTGGCAAGTCCTGCTTTTCTGGG - Intergenic
925829115 2:7877717-7877739 GTGGCAAGTCCTGCTTTTCTGGG - Intergenic
925829133 2:7877781-7877803 GTGGCAAGTCCTGCTTTTCTGGG - Intergenic
925829148 2:7877845-7877867 GTGGCAAGTCCTGCTTTTCTGGG - Intergenic
925829179 2:7877969-7877991 GCGGCAAGTCCTGCTTTTCTGGG - Intergenic
926407510 2:12570559-12570581 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
926407542 2:12570684-12570706 GTGGCAAGTCCCGCTTTTCTGGG + Intergenic
926407561 2:12570748-12570770 GTGGCAAGTCCTGCTTTTCTGGG + Intergenic
926413332 2:12627221-12627243 GCGGCAAGTCCTGCTTTTCTGGG + Intergenic
926413379 2:12627407-12627429 GCGGCAAGTCCCGCTTTTTTGGG + Intergenic
926464281 2:13168665-13168687 GCGGCAAGTCCCACTTTTCTAGG - Intergenic
926464314 2:13168790-13168812 GCAGCAAGTCCCGCTTTTGTGGG - Intergenic
926815746 2:16796626-16796648 GCGGCAAGTCCCGCTTTCCTAGG - Intergenic
926815796 2:16796812-16796834 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
928770802 2:34700483-34700505 GCAGCAAGTACCACTTTTCTGGG - Intergenic
928778114 2:34790798-34790820 GCAGCAAGTACCGCTTTTCTGGG + Intergenic
928779931 2:34805841-34805863 GCAGCAAGTACTGCTTTTCTAGG - Intergenic
928827830 2:35441719-35441741 GCGGCATGTCCTGCTTTTCTGGG - Intergenic
928928365 2:36600102-36600124 GCGGCAAGTCCCGCTTTTCTAGG + Intronic
929076927 2:38085654-38085676 GCGGCAAGTCCTGCTTTTCTGGG - Intronic
930954880 2:57193946-57193968 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
930954899 2:57194010-57194032 GTGGCAAGTCCCGCTTTCCTGGG + Intergenic
930954917 2:57194074-57194096 GCGGCAAGTCCTGCTTTGCTAGG + Intergenic
930958189 2:57229915-57229937 GCGGCAAGTACCGCTTTTCTGGG + Intergenic
930958215 2:57230031-57230053 GTGGCAAGTACCACTTTTCTGGG + Intergenic
931026577 2:58118037-58118059 GCAGCAAGTCCCACTTTTCTAGG - Intronic
931026594 2:58118101-58118123 GTGGCAAGTCCCACTTTTCTGGG - Intronic
931026629 2:58118226-58118248 GCGGCAAGTCCCGCTTTTCTGGG - Intronic
931042458 2:58315008-58315030 GCAGCAAGTCCCACTTTTCTGGG + Intergenic
931236644 2:60418285-60418307 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
931236661 2:60418347-60418369 GCAGCAAGTCCCGCTTTCCTGGG + Intergenic
931236679 2:60418411-60418433 GCAGCAAGTCCCGCTTTCCTGGG + Intergenic
931236713 2:60418539-60418561 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
931236747 2:60418667-60418689 GCGGCAAGTCCCGCTTTCCTAGG + Intergenic
931625521 2:64253341-64253363 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
931625538 2:64253402-64253424 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
931625557 2:64253466-64253488 GCGGCAAGTCCTGCTTTCCTGGG + Intergenic
931625572 2:64253530-64253552 GTGGCAAGTCCCGCTTTCCTAGG + Intergenic
931850183 2:66244786-66244808 GCGGCAAGTTCCGCTTTTCTGGG + Intergenic
931850213 2:66244911-66244933 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
931850230 2:66244975-66244997 GCGGCAAGTCCCGCTTTCCTAGG + Intergenic
932159689 2:69448449-69448471 GCGGCAAGCACTGCTTTTCTGGG - Intergenic
932295588 2:70621349-70621371 GCGGCAAGTCCTGCTTTTCTGGG + Intronic
932295617 2:70621470-70621492 GTGGCAAGTCCCGCTTTTCTAGG + Intronic
932295648 2:70621592-70621614 GCAGCAAGTCCTGCTTTTCTAGG + Intronic
932359021 2:71089769-71089791 GCGGCAAGTCCCGCTTTCCTAGG - Intergenic
932359037 2:71089833-71089855 GCGGCAAGTCCCGCTTTCCTGGG - Intergenic
932359056 2:71089897-71089919 GCGGCAAGTCCCGCTTTCCTGGG - Intergenic
932359100 2:71090085-71090107 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
932367838 2:71164374-71164396 GCGGCAAGTCCCACTTTTCTGGG - Intergenic
932367868 2:71164499-71164521 GTGGCAAGTCCCGCTTTTCTGGG - Intergenic
932367917 2:71164685-71164707 GTGGCAAGTCCTGCTTTTCTGGG - Intergenic
932974201 2:76578772-76578794 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
933012834 2:77089126-77089148 GGGGCAAGTCCCGCTTTTCTGGG + Intronic
933079041 2:77966020-77966042 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
933079060 2:77966084-77966106 GTGGCAAGTCCCGCTTTCCTGGG + Intergenic
933079078 2:77966148-77966170 GCGGCAAGTCCCGCTTTCCTAGG + Intergenic
933163508 2:79052239-79052261 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
933163540 2:79052360-79052382 GCGGCAAGTCCCACTTTTCTGGG + Intergenic
933179994 2:79216659-79216681 GCCACAAGTACCGCTTTTCTAGG - Intronic
933180010 2:79216719-79216741 GCTGCAAGTACCGCTTTTCTAGG - Intronic
933180040 2:79216834-79216856 GTGGCAAGTACTGCAGTTCTGGG - Intronic
933329710 2:80879135-80879157 GTGGCAAGTCCCACTTTCCTAGG - Intergenic
933329759 2:80879321-80879343 GTGGCAAGTCCCGCTTTTCTGGG - Intergenic
933552591 2:83793598-83793620 GCAGCAAGTCCCGCTTTTCTGGG - Intergenic
935445908 2:103156682-103156704 GCAACAATTACTGCTTTTCTTGG - Intergenic
936175743 2:110218782-110218804 GCGGCAAGTCCTGCTTTTCTGGG + Intergenic
936175788 2:110218972-110218994 GTGGCAAGTCCTGCTTTTCTGGG + Intergenic
936883116 2:117279655-117279677 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
936883149 2:117279782-117279804 GCGGCAAGTCCCACTTTCCTAGG + Intergenic
936979898 2:118254794-118254816 GAGGCATGCCCTGCTTCTCTGGG - Intergenic
937893021 2:126954425-126954447 GGAGCAAGTCCTGCTTTACATGG - Intergenic
939083343 2:137687659-137687681 GTGGCAAGTTCCACTTTTCTAGG - Intergenic
939083375 2:137687783-137687805 TTAGCAAGTCCCGCTTTTCTGGG - Intergenic
939445488 2:142304418-142304440 GCGTGTAGTCATGCTTTTCTAGG - Intergenic
939460912 2:142494471-142494493 GCGGCAAGCACCACTTTTCTGGG - Intergenic
940060663 2:149562934-149562956 CCGGGAAGTGCTGCTTTTCTAGG + Intergenic
940107148 2:150113619-150113641 GTGGCAAGTACCTCTTTTCTAGG + Intergenic
940529955 2:154868177-154868199 GTGGCAAATCCCGCTTTTCTGGG + Intergenic
940529988 2:154868298-154868320 GTGGCAAGTCCAACTTTTCTGGG + Intergenic
940676017 2:156724846-156724868 GTGGCAAGTCCCACTTTTCTGGG - Intergenic
941340167 2:164296704-164296726 GCGGTAAGTCCCACTTTTCTGGG + Intergenic
941340198 2:164296829-164296851 GTGGCAAGTCCCGCTTTTCTGGG + Intergenic
941340214 2:164296893-164296915 GTGGCAAGTCCCACTTTTCTAGG + Intergenic
941353177 2:164460093-164460115 GTGGCAAGTCCCGCTTTCCTGGG + Intergenic
941353195 2:164460157-164460179 GCGGCAAGTCCCGCTATCCTAGG + Intergenic
941456390 2:165715180-165715202 GTGGCAAGTCCCGCTTTCCTAGG - Intergenic
941456408 2:165715244-165715266 GTGGCAAGTCCCGCTTTCCTGGG - Intergenic
941936132 2:170982513-170982535 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
942096859 2:172542653-172542675 GCAGCAAGTACCGCTTTTCTGGG + Intergenic
942096891 2:172542772-172542794 GCAGCAAGTACCACTTTTCTAGG + Intergenic
942096904 2:172542832-172542854 GTGGCAAGTACTGCTTTTCTAGG + Intergenic
942114834 2:172718002-172718024 GAGGAATGTCCTGCTTTTCCTGG + Intergenic
943421791 2:187675225-187675247 GCGGCAAGTCCCGCTTTTCTAGG - Intergenic
943449961 2:188034365-188034387 GCGGCAAATGCCGCTTTTCTGGG + Intergenic
943806343 2:192131028-192131050 GCAGCAAGTCCCGCTTTTCTGGG + Intronic
943806434 2:192131397-192131419 GCGGCAAGTCCCGCTTTTCTGGG + Intronic
943806451 2:192131461-192131483 GTGGCAAGTCCCACTTTTCTAGG + Intronic
943834953 2:192507052-192507074 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
943865178 2:192919170-192919192 GTGGCAAGTACTGCTTTTCTGGG + Intergenic
944387210 2:199180266-199180288 GCAGCAAGTCCCACTTTTCTGGG + Intergenic
944387245 2:199180387-199180409 GCGGCAAGTCCTGCTTTTCTAGG + Intergenic
944393902 2:199247800-199247822 GCAGGAAGTCCCGCTTTTCTGGG + Intergenic
944876335 2:203966687-203966709 GCGGCAAGTCCCACTTTTCTAGG - Intergenic
944876368 2:203966804-203966826 GCGGCAAGTCCCACTTTTCTGGG - Intergenic
944907731 2:204279746-204279768 GAGGCAGGTCCAACTTTTCTTGG + Intergenic
945011808 2:205471946-205471968 GTGGTAAGCCCTGCTTCTCTAGG - Intronic
