ID: 977217314

View in Genome Browser
Species Human (GRCh38)
Location 4:94297751-94297773
Sequence GGACTTGCCGCTAAGGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1527
Summary {0: 457, 1: 585, 2: 275, 3: 104, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977217310_977217314 -10 Left 977217310 4:94297738-94297760 CCCTAGAAAAGCAGGACTTGCCG 0: 13
1: 152
2: 413
3: 413
4: 271
Right 977217314 4:94297751-94297773 GGACTTGCCGCTAAGGGTGAAGG 0: 457
1: 585
2: 275
3: 104
4: 106
977217309_977217314 -9 Left 977217309 4:94297737-94297759 CCCCTAGAAAAGCAGGACTTGCC 0: 31
1: 190
2: 354
3: 230
4: 230
Right 977217314 4:94297751-94297773 GGACTTGCCGCTAAGGGTGAAGG 0: 457
1: 585
2: 275
3: 104
4: 106
977217308_977217314 -8 Left 977217308 4:94297736-94297758 CCCCCTAGAAAAGCAGGACTTGC No data
Right 977217314 4:94297751-94297773 GGACTTGCCGCTAAGGGTGAAGG 0: 457
1: 585
2: 275
3: 104
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977217314 Original CRISPR GGACTTGCCGCTAAGGGTGA AGG Intergenic
900560408 1:3302860-3302882 GGACTTGCACCGAGGGGTGAAGG - Intronic
900840544 1:5045675-5045697 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
900840585 1:5045863-5045885 GGACTTGCCACTAAGGGTGAAGG - Intergenic
900899027 1:5504329-5504351 GGCTTTGCCCCTAACGGTGAGGG - Intergenic
901602709 1:10434421-10434443 AGACTTGCCATGAAGGGTGAAGG + Intronic
901765504 1:11497353-11497375 GGACTTGGGGGGAAGGGTGAGGG - Intronic
902924380 1:19686309-19686331 GGACTTTCCTTTAAGGCTGAAGG + Intronic
904711401 1:32433189-32433211 GGACTTGCAGCTAAGGGTGAAGG - Intergenic
904711436 1:32433310-32433332 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
904849714 1:33448128-33448150 GGCCTTGCCTCTGAGGGTGAAGG + Intergenic
904996674 1:34636658-34636680 GGACTTGCTGCCAAGGGTGAAGG + Intergenic
905060754 1:35137151-35137173 GTACTTGCCGCTAAGGGTGAAGG + Intergenic
905499544 1:38425963-38425985 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
905499574 1:38426084-38426106 GTACTTGCCGCTAAGGGTGAAGG - Intergenic
906080676 1:43086361-43086383 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
906080710 1:43086478-43086500 GGACTTGCCACTAAGGGTAAAGG - Intergenic
906613748 1:47221124-47221146 GGACTTTATCCTAAGGGTGATGG + Intronic
906744746 1:48213827-48213849 GGACTTGCCTATAAGGGTGAAGG + Intergenic
906744780 1:48213952-48213974 GGACTTGCCACTAAGGGTGAAGG + Intergenic
907292397 1:53425195-53425217 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
907292430 1:53425320-53425342 GGACTTGCTGCTAAGGATGAAGG - Intergenic
907503779 1:54902615-54902637 GGACTTGCCACTAAGGGTGAAGG + Intergenic
907503814 1:54902736-54902758 GGACTTGCCACTAAGGGTGAAGG + Intergenic
907521042 1:55023608-55023630 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
907719625 1:56959648-56959670 GGACTTGATCCTAAGGGTCATGG + Intronic
908461921 1:64354742-64354764 GGACTTGCCACTAAGGGTGAAGG + Intergenic
908461955 1:64354867-64354889 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
908592184 1:65646703-65646725 GGACTTGCCACTAAGAGTGAAGG + Intergenic
908592212 1:65646830-65646852 GGACTTGCCGCTAAGAGTGAAGG + Intergenic
908592228 1:65646894-65646916 GAACTTGCCGCTAAGGGTGAAGG + Intergenic
908592290 1:65647141-65647163 AGACTTGCCGCTAAGGGTGAAGG + Intergenic
908852099 1:68386877-68386899 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
908852177 1:68387185-68387207 GGACTTGCCACTAAGGGTGAAGG - Intergenic
908852195 1:68387249-68387271 GGACTTGCCGCTAAAGGTGAAGG - Intergenic
908852210 1:68387313-68387335 GGACTTGTCACTAAGGGTGAAGG - Intergenic
909014541 1:70368499-70368521 GTGCTTGCCACTAAGGGTGAAGG - Intronic
909035242 1:70589234-70589256 GGACTTGCCACTAAGGGTGAAGG - Intergenic
909222849 1:72984516-72984538 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
909222867 1:72984579-72984601 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
909223848 1:72992499-72992521 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
909223866 1:72992563-72992585 GGACTTGCCACTAAGGGTGAAGG + Intergenic
909223885 1:72992627-72992649 GGACTTGCCACTAAGGGTGAAGG + Intergenic
909223904 1:72992691-72992713 GGACTTGCCACTAAGGGTGAAGG + Intergenic
909551225 1:76899516-76899538 GGACTTGCCGCTAAGGGTGAAGG + Intronic
909776898 1:79493247-79493269 GGACTTGCCTCTAAGGGTGAAGG + Intergenic
909788470 1:79643501-79643523 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
909788501 1:79643621-79643643 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
909793214 1:79701172-79701194 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
909909699 1:81246168-81246190 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
