ID: 977217314 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:94297751-94297773 |
| Sequence | GGACTTGCCGCTAAGGGTGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 977217310_977217314 | -10 | Left | 977217310 | 4:94297738-94297760 | CCCTAGAAAAGCAGGACTTGCCG | No data | ||
| Right | 977217314 | 4:94297751-94297773 | GGACTTGCCGCTAAGGGTGAAGG | No data | ||||
| 977217308_977217314 | -8 | Left | 977217308 | 4:94297736-94297758 | CCCCCTAGAAAAGCAGGACTTGC | No data | ||
| Right | 977217314 | 4:94297751-94297773 | GGACTTGCCGCTAAGGGTGAAGG | No data | ||||
| 977217309_977217314 | -9 | Left | 977217309 | 4:94297737-94297759 | CCCCTAGAAAAGCAGGACTTGCC | No data | ||
| Right | 977217314 | 4:94297751-94297773 | GGACTTGCCGCTAAGGGTGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 977217314 | Original CRISPR | GGACTTGCCGCTAAGGGTGA AGG | Intergenic | ||