945153345 2:206811721-206811743 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
945173213 2:207018068-207018090 GCGGCAAGTCCTGCTTTTCTGGG + Intergenic
945173245 2:207018193-207018215 GTGGCAAGTCCCACTTTTCTGGG + Intergenic
945301683 2:208220946-208220968 GCAGCAAGTCCTGCTTTTCTGGG - Intergenic
945301717 2:208221067-208221089 GCGTCAAGTCCCGCTTTTCTAGG - Intergenic
945361443 2:208900203-208900225 GTGGCACGTACTGCTTTTCTGGG + Intergenic
945375863 2:209078923-209078945 GCAGCAAGTCCCGCTTTTCTGGG + Intergenic
945375896 2:209079044-209079066 GTGGCAAATCCCGCTTTTCTGGG + Intergenic
945394105 2:209300242-209300264 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
945394122 2:209300306-209300328 GTGGCAAGTCCCGCTTTCCTAGG + Intergenic
945938066 2:215923202-215923224 GCGGCAAGTCCTGCTTTTCTGGG + Intergenic
946215209 2:218178609-218178631 GTGGCAAGTCCCACTTTTCTAGG - Intergenic
946215304 2:218178984-218179006 GCAGCAAGTCCCACTTTTCTGGG - Intergenic
946781266 2:223194644-223194666 GCAGCAAGTCCCGCTTTTCTGGG - Intronic
946886267 2:224226181-224226203 GCATCAAGTCCTGCTTTTCTGGG + Intergenic
946893026 2:224297494-224297516 ATGGCAAGTCCCGCTTTTCTGGG + Intergenic
946893058 2:224297615-224297637 GCAGCAAGTCTCACTTTTCTAGG + Intergenic
948390403 2:237607637-237607659 GTGGCAAGTCCCGCTTTTCTGGG + Intergenic
948390441 2:237607758-237607780 GTGGCAAGTCCCGCTTTTCTGGG + Intergenic
1168739181 20:173671-173693 GCAGCAAGTACCGCTTTTCTAGG + Intergenic
1170069066 20:12344975-12344997 GTGGCAAGTCCTGCTTTTCTAGG - Intergenic
1170069082 20:12345039-12345061 GCGGCAAGTCCCACTTTTCTGGG - Intergenic
1170105989 20:12754717-12754739 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1170106029 20:12754882-12754904 GTGGCAAGTCCCGCTTTTCTGGG + Intergenic
1170165654 20:13358837-13358859 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1170165702 20:13359025-13359047 GCGGCAAGTCCCGCTTTCCTAGG + Intergenic
1170325688 20:15152554-15152576 GTGGCAAGTCCCACTTTTCTAGG - Intronic
1170325721 20:15152677-15152699 GCGGCAAGTCCCACTTTTCTGGG - Intronic
1170820889 20:19755755-19755777 GCGGCAAGTCCCGCTTTCCTAGG - Intergenic
1170820923 20:19755881-19755903 GCGGCAAGTCCTGCTTTTCTGGG - Intergenic
1171231925 20:23493649-23493671 GGGCCAAGTCCTCCTTTTGTTGG - Intronic
1172314767 20:33945057-33945079 ATGACAAGTCCTGCTGTTCTGGG + Intergenic
1172932757 20:38597913-38597935 GCAGCAAGTACCACTTTTCTGGG - Intergenic
1173101642 20:40093982-40094004 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1173101672 20:40094107-40094129 GCGGCAAGTCCCGCTTTTCTAGG + Intergenic
1173118639 20:40269952-40269974 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1173118673 20:40270077-40270099 ATGGCAAGTCCCGCTTTTCTGGG + Intergenic
1173118691 20:40270141-40270163 GTGGCAAGTCCCGTGTTTCTAGG + Intergenic
1173781408 20:45760204-45760226 GTGGCAAGTCCCGCTTTTCTGGG + Intronic
1173781437 20:45760324-45760346 GCGGCAAGTCCTGCTTTTCTAGG + Intronic
1173888521 20:46483153-46483175 GCAGCAAGTCTTGCTTGTTTTGG - Intergenic
1177031361 21:15984431-15984453 GCGGCAAGTACCGCTTTTCTAGG - Intergenic
1177100394 21:16893064-16893086 GTGGCAAGTCCTGTTTTTCTGGG + Intergenic
1177102483 21:16914981-16915003 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1177119331 21:17122344-17122366 GCGGCAAGTACCGCTTTTCTGGG + Intergenic
1178371836 21:32033051-32033073 ACAGCAAGGGCTGCTTTTCTGGG + Intronic
1179015473 21:37591634-37591656 GCGGCAAGTACCGCCTTTCTGGG - Intergenic
1179387289 21:40955659-40955681 GCGGCAAGTCCTGCTTTTCTGGG + Intergenic
1179650553 21:42805662-42805684 GCGGCAAGTACTGCTTTTCTGGG - Intergenic
1180560675 22:16612226-16612248 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
1180560694 22:16612290-16612312 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1180560712 22:16612354-16612376 GTGGCAAGTCCCGCTTTCCTGGG + Intergenic
1180560728 22:16612418-16612440 GTGGCAAGTCCCGCTTTTCTAGG + Intergenic
1182113713 22:27742884-27742906 GTGGCAAGTCCCACTTTCCTGGG + Intergenic
1182113731 22:27742948-27742970 GCGGCAAGTCCCGCTTTCCTAGG + Intergenic
1182113751 22:27743014-27743036 GCGGCAAGTCCTGCTTTCCTAGG + Intergenic
1182732042 22:32503624-32503646 GCGGCAAGTCTCGCTTTTCTGGG + Intergenic
1182732070 22:32503746-32503768 GCTGCTAGTCCCGCTTTCCTAGG + Intergenic
1183801219 22:40166191-40166213 GCTGCAAATCCGGCTTTTGTGGG + Intronic
1184298832 22:43543158-43543180 GTGGCAAGTCCGGCTCTCCTTGG - Intronic
949162334 3:895532-895554 GCGGCAAGTCCCGCTTTTCTAGG - Intergenic
949190562 3:1244327-1244349 GCGGCAAGTCCCACTTTTCTAGG - Intronic
949190580 3:1244391-1244413 GCGGCAAGTCCCGCTTTCCTGGG - Intronic
949190599 3:1244455-1244477 GCGGCAAGTCCCGCTTTCCTGGG - Intronic
949670912 3:6398490-6398512 GCGGCAAGTCCTGCTTTTCTGGG + Intergenic
949670943 3:6398611-6398633 GCGGCAAGTCCCGCTTTTGTAGG + Intergenic
949827201 3:8177873-8177895 GCGGCAAGTCCTGCTTTTCTGGG + Intergenic
949827235 3:8177990-8178012 GTGGCAAGTCCCACTTTTCTGGG + Intergenic
950926252 3:16745132-16745154 GTGGCAAGTCCTGCTTTTCTGGG + Intergenic
950926284 3:16745253-16745275 GTGGCAAGTCCCGCTTTTCTGGG + Intergenic
952651722 3:35735645-35735667 GTGGAAAGTCCTCCTTATCTTGG - Intronic
952663656 3:35879068-35879090 TTGGCAAGTCCTGCTTTTCTAGG - Intergenic
952663690 3:35879193-35879215 GCAGTAAGTCCTGCTTTTCTGGG - Intergenic
952895480 3:38075773-38075795 GTGGCAAGTCCCGCTTTTCTAGG - Intronic
952895511 3:38075898-38075920 GTGGCAAGTCCCGCTTTTCTAGG - Intronic
952896725 3:38082603-38082625 GCGGCAAGTCCCGCTTTTCTAGG - Intronic
952896776 3:38082785-38082807 GCGGCAAGTCCCGCTTTTCTGGG - Intronic
953077389 3:39582745-39582767 GAGGCAAATCCCTCTTTTCTGGG - Intergenic
953135512 3:40178376-40178398 GTGGCAAGTCCTGCTGGGCTGGG + Intronic
953176968 3:40561868-40561890 GCAGCAAGTCCTGCTTTTCTAGG + Intronic
953687706 3:45091197-45091219 GCAGCTAGACCTGCTCTTCTCGG - Exonic
953825913 3:46251009-46251031 GTGGCAAGTCCCACTTTTCTAGG - Intronic
953825942 3:46251134-46251156 GCAGCAAGTCCCACTTTTCTGGG - Intronic
954969460 3:54639166-54639188 GCAGCAAGTCCCGCTTTCCTAGG - Intronic
954969476 3:54639230-54639252 GCGGCAAGTCCCGCTTTTCTGGG - Intronic
954969495 3:54639294-54639316 GCGGCAAGTCCCGCTTTCCTGGG - Intronic
956549152 3:70439466-70439488 GCGGCAAGTCCCACTTTTCTGGG - Intergenic
956709011 3:72023985-72024007 GCGGCAAGTCCCACTTTTCTGGG + Intergenic
957060101 3:75474795-75474817 GCAGCAAGTCCTGTTTTTCTGGG - Intergenic
957060119 3:75474860-75474882 GTGGCAAGTCCCGCTTTTCTGGG - Intergenic
957294968 3:78324545-78324567 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
957317553 3:78588004-78588026 GCGGCAAGTCCCACTTTTCTGGG - Intergenic
958182037 3:90072418-90072440 GGGGCACGTCCTGCTTTTCTGGG - Intergenic
958931697 3:100214521-100214543 TCGGCAATTCCTGCTTGTCCAGG - Intergenic
959288595 3:104444880-104444902 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
959362959 3:105417896-105417918 GCAGTAAGTCCTCCATTTCTAGG - Intronic
959485963 3:106927384-106927406 GTGGCAAGTCCCGCTTTTCTAGG - Intergenic
959972470 3:112422315-112422337 GCGGCAAGTCCTGCTTTCCTAGG - Intergenic
959972502 3:112422440-112422462 ACGGCAAGTCCCGCTTTTCTGGG - Intergenic
960283095 3:115798243-115798265 GCGGCAAGTCCTGCTTTTCTGGG - Intergenic
960310338 3:116110080-116110102 GCAGCAAGTCCCACTTTTCTAGG - Intronic
960310396 3:116110327-116110349 GCGGCAAGACCTGCTTTTCTGGG - Intronic
961164962 3:124757220-124757242 GCGGCAAGTCCCGCTTTCCTAGG - Intergenic
961164980 3:124757284-124757306 GTGGCAAGTCCCGCTTTTCTGGG - Intergenic
961293266 3:125864546-125864568 GTGGCAAGTCCCACTTTTCTGGG + Intergenic
961293284 3:125864611-125864633 GCAGCAAGTCCCACTTTTCTGGG + Intergenic
961711866 3:128834035-128834057 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
961730357 3:128960697-128960719 GCGGCTAGTCCCGCTTTTCTGGG + Intronic
