ID: 977217314

View in Genome Browser
Species Human (GRCh38)
Location 4:94297751-94297773
Sequence GGACTTGCCGCTAAGGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977217309_977217314 -9 Left 977217309 4:94297737-94297759 CCCCTAGAAAAGCAGGACTTGCC No data
Right 977217314 4:94297751-94297773 GGACTTGCCGCTAAGGGTGAAGG No data
977217308_977217314 -8 Left 977217308 4:94297736-94297758 CCCCCTAGAAAAGCAGGACTTGC No data
Right 977217314 4:94297751-94297773 GGACTTGCCGCTAAGGGTGAAGG No data
977217310_977217314 -10 Left 977217310 4:94297738-94297760 CCCTAGAAAAGCAGGACTTGCCG No data
Right 977217314 4:94297751-94297773 GGACTTGCCGCTAAGGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977217314 Original CRISPR GGACTTGCCGCTAAGGGTGA AGG Intergenic