961730374 3:128960761-128960783 GCGGCAAGTCCCGCTTTCCTGGG + Intronic
961730393 3:128960825-128960847 GCGGCAAGTCCCACTTTCCTGGG + Intronic
961730411 3:128960889-128960911 GCGGCAAGTCCCGCTTTTCTAGG + Intronic
961880816 3:130060123-130060145 GTGGCAAGTCCTGCTTTTCTGGG + Intergenic
961880850 3:130060244-130060266 GTGGCAAGTCCCACTTTTCTGGG + Intergenic
961893916 3:130151866-130151888 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
962660437 3:137596502-137596524 GCGGCAAGTCCCTCTTTTCTGGG + Intergenic
963058359 3:141205760-141205782 GCAGCAAGTCCTGCTTTTCTGGG + Intergenic
963058393 3:141205881-141205903 GTGGCAAGTACCGCTTTTCTAGG + Intergenic
963424997 3:145113926-145113948 GTGGCAAGTCCTGCTTTTCTGGG + Intergenic
963425030 3:145114051-145114073 GCGACAAGTCCCACTTTTCTAGG + Intergenic
963456879 3:145555917-145555939 GTGGCAAGTCCTGCTTTTCTAGG - Intergenic
963456913 3:145556038-145556060 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
963468392 3:145711295-145711317 TTAGCAAGTCCTGCTTTTCTGGG + Intergenic
963521392 3:146362947-146362969 GCAGCAAGTCCTGCTTTTCTGGG + Intergenic
963521424 3:146363069-146363091 TTAGCAAGTCCTGCTTTTCTAGG + Intergenic
963663072 3:148152399-148152421 GCGGCAAGTCCTGCTTTTCTGGG + Intergenic
963684074 3:148415135-148415157 GCGGAAAGTCCCGCTTTTCTGGG + Intergenic
963684105 3:148415260-148415282 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
964067582 3:152597873-152597895 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
964125723 3:153231640-153231662 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
964300461 3:155279922-155279944 GTGGCAAGTACCACTTTTCTGGG - Intergenic
964708145 3:159642949-159642971 GGGGCTAGTCCTGCTTTAGTGGG + Intronic
964906731 3:161726655-161726677 GCAGCAAGTCCCGCTTTTCTGGG - Intergenic
964906766 3:161726776-161726798 GTGGCAAGTCCGGCTTTTCTAGG - Intergenic
964906803 3:161726896-161726918 GCAGCAAGTCCCACTTTTCTGGG - Intergenic
964983432 3:162713358-162713380 GCGGCAAGTACTGCTTTTCTGGG + Intergenic
965262863 3:166505545-166505567 GCGGCAAGTCCTGCTTTTCTGGG - Intergenic
965286915 3:166828699-166828721 GCGGCAAGTCCCACTTTTCTAGG - Intergenic
965286946 3:166828824-166828846 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
965336132 3:167432202-167432224 GCGGCAAGTACCGCTTTTCTGGG + Intergenic
965625090 3:170677267-170677289 GTGGCAAGTCCTGCTTTTCTGGG - Intronic
965626519 3:170688092-170688114 GTGGCAAGTTCTGCTTTTCTGGG - Intronic
965626555 3:170688211-170688233 GTGGCAAGTCCTGCTTTTCTAGG - Intronic
965626586 3:170688332-170688354 GCGGCAAGTCCTGCTTTTCTGGG - Intronic
965640295 3:170822893-170822915 GCGGCAAGTCCCGCTTTTCTAGG - Intronic
965713148 3:171577227-171577249 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
965713181 3:171577352-171577374 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
965713198 3:171577416-171577438 GTGGCAAGTCCTGCTTTTCTAGG + Intergenic
965891144 3:173514829-173514851 GCAGCATTTCCTTCTTTTCTAGG + Intronic
966066562 3:175828386-175828408 GTGGCAAGTCCTGCTTTTCTGGG + Intergenic
966066595 3:175828507-175828529 GCAGCAAGTCCTGCTTTTCTAGG + Intergenic
966085208 3:176062200-176062222 ATGGTAAGTCCTGCTTTTCTGGG + Intergenic
966085237 3:176062325-176062347 GCGGCAAGTCCTGCTTTTCTGGG + Intergenic
966105269 3:176326251-176326273 GCAGCAAGTTCCGCTTTTCTAGG - Intergenic
966105285 3:176326315-176326337 GCGGCAAGTCCTGCTTTTCTGGG - Intergenic
966105318 3:176326439-176326461 GCAGCAAGTCCCGCTTTTCTGGG - Intergenic
966233022 3:177670439-177670461 GCGGCAAGTCCCGCTTTTCTAGG - Intergenic
966278953 3:178208040-178208062 GTGGCAAGTACTGCTTTTTTGGG + Intergenic
966278987 3:178208159-178208181 GAGGCAAGTACTGCTTTTCTGGG + Intergenic
966279019 3:178208279-178208301 GCAGCAAGTACCACTTTTCTGGG + Intergenic
966279053 3:178208392-178208414 GTGGCAAGTACCACTTTTCTGGG + Intergenic
966279087 3:178208511-178208533 TAGGCAAGCACTGCTTTTCTGGG + Intergenic
966279117 3:178208629-178208651 GCAGCAAGTACCACTTTTCTAGG + Intergenic
966397476 3:179517932-179517954 GTGGCAAGTACCGCTTTTCTGGG + Intergenic
967151886 3:186658623-186658645 GCGGCAAGTCCCGCTTTTCTAGG + Intergenic
967212370 3:187180225-187180247 GCAGCAAGTCCCGCCTTTCTAGG - Intronic
967212403 3:187180350-187180372 GCGGCAAGTCCCGCTTTTCTGGG - Intronic
967244402 3:187471130-187471152 GCGGCAAGTCCTGCTTTTCTGGG - Intergenic
967496001 3:190145439-190145461 GCGGCAAGTCCTGCTTTTCTAGG + Intergenic
967561169 3:190921061-190921083 GCGTCAAGTCCCGCTTTTCGGGG + Intergenic
967561202 3:190921186-190921208 GCGGCAAGTCCTGCTTTCCTAGG + Intergenic
967624882 3:191671329-191671351 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
967624915 3:191671454-191671476 GCGGCAAGTCCAGCTTTTCTAGG - Intergenic
967644031 3:191900107-191900129 GCAGCAAGTCCCGCTTTTCTAGG - Intergenic
967644065 3:191900228-191900250 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
967658360 3:192075983-192076005 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
967740248 3:192996508-192996530 GCGGCAAGTCCTGCTTTTCTGGG + Intergenic
967740281 3:192996633-192996655 GCGGCAAGTCCTGCTTTTCTAGG + Intergenic
968620589 4:1601889-1601911 GCGGCCAGTCCAGCTTGTGTGGG + Intergenic
968993166 4:3928288-3928310 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
969004023 4:4005021-4005043 GTGGCAAGTCCCGCTTTTCTGGG - Intergenic
969654343 4:8487662-8487684 GTGGTAAGTCCCGCTTTTCTAGG - Intronic
969654372 4:8487787-8487809 GTGGCAAGTCCTGCTTTTCTGGG - Intronic
969748844 4:9095202-9095224 GCAGCAAGTCCCACTTTTCTGGG + Intergenic
969809895 4:9639780-9639802 GTGGCAAGTCCCGCTTTTCTGGG + Intergenic
969809913 4:9639845-9639867 GCAGCAAGTCCCGCTTTTCTGGG + Intergenic
970029420 4:11658402-11658424 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
970041907 4:11807321-11807343 GCAGCAAGTCCCGCTTTTCTAGG + Intergenic
970087351 4:12364714-12364736 GTGGCAAGTCCCACTTTTCTGGG + Intergenic
970087366 4:12364778-12364800 GCAGCAAGTCCTGCTTTTCTAGG + Intergenic
970532520 4:16998639-16998661 GAGGCAAGTCCCGCTTTTCTTGG + Intergenic
970854282 4:20635094-20635116 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
971123383 4:23726706-23726728 GCGGCAAGTCCCGCTTCCCTAGG - Intergenic
971123415 4:23726831-23726853 GCGGCAAGTCCCACTTTTCTGGG - Intergenic
971123444 4:23726956-23726978 GCGGCAAGTCCCACTTTTCTGGG - Intergenic
971180332 4:24324167-24324189 GCGGCAAGTCCTGCTTTTCTGGG + Intergenic
971180364 4:24324293-24324315 GCGGCAAGTCCCGCTTCCCTAGG + Intergenic
971199891 4:24501877-24501899 GCGGCAAGTCCCACTTTTCTGGG + Intergenic
971199971 4:24502186-24502208 ATGGCAAGTCCCGCTTTTCTAGG + Intergenic
971620126 4:28845163-28845185 GCCCCAAGTCTTTCTTTTCTGGG + Intergenic
971738584 4:30490850-30490872 GAACAAAGTCCTGCTTTTCTTGG - Intergenic
974428601 4:61769005-61769027 GCGGCAAGTCCCGCTTTCCTAGG - Intronic
974428619 4:61769069-61769091 GCGGCAAGTCCCGCTTTCCTGGG - Intronic
975865350 4:78718809-78718831 GCAGCAAGTCCTGCTTTCCTGGG - Intergenic
975934108 4:79558735-79558757 GCAGCAAGTCCTGCTTTTCTAGG - Intergenic
975934125 4:79558797-79558819 GTGGCAAGTCCCGCTTTCCTGGG - Intergenic
976558390 4:86475677-86475699 ACGGCAAGTACTGCTTTTCTGGG + Intronic
976558403 4:86475734-86475756 GCGGCAAGTACCGCTTTTCTAGG + Intronic
976696294 4:87922691-87922713 GCGGCAAGTCCCACTTTTCTGGG + Intergenic
976884808 4:89969605-89969627 GCGGCAAGTCCCACTTTTCTGGG - Intergenic
977010000 4:91624528-91624550 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
977010057 4:91624823-91624845 GCGGCAAGTCCTGCTTTTCTGGG + Intergenic
977010098 4:91625009-91625031 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
977013168 4:91659530-91659552 GCGGCAAGTCCCACTTTTCTGGG - Intergenic
977013195 4:91659655-91659677 GCGGCAAGTCCTGCTTTTCTGGG - Intergenic
977041769 4:92026692-92026714 TTGGCAAGTCCCGCTTTTCTGGG + Intergenic
977041835 4:92026939-92026961 GCGGCAAGTCCCACTTTCCTGGG + Intergenic
977041852 4:92027003-92027025 GCAGCAAGTCCTGCTTTTCTAGG + Intergenic
977062828 4:92276735-92276757 GCGGCAAGTCCCACTTTTCTGGG - Intergenic
977075425 4:92443740-92443762 GCGGCAAGTCCTGCTTTTCTGGG - Intronic
977198625 4:94089298-94089320 GTGGCAAGTCCTGCTTTCCTAGG - Intergenic
977198642 4:94089362-94089384 GCAGCAAGTCCTGCTTTCCTGGG - Intergenic
977217311 4:94297739-94297761 GCGGCAAGTCCTGCTTTTCTAGG - Intergenic
977217328 4:94297803-94297825 GCGGCAAGTTCCGCTTTCCTGGG - Intergenic
977217345 4:94297867-94297889 GCGGCAAGTCCCGCTTTCCTGGG - Intergenic
977217380 4:94297992-94298014 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
977225596 4:94388389-94388411 GCGGCAAGTCCTGCTTTTCTGGG - Intergenic
978001317 4:103558444-103558466 GTGACAAGTCCTGCTTTTCTAGG - Intergenic
978001348 4:103558569-103558591 GTGGCAAGTCCTGCTTTTCTGGG - Intergenic
979054839 4:115980409-115980431 GCAGCAAGTCCCTCTTTTCTGGG - Intergenic
979146416 4:117253079-117253101 GCAGCAAGTCCCACTTTCCTAGG + Intergenic
979379646 4:119994563-119994585 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
979850558 4:125566545-125566567 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
979895356 4:126149810-126149832 GTGGCAAGTCCTGCTTTTCTAGG - Intergenic
979895373 4:126149874-126149896 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
980003579 4:127516280-127516302 GCGGCAAGTACCGCTTTTCTGGG - Intergenic
980112146 4:128645607-128645629 GCGGCAAGTACTGCTTTTCTAGG - Intergenic
980112175 4:128645725-128645747 GCGGCAAGTACCACTTTTCTGGG - Intergenic
980284732 4:130768263-130768285 GCAGCAAGTCCCACTTTTCTGGG + Intergenic
980284760 4:130768388-130768410 GCGGCAAGTCCCGCTTTTCTAGG + Intergenic
980388680 4:132119032-132119054 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
980527654 4:134013072-134013094 GCAGCAAGTCCTGCTTTTCTTGG + Intergenic
980527684 4:134013197-134013219 GCGGCAAGTCCCACTTTTCTGGG + Intergenic
980575831 4:134682563-134682585 GTGACAAGTCCCGCTTTTCTGGG - Intergenic
980575866 4:134682684-134682706 GTGGCAAGTCCCACTTTTCTGGG - Intergenic
980611959 4:135171965-135171987 GCTGCAAGTTCTGCTTTTCTAGG - Intergenic
980611975 4:135172029-135172051 GCGGCAAGTCCCGCTCTTCTGGG - Intergenic
980612020 4:135172215-135172237 GCGGCAAGTCCTGCTTTTCTGGG - Intergenic
980903675 4:138928677-138928699 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
980903711 4:138928799-138928821 GCAGCAAGTCCTGCTTTTCTGGG + Intergenic
981040041 4:140214541-140214563 GCGGCAAGTCCTGCTTTTCTTGG + Intergenic
981040074 4:140214666-140214688 GCGGCAAGTCCTGCTTTTCTAGG + Intergenic
981524900 4:145699723-145699745 GTGGCAAGTCCCGCTTTTCTGGG + Intronic
981524946 4:145699909-145699931 GCGGCAAGTCCCGCTTTTCTGGG + Intronic
981539458 4:145833461-145833483 GTGGCAAGTCCCGCTTTCCTGGG + Intronic
982084146 4:151817236-151817258 GCGGCAAGTCCCGCTTTTCTAGG - Intergenic
982084179 4:151817357-151817379 GTGGCAAGTCCTGCTTTTCTGGG - Intergenic
982180680 4:152746046-152746068 GTGGCAAGTCCCGCTTTCCTGGG - Intronic
982180697 4:152746110-152746132 GTGGCAAGTCCCGCTTTCCTGGG - Intronic
982180730 4:152746235-152746257 GCGGCAAGTCCCGCTTTTCTGGG - Intronic
982396921 4:154923563-154923585 GTGGCAAGTACCACTTTTCTAGG - Intergenic
982396952 4:154923681-154923703 GCGGCAAGTCCCACTTTTCTGGG - Intergenic
982414397 4:155113192-155113214 GCGACAAGTCTCGCTTTTCTAGG - Intergenic
982414429 4:155113313-155113335 GCGGCAAGTCCCGCTTTCCTGGG - Intergenic
982497369 4:156108433-156108455 GCGGCAAGTCTCGCTTTTCTGGG - Intergenic
982535185 4:156601083-156601105 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
982535218 4:156601208-156601230 GCGGCAAGTCCCACTTTTCTGGG + Intergenic
982535234 4:156601272-156601294 GCGGCAAGTCCCGCTTTTCTAGG + Intergenic
983023640 4:162710036-162710058 GCGGCAAGTCCCACTTTCCTGGG + Intergenic
983055264 4:163094054-163094076 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
983055300 4:163094198-163094220 GCAGCAAGTCCCGCTTTCCTGGG + Intergenic
983055318 4:163094262-163094284 GTGGCAAGTCCCGCTTTTCTAGG + Intergenic
983345367 4:166521550-166521572 GCAGCAAGTCCTGCTTTTCTGGG + Intergenic
983360148 4:166717022-166717044 GCGGCAAGTCCTGCTTTTCTGGG + Intergenic
983414908 4:167440493-167440515 GCGGCAAGTCCCGCTTTCCTAGG - Intergenic
983414939 4:167440620-167440642 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
983447836 4:167877162-167877184 GCATCAAGTCCCGCTTTTCTGGG + Intergenic
983447852 4:167877224-167877246 GTGGCAAGTCCCGCTTTTCTTGG + Intergenic
983452132 4:167923875-167923897 ACAGCAAGTCCCGCTTTTCTGGG + Intergenic
983659351 4:170117290-170117312 GCGGCAAGCCCTGCTTTTCTGGG + Intergenic
983707481 4:170678497-170678519 GCGGTAAGTCCCGCTTTTCTAGG + Intergenic
983884067 4:172961426-172961448 GCAGCAAGTACCGCTTTTCTGGG - Intronic
984099267 4:175466208-175466230 GCAGCAAGTCCCGCTTTTCTGGG - Intergenic
984165552 4:176299526-176299548 GCGGCAAGTACCGCTTTTCTGGG - Intergenic
984321944 4:178207984-178208006 GCAGCAAGTCCTGCTTTTCTGGG + Intergenic
984393797 4:179169521-179169543 GCGGCAAGTCCCGCTTTTCTAGG - Intergenic
984437041 4:179721386-179721408 GCAGCAAGTCCCACTTTTCTGGG + Intergenic
984700381 4:182815193-182815215 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
984700457 4:182815501-182815523 GCGGCAAGTCCCGCTCTCCTAGG + Intergenic
985435503 4:189926745-189926767 GTGGCAAGTCCCACTTTTCTGGG + Intergenic
985582034 5:703351-703373 GCAGCAAGTCCCGCTTTTCTGGG + Intergenic
985582077 5:703537-703559 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
985582140 5:703784-703806 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
985582156 5:703848-703870 GCGGCAAGTCCCGCTTTTCTAGG + Intergenic
986193300 5:5516424-5516446 GCAGCAAGTACCGCTTTTCTGGG + Intergenic
986193332 5:5516549-5516571 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
986388649 5:7264469-7264491 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
986555774 5:9008674-9008696 GCAGCAAGTCCCACTTTTCTAGG - Intergenic
986555809 5:9008799-9008821 GTGGCAAGTCCCACTTTTCTGGG - Intergenic
986555900 5:9009371-9009393 GTGGCAAGTCCCGCTTTTCTAGG - Intergenic
986555932 5:9009496-9009518 GTGGCAAGTCCCGCTTTTCTGGG - Intergenic
986905552 5:12490766-12490788 GCGGCAAGTCCTACTTTCCTGGG + Intergenic
986905570 5:12490830-12490852 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
986905586 5:12490894-12490916 GCAGCAAGTCCCGCTTTCCTAGG + Intergenic
986919834 5:12667425-12667447 GTGGCAAGTCCCGCTTTTCTGGG - Intergenic
987281795 5:16420826-16420848 GCAGCAAATCCCGCTTTTCTGGG + Intergenic
987281828 5:16420951-16420973 GCGGCAAGTCCTGCTTTTCTAGG + Intergenic
987498333 5:18673554-18673576 GTGGCAAGTCCCGCTTTCCTGGG - Intergenic
987498365 5:18673679-18673701 GCAGCAAGTCCCACTTTTCTGGG - Intergenic
987755555 5:22095510-22095532 GCGGCAAGTACTGCTTTTCTGGG + Intronic
987755579 5:22095629-22095651 GTGGCAAGTACTGCTTTTCTAGG + Intronic
991776642 5:70091672-70091694 GGGGCAAGGGCTGCTTTTCCTGG + Intergenic
991855929 5:70967119-70967141 GGGGCAAGGGCTGCTTTTCCTGG + Intergenic
991869944 5:71099892-71099914 GGGGCAAGGGCTGCTTTTCCTGG + Intergenic
992394413 5:76358142-76358164 GCGGCAAGTCTCGCTTTTCTGGG + Intergenic
992452453 5:76886119-76886141 GCGGCAAGCACCACTTTTCTGGG - Intronic
992549224 5:77845210-77845232 GCGGCAGGTTCTGCCTGTCTAGG - Intronic
992960588 5:81954083-81954105 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
992960622 5:81954204-81954226 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
993192426 5:84699109-84699131 GTGGCAAGTCCCGCTTTTCTGGG + Intergenic
993192489 5:84699377-84699399 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
993836419 5:92824625-92824647 GCAGCAAGTCCCGCTTTTCTGGG + Intergenic
993836454 5:92824750-92824772 GCGGCAAGTCCTACTTTTCTGGG + Intergenic
993836482 5:92824875-92824897 GCGGCAAGTCCTGCTTTTCTGGG + Intergenic
993836512 5:92824999-92825021 GCGGCAAGTCCCACTTTTCTAGG + Intergenic
994294952 5:98080096-98080118 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
994294969 5:98080160-98080182 GCGGCAAGTCCCGCTTTTCTAGG + Intergenic
994532723 5:100988885-100988907 GCAGCAAGTCCCGCTTTTCTAGG - Intergenic
994532737 5:100988949-100988971 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
994532801 5:100989196-100989218 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
994532837 5:100989321-100989343 GTGGCAAGTCCCACTTTTCTGGG - Intergenic
994775466 5:104032559-104032581 GCGGCAAGTCCTGCTTTTCTGGG + Intergenic
994775499 5:104032680-104032702 GCGGCAAGTCCTACTTTTCTGGG + Intergenic
994779242 5:104069379-104069401 GTGGCAAGTCCCTCTTTTCGAGG - Intergenic
994779258 5:104069443-104069465 GTGGCAAGTCCCACTTTTCTGGG - Intergenic
994779288 5:104069568-104069590 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
995125486 5:108573792-108573814 GTGGCAAGTACCGCTTTTCTGGG - Intergenic
995899643 5:117051362-117051384 GCGGCAAGTCCCACTTTTCTAGG - Intergenic
996203508 5:120702498-120702520 ACAGCAAGTCCCGCTTTTCTGGG - Intergenic
996345013 5:122478260-122478282 GCGGCAAGTCCCGCTTTCCTAGG - Intergenic
996509673 5:124304623-124304645 GAGGCAAGTACCGCTTTTCTAGG + Intergenic
996527823 5:124497896-124497918 GTGGCAAGTCCTGCTTTTCTAGG + Intergenic
996527854 5:124498021-124498043 GCAGCAAGTCTCGTTTTTCTGGG + Intergenic
996745765 5:126844786-126844808 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
997746186 5:136302280-136302302 GCGGCAAGTCCCACTTTTCTGGG + Intronic
997746205 5:136302341-136302363 GGGGCAAGTCCCGCTTTTCTGGG + Intronic
997746221 5:136302402-136302424 GCGGCAAGTCCCGCTTTTCTAGG + Intronic
997769880 5:136544364-136544386 GTGGCAAGTCCCGCTTTCCTAGG - Intergenic
997769898 5:136544428-136544450 GCAGCAAGTCCCGCTTTCCTGGG - Intergenic
997769915 5:136544492-136544514 GCAGCAAGTCCCATTTTTCTGGG - Intergenic
997772908 5:136570334-136570356 GTGGCAAGTCCTGCTTTTCTGGG - Intergenic
997788740 5:136737882-136737904 GTGGCAAGTACCGCTTTTCTGGG + Intergenic
998315163 5:141175951-141175973 ACCAAAAGTCCTGCTTTTCTGGG + Exonic
998996583 5:147873540-147873562 GCGGCAAGTCCCAGTTTCCTAGG - Intronic
998996601 5:147873604-147873626 GCGGCAAGTCCCGCTTTCCTGGG - Intronic
999619063 5:153454383-153454405 GCGGCAAGTCCCACTTTCCTAGG - Intergenic
999619096 5:153454504-153454526 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1000519627 5:162280155-162280177 GTGGCAAGTCCCGCTTTTCTGGG - Intergenic
1000519658 5:162280276-162280298 GTGGCAAGTCCTGCTTTTCTGGG - Intergenic
1000885527 5:166743781-166743803 GCAGCAAGTACCGCTTTTCTGGG - Intergenic
1000935864 5:167302675-167302697 GTGGCAAGTACCACTTTTCTAGG - Intronic
1000935895 5:167302796-167302818 GCGGCAAGTCCCGCTTTTCTGGG - Intronic
1001216851 5:169864317-169864339 GCCTTAAGTCCTGCTTTTCCGGG + Exonic
1001331726 5:170766992-170767014 GCGGCAAGTCCCACTTTTCTGGG - Intronic
1002377581 5:178799239-178799261 GCCGAAAGTGGTGCTTTTCTAGG - Intergenic
1002611165 5:180419416-180419438 GCGGCAAGTCCCGCTTTCCTAGG - Intergenic
1002611215 5:180419602-180419624 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1003321389 6:5055167-5055189 TCGAGAAGTCCTGCCTTTCTGGG + Intergenic
1003430360 6:6032471-6032493 GTGGCAAGTCCTGCTTTTCTAGG - Intergenic
1003430377 6:6032535-6032557 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1003430396 6:6032599-6032621 GCGGCAAGTCCCGCTATTCTGGG - Intergenic
1003430430 6:6032724-6032746 GTGGCAAGTCCCACTTTTCTGGG - Intergenic
1003748618 6:9030624-9030646 GGGGCAAGTCATGCTTTACCTGG - Intergenic
1004105966 6:12668032-12668054 GCGGCAAGTCCCACTTTTCTGGG + Intergenic
1004106064 6:12668395-12668417 GCAGCAAGTCCCGCTTTTCTAGG + Intergenic
1004283796 6:14301921-14301943 GCGGCAAGTCCTGCTTTTCTGGG - Intergenic
1004508265 6:16264018-16264040 GCGGCAAGTCCTGCTTTTCTGGG - Intronic
1004574992 6:16886830-16886852 GCGGCAAGTCTCGCTTTTCTGGG + Intergenic
1004768839 6:18759016-18759038 GCAGCAAGTCCCACTTTTCTGGG - Intergenic
1004836799 6:19539888-19539910 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1005014875 6:21366229-21366251 GAGGCAAGTCCCGCTTTTCTAGG - Intergenic
1005014908 6:21366354-21366376 GCGGCAAGTCCTGCTTTTCTGGG - Intergenic
1008169130 6:48180772-48180794 GGGGCAACTCCTGTTTTTTTTGG - Intergenic
1008476307 6:51939128-51939150 GCAGCAAGTACTGCTTTTCTGGG + Intronic
1008476344 6:51939249-51939271 GTGGCAAGTACCGCTTTTCTGGG + Intronic
1008850428 6:56015554-56015576 GTGGCAAGTACCGCTTTTCTAGG - Intergenic
1008850458 6:56015675-56015697 GTGGCAAGTACTGCTTTTCTGGG - Intergenic
1008850490 6:56015794-56015816 GCAGCAAGTACTGCTTTTCTGGG - Intergenic
1008850523 6:56015914-56015936 GCGGCAAGTACCGCTTTTCTGGG - Intergenic
1009343409 6:62586953-62586975 GCAGCAAGTCCCACTTTTCTAGG + Intergenic
1009359180 6:62792593-62792615 GTGGCAAGTACCACTTTTCTAGG + Intergenic
1010071909 6:71753190-71753212 GTGGCAAGTACCACTTTTCTGGG - Intergenic
1010167736 6:72937234-72937256 GGAGCAAGTCCTGCTTTCCCTGG - Intronic
1010586912 6:77665288-77665310 GTGGCAAGTCCCACTTTTCTAGG - Intergenic
1010586929 6:77665352-77665374 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1010586948 6:77665416-77665438 GCGGCAAGTCCCGCTTTCCTGGG - Intergenic
1010586981 6:77665541-77665563 GCAGCAAATCCCGCTCTTCTGGG - Intergenic
1010827114 6:80487109-80487131 GCGGCAAGTCCCGCTTCCCTAGG - Intergenic
1010827146 6:80487235-80487257 GCGGCAAGTCCTGCTTTTCTGGG - Intergenic
1010894834 6:81350266-81350288 GCGGCAAGTCCCGTTTTTCTGGG - Intergenic
1011023607 6:82841683-82841705 GGGGCAAGACCTGCTGTTCATGG - Intergenic
1011054810 6:83193550-83193572 GCGGCAGGCCCTGCGTTCCTGGG + Intronic
1011368084 6:86602962-86602984 GTGGCAAGTACCACTTTTCTGGG - Intergenic
1011368099 6:86603021-86603043 GCGGCAAGTACTGCTTTTCTGGG - Intergenic
1011771139 6:90674865-90674887 GTGACAAGTCCCGCTTTTCTAGG - Intergenic
1012014605 6:93834838-93834860 GTGGCAAGTCCCGCTTTTCTGGG - Intergenic
1012066731 6:94558578-94558600 GTGGCAAGTCCCGCTTTCCTAGG - Intergenic
1012066754 6:94558662-94558684 GCCGCAAGTCCCGCTTTTCTGGG - Intergenic
1012315569 6:97780399-97780421 GTGGCAAGTCCCACTTTTCTGGG + Intergenic
1012674906 6:102102973-102102995 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1012689300 6:102293612-102293634 GCAGCAAGTCTCGCTTTTCTGGG + Intergenic
1012689335 6:102293740-102293762 GTGGCAAGTCCCATTTTTCTGGG + Intergenic
1012689351 6:102293804-102293826 GCGGCAAGTCCTGCTTTCTACGG + Intergenic
1013408141 6:109860694-109860716 GCGGCAAGTCCCACTTTTCTGGG - Intergenic
1013627019 6:111948800-111948822 GCCTCAAATCCTGGTTTTCTTGG + Intergenic
1013891440 6:115032682-115032704 GCAGCAAGTCCCGCTTTTCTGGG + Intergenic
1013891474 6:115032808-115032830 GCGGCAAGTCCTGCTTTCCTGGG + Intergenic
1013891490 6:115032872-115032894 GTGGCAAGTCCCGCTTTTCTAGG + Intergenic
1014360419 6:120467220-120467242 GTAGCAAGTCCCGCTTTTCTGGG - Intergenic
1014395763 6:120925687-120925709 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1014395793 6:120925805-120925827 GCAGCAAGTCCCACTTTTCTAGG + Intergenic
1014455076 6:121625137-121625159 GCGGCAAGTCCCGCTTTTCTAGG - Intergenic
1014455093 6:121625201-121625223 GTGGCAAGTCCCGCTTTTCTGGG - Intergenic
1014455109 6:121625265-121625287 GTGGCAAGTCCTGCTTTTCTGGG - Intergenic
1014455143 6:121625390-121625412 GCAGCAAGTCCCGCTTTTCTGGG - Intergenic
1014555594 6:122840646-122840668 GCAGCAAGTCCCGCTTTTCTGGG + Intergenic
1014611887 6:123557714-123557736 GCAGCAAGCACCGCTTTTCTGGG + Intronic
1014614907 6:123587143-123587165 GTGGCAAGTCCCGCTTTTCTGGG - Intronic
1014718373 6:124891290-124891312 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1014718406 6:124891415-124891437 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1014718422 6:124891479-124891501 GTGGCAAGTCCCTCTTTTCTAGG + Intergenic
1014794219 6:125706666-125706688 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1014794265 6:125706851-125706873 TCGGCAAGTCCCACTTTTCTGGG - Intergenic
1014891331 6:126849726-126849748 GTGGCAAGTCCCGCTTTTCTGGG + Intergenic
1014891350 6:126849789-126849811 GTGGCAAGTCCCGCTTTTCTAGG + Intergenic
1015164970 6:130193162-130193184 GCAGGAAGTCCCACTTTTCTGGG + Intronic
1015165004 6:130193283-130193305 GCAGCAAGTCCCACTTTTCTGGG + Intronic
1015266483 6:131296247-131296269 GCGGCAAGTCCCACTTTTCTGGG + Intergenic
1015266542 6:131296493-131296515 GCGGCAAATCCCACTTTCCTAGG + Intergenic
1015269412 6:131324198-131324220 GCGGCAAGTCCTGCTTTTCTGGG + Intergenic
1015271118 6:131339702-131339724 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1015271169 6:131339890-131339912 GCAGCAAGTCCCGCTTTCCTGGG + Intergenic
1015271187 6:131339954-131339976 GCGGCAAGTCCCGCTTTCCTAGG + Intergenic
1015277937 6:131403809-131403831 GTGGCAAGTCCCACTTTTCTGGG + Intergenic
1015277973 6:131403933-131403955 GTGGCAAGTCCCACTTTTCTAGG + Intergenic
1015323569 6:131902444-131902466 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1015801629 6:137066235-137066257 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1016204306 6:141453673-141453695 GCAGCAAGTTCCACTTTTCTAGG + Intergenic
1016204336 6:141453799-141453821 GTGGCAAGTCCTGCTTTTCCAGG + Intergenic
1016248591 6:142016558-142016580 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1016447643 6:144150091-144150113 GCGGCAGGTCCTGCATCCCTGGG - Intergenic
1016518571 6:144924058-144924080 GCGGCAAGTCCTGCTTTTCTGGG + Intergenic
1016518604 6:144924183-144924205 GTGGCAAGTCCCTCTTCTCTGGG + Intergenic
1016518636 6:144924308-144924330 GTGGCAAGTCCCACTTTTCTAGG + Intergenic
1016534678 6:145097141-145097163 GAGGCAGCTCCTGCATTTCTAGG + Intergenic
1016535983 6:145107996-145108018 GCGGCAAGTCCCGCTTTTCTAGG - Intergenic
1016650572 6:146455439-146455461 GCGACAAGTCCTGCTTTTCTGGG - Intergenic
1016650601 6:146455564-146455586 GCGGCAAGTCCTGCTTTTCTGGG - Intergenic
1016791750 6:148073642-148073664 GGGGAAAGGCTTGCTTTTCTGGG + Intergenic
1016853026 6:148640620-148640642 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1017779529 6:157705371-157705393 GCAGCAAGTCCCACTTTTCTAGG - Intronic
1017779561 6:157705492-157705514 GTGGCAAGTCCCATTTTTCTAGG - Intronic
1017779591 6:157705613-157705635 GTGGCAAGTCCCACTTTTCTGGG - Intronic
1018084713 6:160291317-160291339 GCGGCAAGTCCCGCTTTTCTAGG - Intergenic
1018084747 6:160291438-160291460 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1018495672 6:164343777-164343799 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1018495703 6:164343897-164343919 GCGGCAAGTCCTGCTTTTCTGGG - Intergenic
1018521693 6:164656938-164656960 GTGGCAAGTCCTGCTTTTCTGGG - Intergenic
1018521725 6:164657059-164657081 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1018521759 6:164657180-164657202 GCGGCAAGTCCCACTTTTCTGGG - Intergenic
1020315802 7:6904635-6904657 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1020315834 7:6904760-6904782 GTGGCAAGTCCCACTTTTCTGGG + Intergenic
1020324149 7:6961438-6961460 GCAGCAAGTCCTGCTTTTCTGGG - Intergenic
1020532955 7:9358294-9358316 GCGGCAAGTCCTGCTTTTCTGGG - Intergenic
1020541340 7:9463271-9463293 GCGGCAAGTCTCACTTTTCTGGG - Intergenic
1021393417 7:20121617-20121639 GCAGCAAGTACCGCTTCTCTGGG + Intergenic
1021637093 7:22704235-22704257 GCAGCAAGTACCGCTTTTCTGGG + Intergenic
1021637110 7:22704295-22704317 GTGGCAAGTGCCGCTTTTCTAGG + Intergenic
1021810425 7:24397148-24397170 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1021978050 7:26028710-26028732 GCGGCAAGTCCTGCTTTTCTAGG - Intergenic
1021978068 7:26028774-26028796 GCGGCAAGTCCCGCTTTCCTGGG - Intergenic
1021978101 7:26028899-26028921 GCGGCAAGTCCTGCTTTTCTGGG - Intergenic
1022372660 7:29785841-29785863 GCAGCAAGTCCCACTTTTCTGGG + Intergenic
1022372692 7:29785966-29785988 GCAGCAAGTCCTGCTTTTCTGGG + Intergenic
1022710213 7:32842441-32842463 GTGGCAAGTCCCGCTTTTCTAGG - Intergenic
1022710262 7:32842627-32842649 GCGGCAAGTCCCACTTTTCTGGG - Intergenic
1022854908 7:34304528-34304550 GTGGCAAGTCCCGCTTTTCTAGG - Intergenic
1022854941 7:34304660-34304682 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1023699110 7:42875386-42875408 GCGGCAAGTCCCACTTTCCTGGG - Intergenic
1023699129 7:42875450-42875472 GTGGCAAGTCCCGCTTTCCTGGG - Intergenic
1024697355 7:51870782-51870804 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
1024697374 7:51870846-51870868 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
1024697393 7:51870910-51870932 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
1024697412 7:51870974-51870996 GTGGCAAGTCCTGCTTTCCTGGG + Intergenic
1024697429 7:51871038-51871060 GTGGCAAGTCCCACTTTCCTAGG + Intergenic
1026483743 7:70800191-70800213 GCTGCAACTCCTGCTGTTCTTGG - Intergenic
1027851712 7:83460554-83460576 GCGGCAAGTCCTGCCTTTCTGGG + Intronic
1028689982 7:93640916-93640938 GCAGCAAGTCCCGCTTTTCTAGG + Intronic
1029500006 7:100923119-100923141 GTGGAAAGTACCGCTTTTCTGGG + Intergenic
1029795713 7:102892556-102892578 AGTGCAATTCCTGCTTTTCTGGG - Intronic
1030751670 7:113238116-113238138 GTGGCAAGTCCCTCTTTTCTAGG - Intergenic
1030751688 7:113238180-113238202 GCGGCAAGTCCCGCTTTCCTGGG - Intergenic
1030751739 7:113238366-113238388 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1031004461 7:116456514-116456536 GCGGCAAGTCCCGCTTTTCTGGG + Intronic
1031004479 7:116456578-116456600 GCGGCAAGTCCCACTTTTCTAGG + Intronic
1031355415 7:120781895-120781917 GCGGCAAGTACTGCTTTTCTAGG - Intergenic
1031364947 7:120890388-120890410 GTGGCAAGTCCCACTTTTCTGGG - Intergenic
1031364982 7:120890509-120890531 GCAGCAAGTCCCGCTTTTCTGGG - Intergenic
1031399699 7:121316269-121316291 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1031399822 7:121316743-121316765 GCAGCAAGTCCCGCTTTTCTAGG + Intergenic
1031525316 7:122817620-122817642 GTGGCAAGTCCTGCTTTTCTGGG + Intronic
1031685636 7:124729993-124730015 GCGGCAAGTCCCGCTTTTCTAGG + Intergenic
1031728130 7:125263592-125263614 GCGGCAAGTCCCGCTTTCCTAGG - Intergenic
1031728159 7:125263717-125263739 GCGGCAAGTCCCTCTTTTCTGGG - Intergenic
1031776094 7:125910852-125910874 GTGGCAAGTCCCACTTTTCTGGG + Intergenic
1031777125 7:125918547-125918569 GCAGCAAGTCCCACTTTTCTAGG + Intergenic
1031892270 7:127308774-127308796 GGGACAAGTCCTGATTTTCCTGG - Intergenic
1033211315 7:139462291-139462313 GCAGCAAGCACTGCTTTTCTTGG + Intronic
1033676161 7:143541920-143541942 GCGGCAAGTCCCGCTTTTCTAGG - Intergenic
1033676195 7:143542045-143542067 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1033695638 7:143787394-143787416 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1033695672 7:143787519-143787541 GCGGCAAGTCCCGCTTTTCTAGG + Intergenic
1033909723 7:146248341-146248363 GCGGCAAGTCCCACTTTTCTGGG - Intronic
1034085002 7:148314613-148314635 GCGGCAAGTACCGCTTTTCTAGG - Intronic
1036071116 8:5441305-5441327 GCGGCAAGTACCGCTTTTCTAGG - Intergenic
1036071149 8:5441424-5441446 GTGGCAAGTACCGCTTTTCTGGG - Intergenic
1036281230 8:7403180-7403202 GCGGCAATTCCCGCTTTTCTGGG + Intergenic
1036340236 8:7908392-7908414 GCGGCAATTCCCGCTTTTCTGGG - Intergenic
1036371915 8:8169527-8169549 GCAGCAAGACCTGCTTTTCTGGG + Intergenic
1036371931 8:8169591-8169613 GCAGCATGTCCCACTTTTCTGGG + Intergenic
1036472555 8:9064196-9064218 GCGGCAAGTATCGCTTCTCTAGG - Intronic
1036472589 8:9064319-9064341 GCGGCAAGTACCGCTTTTCTGGG - Intronic
1036639218 8:10571964-10571986 GCAGCAAGTCCCACTTTTCTAGG + Intergenic
1036639256 8:10572093-10572115 GCGGCAAATCCCACTTTTCTAGG + Intergenic
1036878973 8:12496052-12496074 GCAGCATGTCCCACTTTTCTGGG - Intergenic
1036878989 8:12496116-12496138 GCAGCAAGACCTGCTTTTCTGGG - Intergenic
1041623889 8:60002828-60002850 ACTGCAACTCCTGCTTTTTTCGG - Intergenic
1042453284 8:68973870-68973892 GCGGCAAGTCCCGCTTTTCTAGG + Intergenic
1043353873 8:79390781-79390803 GCGGCAAGTCCCGCTTTCCTAGG - Intergenic
1043718151 8:83510058-83510080 GCGGGAAGTCCTGCTTTTCTGGG - Intergenic
1043837466 8:85063691-85063713 GCAGCAAGTCCCACTTTTCTGGG + Intergenic
1043837496 8:85063816-85063838 GCAGCAAGTCCCACTTTTCTGGG + Intergenic
1043837512 8:85063880-85063902 GCAGCAAGTACCACTTTTCTAGG + Intergenic
1044148692 8:88746825-88746847 ACAGCAAGTCCCGCTTTTCTAGG - Intergenic
1044258806 8:90094838-90094860 GCGGCAAGTCCCGCTTTTCTAGG - Intronic
1044258833 8:90094963-90094985 GCAGCAAGTCCCGCTTTTCTGGG - Intronic
1044416838 8:91948871-91948893 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
1044416857 8:91948935-91948957 GCGGTAAGTCCCGCTTTCCTGGG + Intergenic
1044416875 8:91948996-91949018 GTGGCAAGTCCCGCTTTCCTGGG + Intergenic
1044416892 8:91949060-91949082 GCAGCAAGTCCCACTTTCCTAGG + Intergenic
1044921721 8:97175903-97175925 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1044921756 8:97176028-97176050 GCGGCAAGTCCTGCTTTTCTGGG + Intergenic
1044921788 8:97176152-97176174 GTGGCAAGTCCCGCTTTTCTAGG + Intergenic
1044924889 8:97201661-97201683 GCGGCAAGTCCCACTTTTCTGGG + Intergenic
1044924937 8:97201849-97201871 GCGGCAAGTCCTGCTTTCCTGGG + Intergenic
1044924952 8:97201913-97201935 GTGGCAAGTCCCGCTTTTCTAGG + Intergenic
1045197237 8:99944564-99944586 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1045197270 8:99944689-99944711 ACAGCAAGTCTCGCTTTTCTAGG + Intergenic
1045644541 8:104286791-104286813 GCGGCAAGTCCCGCTTTTCTTGG + Intergenic
1046293887 8:112196728-112196750 GCAGCAAGTCCTGCTTTTCTGGG + Intergenic
1046293921 8:112196853-112196875 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1046386605 8:113514465-113514487 GCGGCAAGTCCTGCTTTTCTGGG - Intergenic
1046439825 8:114242495-114242517 GCGGCAAGTCCTGCTTTTTTGGG + Intergenic
1046442955 8:114282587-114282609 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1046442989 8:114282712-114282734 GCGGCAAGTCCCACTTTTCTGGG + Intergenic
1046511860 8:115213143-115213165 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1046511888 8:115213268-115213290 GCGGCAAGTCCTGCTTTCCTAGG + Intergenic
1046559042 8:115815504-115815526 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1046559076 8:115815630-115815652 GCGGCAAGTCCCGCTTTCCTAGG + Intergenic
1046810336 8:118526345-118526367 GGGGCTATTCCTGGTTTTCTTGG - Intronic
1047508683 8:125499670-125499692 GCAGCATGGCCTGCTTTTCATGG - Intergenic
1047699112 8:127432596-127432618 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1047699142 8:127432700-127432722 GCGGCAAGTCCTGCTTTCCTGGG + Intergenic
1047829728 8:128616580-128616602 GCGGCAAGTCCTGCTTTCCTAGG - Intergenic
1047829759 8:128616705-128616727 GCGGCAAGTCTCGCTTTTCTGGG - Intergenic
1047856150 8:128915319-128915341 GCAGCAAGTCCCGCTTTTCTAGG + Intergenic
1048097366 8:131311016-131311038 GTGGCAAGTCCTGCTTTTCTGGG + Intergenic
1048097395 8:131311137-131311159 GCGGCAAGTCCCGCTTTTCTAGG + Intergenic
1048135251 8:131741603-131741625 GTGGCAAGTCCCGCTTTTCTGGG + Intergenic
1048135280 8:131741728-131741750 CTGGCAAGTCCCACTTTTCTAGG + Intergenic
1048168627 8:132084890-132084912 GCGGCAAGTCCTGCTTTCCTAGG - Intronic
1048168678 8:132085079-132085101 GCGGCAAGTCCCACTTTTCTGGG - Intronic
1048585623 8:135771862-135771884 GCGGCAAGTCCCACTTTGCTAGG - Intergenic
1048585685 8:135772108-135772130 GTGGCAAGTCCTGCTTTTCTGGG - Intergenic
1048764422 8:137829503-137829525 GCAGCAAGTCCTGTTTTTCTGGG - Intergenic
1048764438 8:137829567-137829589 GTGGCAAGTCCCGCTTTTCTGGG - Intergenic
1048764473 8:137829692-137829714 GTGGCAAGTCCCGCTTTTCTGGG - Intergenic
1049869023 8:144958994-144959016 GTGGCAAGTCCTGCTTTTCTGGG - Intergenic
1049869056 8:144959115-144959137 GTGGCAAGTCCTGCTTTTCTAGG - Intergenic
1050258313 9:3815896-3815918 GCGGCAAGTCCCACCTTTCTGGG - Intergenic
1050473932 9:6020917-6020939 GCGGCAAGCACTGCTTTTCTGGG + Intergenic
1050895890 9:10885832-10885854 GCGGCAAGTACTGCTTTTCTTGG + Intergenic
1051052405 9:12949277-12949299 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
1051052422 9:12949341-12949363 GAGGCAAGTCCTGCTTTCCTAGG + Intergenic
1051849490 9:21490396-21490418 GCGGCGAGTCCCGCTTTCCTAGG - Intergenic
1051849534 9:21490584-21490606 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1051953589 9:22663185-22663207 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1052191589 9:25669775-25669797 GTGGCAAGTACTGCTTTTCTGGG + Intergenic
1052191618 9:25669893-25669915 GTGGCAAGTACCGCTTTTCTAGG + Intergenic
1052653076 9:31327203-31327225 GCAGCAAGTACCGCTTTTCTGGG + Intergenic
1052716181 9:32120227-32120249 AAGGCAATTCCTACTTTTCTTGG - Intergenic
1053057738 9:35004156-35004178 GCAGCAAGTACTGCTTTTCTAGG + Intergenic
1053057766 9:35004273-35004295 GCTGCAAGTACCACTTTTCTAGG + Intergenic
1054807683 9:69409433-69409455 GCGGCAAGTCCCACTTTTCTGGG - Intergenic
1055232801 9:74086470-74086492 GTGGCAAGTCCTGCTTTTCTGGG + Intergenic
1055232834 9:74086597-74086619 GTGGCAAGTCCCGCTTTTCTGGG + Intergenic
1055232851 9:74086661-74086683 GCGGCAAGTCCTGCTTTTCTAGG + Intergenic
1055347917 9:75356463-75356485 GCGGCAAGTACTGCTTTTCTAGG - Intergenic
1055626455 9:78181547-78181569 GTGGCAAGTCCCACTTTTCTGGG + Intergenic
1055626488 9:78181672-78181694 GCGGCAAGTCCCACTTTTCTAGG + Intergenic
1055809800 9:80138181-80138203 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1055881535 9:81009931-81009953 GCAGCAAGTCCCGCTTTTCTGGG + Intergenic
1055881550 9:81009994-81010016 GCGGCAAGTCCCACTTTTCTGGG + Intergenic
1056044909 9:82705247-82705269 GCGGCAAGTCCCGCTTTTCTAGG - Intergenic
1056044927 9:82705311-82705333 GCGGGAAGTCCCACTTTCCTGGG - Intergenic
1056044949 9:82705375-82705397 GCGGCAAGTCCCACTTTCCTGGG - Intergenic
1056060925 9:82884635-82884657 GTGGCAAGTCCCGCTTTTCTGGG + Intergenic
1056257062 9:84810674-84810696 CCGGGAAGTGCTGCTTATCTGGG + Intronic
1056321564 9:85440161-85440183 GGGGCAAGGCCAGCATTTCTCGG - Intergenic
1056323579 9:85459225-85459247 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1056323626 9:85459411-85459433 GTGGCAAGTCCCACTTTTCTAGG + Intergenic
1056437429 9:86587962-86587984 GCGGCAAGTCCCGCTTTCCTAGG - Intergenic
1056437446 9:86588026-86588048 GCGGCAAGTCCCATTTTCCTGGG - Intergenic
1056437464 9:86588090-86588112 GCGGCAAGTCCCGCTTTCCTGGG - Intergenic
1056437482 9:86588154-86588176 GCGGCAAGTCCCGCTTTCCTGGG - Intergenic
1056437501 9:86588218-86588240 GCGGCAAGTCCCGCTTTCCTGGG - Intergenic
1056437520 9:86588282-86588304 GTGGCAAGTCCCGCTTTCCTGGG - Intergenic
1056437538 9:86588346-86588368 GCGGCAAGTCCTGCTTTCCTGGG - Intergenic
1056522160 9:87411598-87411620 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1056882778 9:90413596-90413618 GCGGCAAGTCCTGCTTTCCTAGG + Intergenic
1057207596 9:93183051-93183073 CCAGGAAGTCCTGCTTCTCTGGG + Intergenic
1057234608 9:93348490-93348512 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1057377781 9:94540822-94540844 GCGGCAAGTCCCGCTTTTCTAGG + Intergenic
1057683717 9:97215461-97215483 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
1057683738 9:97215525-97215547 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
1057683759 9:97215587-97215609 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
1057683777 9:97215650-97215672 GCAGCAAGTCCCGCTTTCCTAGG + Intergenic
1057981765 9:99670672-99670694 GCAGCAAGTCCCGCTTTTCTGGG + Intergenic
1057981781 9:99670736-99670758 GTGGCAAGTCCCGCTTTTCTGGG + Intergenic
1057981799 9:99670800-99670822 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1058026440 9:100145523-100145545 GTGGCAAGTACCACTTTTCTAGG - Intronic
1058026468 9:100145643-100145665 GCAGCAAGTACTGCTTTTCTGGG - Intronic
1058166989 9:101631497-101631519 TAGGGAAATCCTGCTTTTCTGGG + Intronic
1058612189 9:106789133-106789155 GCGGCAAGTCCCACTTTTCTGGG + Intergenic
1059423356 9:114206168-114206190 GGGGCAAGTCCTGCCTCTTTGGG - Intronic
1059546385 9:115179456-115179478 GCAGCAAGTCCTGCTTTTCTTGG - Intronic
1059574343 9:115474084-115474106 GCAGCAAGTCCCGCTTTTCTAGG + Intergenic
1059574393 9:115474270-115474292 GCGGCAAGTCCCACTTTTCTGGG + Intergenic
1059574411 9:115474334-115474356 GCGGCAAGTCCTGCTTTTCTGGG + Intergenic
1059574427 9:115474398-115474420 GTGGCAAGTCCTGCTTTCCTAGG + Intergenic
1059606906 9:115843891-115843913 GCGGCAAGTCCCGCTTTCCTAGG - Intergenic
1059606939 9:115844016-115844038 GCGGCAAGTCCTGCTTTTCTGGG - Intergenic
1059863687 9:118490360-118490382 GCGGCAAGTCCCGCTTTCCTAGG - Intergenic
1059863716 9:118490485-118490507 GCAGCAAGTCCTGCTTTTCTGGG - Intergenic
1060225923 9:121790900-121790922 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1060318669 9:122535275-122535297 GTGGCAAGTCCTGCTTTTCTGGG - Intergenic
1060738105 9:126079418-126079440 GCGGCAAGTCCCACTTTTCTAGG - Intergenic
1060738135 9:126079543-126079565 GTGGCAAGTCCTGCTTTTCTGGG - Intergenic
1185858758 X:3559007-3559029 GCAGCAAGTCCTGCTTTTCTAGG - Intergenic
1185858790 X:3559131-3559153 GTGGCAAGTCCCACTTTTCTGGG - Intergenic
1185858821 X:3559256-3559278 GCGACAAGTCCCGCTTTTCTGGG - Intergenic
1185960857 X:4545022-4545044 GCAGCAAGTCCCACTTTTCTAGG - Intergenic
1185960873 X:4545086-4545108 GTGGCAAGTCCTGCTTTCCTGGG - Intergenic
1185960895 X:4545152-4545174 GCGGTAAGTCCCGCTTTTCTAGG - Intergenic
1185960957 X:4545399-4545421 GCAGCAAGTCCCGCTTTTCTGGG - Intergenic
1185990834 X:4892501-4892523 GTGGCAAGTCCCGCTTTTCTAGG + Intergenic
1186091387 X:6052485-6052507 CCTTCAAGTCCTGCCTTTCTTGG - Intronic
1186113093 X:6276934-6276956 GCGGCAAGTCCCGCTTTTCTAGG - Intergenic
1186783870 X:12940853-12940875 GTGGCAAGTCCCGCTTTTCTAGG + Intergenic
1187086767 X:16049552-16049574 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1188333212 X:28897236-28897258 GCGGCAAGTACAGCTTTTCTAGG - Intronic
1188463585 X:30453815-30453837 GTGGCAAGTCCCACTTTTCTAGG - Intergenic
1188463612 X:30453939-30453961 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1188552464 X:31378616-31378638 GCGGCAAGTACCGCTTTTCTCGG + Intronic
1192705899 X:73528573-73528595 GCAGCAATCACTGCTTTTCTGGG + Intergenic
1193885712 X:86982737-86982759 GCAGCAAGTCCTGCTTTTCTGGG + Intergenic
1193885745 X:86982858-86982880 GTGGCAAGTCCTGCTTTTCTGGG + Intergenic
1193941222 X:87682580-87682602 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1193941281 X:87682827-87682849 GCAGCAAGTCCTGCTTTTCTGGG + Intergenic
1194186435 X:90777992-90778014 GCAGCAAGTCCTGCTTTCCTAGG - Intergenic
1194186493 X:90778233-90778255 GCGGAAAGTCCTGCTTTTCAGGG - Intergenic
1194293813 X:92104903-92104925 GTGGCAAGTCCCGCTTTCCTAGG - Intronic
1194293829 X:92104967-92104989 GTGGCAAGTCTCGCTTTCCTGGG - Intronic
1194308773 X:92277892-92277914 GCGGCAAGTCCCGCTTTTCTGGG - Intronic
1194351042 X:92825332-92825354 GCAGCAAGTCCCGCTTTTCTGGG + Intergenic
1194351076 X:92825459-92825481 GCGGCAAGTCCCACTTTCCTGGG + Intergenic
1194351094 X:92825523-92825545 GCGGCAAGTCCTGCTTTCCTAGG + Intergenic
1194366868 X:93023821-93023843 GCGACAAGTCCCACTTTTCTGGG + Intergenic
1194366902 X:93023942-93023964 GTGGCAAGTCCCACTTTTCTAGG + Intergenic
1194503226 X:94703702-94703724 GTGGCAAGTCCTGCTTTTCTGGG - Intergenic
1194660443 X:96624857-96624879 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1194822965 X:98528971-98528993 GTGGCAAGTCCCGCTTTTCTAGG - Intergenic
1194822983 X:98529035-98529057 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1194823017 X:98529160-98529182 GCGTCAAGTCCCGCTTTTCTGGG - Intergenic
1194874048 X:99164313-99164335 GCTGCAAGCCCTGCTTTCCTGGG - Intergenic
1195841232 X:109179230-109179252 GCGGCAAGTCCTGCTTTTCTGGG + Intergenic
1195908873 X:109869888-109869910 GCGGCAAGTCCCACTTTCCTAGG - Intergenic
1195908891 X:109869950-109869972 GCGGCAAGTCCCGCTTTCCTGGG - Intergenic
1196072825 X:111544699-111544721 GCGGCAAGTCCCACTTTTCTGGG + Intergenic
1196165269 X:112531294-112531316 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1196165296 X:112531419-112531441 GCGGCAAGTCCCGCTTTTCTGGG + Intergenic
1196221210 X:113113513-113113535 GCAGCAAGTACCGCTTTTCTGGG - Intergenic
1196330574 X:114467562-114467584 GCGGCAAGTCCCACTTTTCTGGG + Intergenic
1196341965 X:114606206-114606228 GCGGCAAGTCCCGCTTTTCTGGG - Intronic
1196341994 X:114606331-114606353 GCGGCAAGTCCCGCTTTTCTGGG - Intronic
1196525682 X:116725646-116725668 GTGGCAAGTACCACTTTTCTAGG - Intergenic
1196533735 X:116817174-116817196 GCGGCAAGTCCCACTTTCCTAGG - Intergenic
1196533753 X:116817238-116817260 GTGGCAAGTCCCGCTTTCCTGGG - Intergenic
1196572259 X:117280030-117280052 GCAGCAAGTCCCGCTTTTCTGGG + Intergenic
1196572324 X:117280276-117280298 GCGGCAAGTCCCACTTTCCTGGG + Intergenic
1196572341 X:117280340-117280362 GCAGCAAGTCCCGCTTTTCTAGG + Intergenic
1196774056 X:119322443-119322465 GCAGCAAGTCCCGCTTTTCTAGG - Intergenic
1196774087 X:119322568-119322590 GTGGCAAGTCCTGCTTTTCTGGG - Intergenic
1196992926 X:121347802-121347824 CCGGCAAGTACCGCTTTTCCAGG - Intergenic
1197064676 X:122222906-122222928 GCCGCAAGTCCCGCTTTTCTGGG + Intergenic
1197352255 X:125393526-125393548 GCAGCAAGTCCTGCTTTTCTAGG - Intergenic
1197352284 X:125393651-125393673 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1197470726 X:126863962-126863984 GCTGCAAGTCCCACTTTTCTGGG + Intergenic
1197932840 X:131712899-131712921 GCGGCAAGTCCCGCTTTTCTAGG + Intergenic
1197932870 X:131713020-131713042 GCAGCAAGTCCCACTTTTCTGGG + Intergenic
1198598188 X:138259511-138259533 GCAGCAAGTCCTGCTTTTCTAGG + Intergenic
1198598223 X:138259636-138259658 GTGGTAAGTCCCGCTTTTCTAGG + Intergenic
1198599600 X:138269037-138269059 GCAGCAAGTCCCGCTTTTCTGGG - Intergenic
1198599632 X:138269158-138269180 GCGGCAAGTCCCGCTTTTCTGGG - Intergenic
1199576220 X:149316484-149316506 GCAGCAAGTCCCACTTTTCTGGG + Intergenic
1199576253 X:149316609-149316631 GCAGCAAGTCCCGCTTTTCTAGG + Intergenic
1199576286 X:149316734-149316756 GTGGCAAGTCCCACTTTTCTAGG + Intergenic
1200313892 X:155110421-155110443 TTGGCAAGTTGTGCTTTTCTAGG + Intronic
1200533034 Y:4360068-4360090 GCGGCAAGTCCTGCTTTCCTAGG - Intergenic
1200533094 Y:4360309-4360331 GCAGAAAGTCCCGCTTTTCAGGG - Intergenic
1200611330 Y:5329444-5329466 GTGGCAAGTCCCGCTTTCCTAGG - Intronic
1200611348 Y:5329508-5329530 GCGGCAAGTCCCTCTTTCCTGGG - Intronic
1200659369 Y:5942012-5942034 GCGGCAAGTCCCGCTTTCCTGGG + Intergenic
1200659405 Y:5942139-5942161 GCGGCAAGCCCTGCTTTCCTGGG + Intergenic
1200659422 Y:5942203-5942225 GCAGCAAGTCCTGCTTTCCTAGG + Intergenic
1200675090 Y:6140077-6140099 GCGACAAGTCCCACTTTTCTGGG + Intergenic
1200675124 Y:6140198-6140220 GTGGCAAGTCCCGCTTTTCTAGG + Intergenic
1201581152 Y:15513171-15513193 GCAGCAAGTCCTGCTTTTCTGGG + Intergenic
1201936848 Y:19419354-19419376 GTGGCAAGTCCTGCTTTTCTGGG + Intergenic
1201936869 Y:19419458-19419480 GCGGCAAGTCCCACTTTTCTAGG + Intergenic
1202076754 Y:21044147-21044169 GCAGCAAGTCCTGCTTTTCTAGG - Intergenic
1202076780 Y:21044273-21044295 GCAGCAAGGCCTGCTTTTCTGGG - Intergenic