909909734 1:81246293-81246315 GGACTTGCCGCAAAGGGTGAAGG - Intergenic
909978640 1:82072156-82072178 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
909978673 1:82072281-82072303 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
910049135 1:82956162-82956184 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
910079729 1:83327262-83327284 AGACTTCCAGGTAAGGGTGAGGG - Intergenic
911510817 1:98805955-98805977 GTACTTGCCACTAAGGGTGAAGG + Intergenic
911570143 1:99510387-99510409 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
911570174 1:99510512-99510534 GGTCTTGCCACGAAGGGTGAAGG - Intergenic
911570191 1:99510576-99510598 GGACTTGCCACTAAGAGTGAAGG - Intergenic
911759961 1:101602633-101602655 GTACTGGCTGCTAAGGGTGAAGG + Intergenic
912296274 1:108473945-108473967 GGACTTGCTGCTAAGAGTGAAGG - Intergenic
913241594 1:116834880-116834902 GGACTTCCTGCTAAGAGTCAGGG - Intergenic
916193317 1:162199694-162199716 GGACTGGCTGTTAAGGGTGGTGG - Intronic
918346761 1:183614081-183614103 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
918346915 1:183614694-183614716 GGACTTGTTGCTAAGGGTGAAGG - Intergenic
918567883 1:185953043-185953065 GGACTTGCCACTAAGGGTGAAGG + Intronic
918567902 1:185953107-185953129 GGACTTGCCACTAAGGGTGAAGG + Intronic
918567949 1:185953296-185953318 AGACTTGCTGCTAAGGGTGAAGG + Intronic
918714601 1:187770180-187770202 GGACTTGCCACTAAGGGTGAAGG + Intergenic
918714619 1:187770244-187770266 GGAGTTGCCACTAAGGGTGAAGG + Intergenic
918714635 1:187770306-187770328 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
919476131 1:198035497-198035519 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
919476164 1:198035618-198035640 GGACTTGCCTCTAAGGGTGAAGG - Intergenic
920829128 1:209449685-209449707 GGACTTGCCACTAAGGGTGAAGG - Intergenic
920829163 1:209449812-209449834 GGACTTGCCACTAAGGGTGAAGG - Intergenic
920829180 1:209449876-209449898 GGACTTGCCACTAAGGGTGAAGG - Intergenic
920829199 1:209449940-209449962 GGACTTGCCGCTCAGGGTGAAGG - Intergenic
920901705 1:210115384-210115406 GTGCTTGCCACTAAGGGTGAAGG + Intronic
920990299 1:210931506-210931528 GGACTTGGGGGAAAGGGTGAGGG + Intronic
921212217 1:212910516-212910538 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
921459995 1:215414714-215414736 GGACTCGCCGCTAAGGGTGAAGG + Intergenic
921460011 1:215414778-215414800 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
921509060 1:216008981-216009003 GGACTTGCTGCTAAGGGTGAAGG - Intronic
921519909 1:216146490-216146512 GGACTTGGCGCTAAGGGTGAAGG - Intronic
921519929 1:216146554-216146576 GGACTTGCCGCTAAGGGTGAAGG - Intronic
921733178 1:218598493-218598515 GGACTTGTCGCTAAGGGTGAAGG + Intergenic
921733195 1:218598557-218598579 GGACTTGGCGCTAAGGGTGAAGG + Intergenic
921733213 1:218598621-218598643 GGACTTGCCACTAAGGGTGAAGG + Intergenic
921733347 1:218599173-218599195 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
922048174 1:221966794-221966816 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
922048207 1:221966919-221966941 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
922048225 1:221966983-221967005 GGACTTACCGCTAAGGGTGAAGG - Intergenic
922049752 1:221977869-221977891 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
922049770 1:221977933-221977955 GGACTTGCCAGTAAGGGTGAAGG + Intergenic
922049801 1:221978057-221978079 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
922154276 1:223029127-223029149 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
922154303 1:223029251-223029273 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
922363742 1:224845130-224845152 GTGCTTGCCACTAAGGGTGAAGG + Intergenic
922363765 1:224845224-224845246 GTGCTTGCCGCTAAGGGTGAAGG + Intergenic
922906151 1:229175207-229175229 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
922906181 1:229175332-229175354 GGACTTGCTGCTAAGTGTGAAGG - Intergenic
922934573 1:229413244-229413266 GGATTTGCTGCTAAGGGTGAAGG - Intergenic
922934637 1:229413487-229413509 AGACTTGCCACTAAGGGTGAAGG - Intergenic
923074971 1:230602087-230602109 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
923075003 1:230602208-230602230 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
923214365 1:231834786-231834808 GTACTTGCCACTAACGGTGAAGG + Intronic
923244506 1:232118993-232119015 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
923244540 1:232119118-232119140 GGACTTGCCACTAAGGGTGAAGG - Intergenic
923257486 1:232233974-232233996 GGACTTGCCACTAAGGGTGAAGG + Intergenic
923257516 1:232234099-232234121 GGACTTGCAGCTAAGGGTGAAGG + Intergenic
923408820 1:233688179-233688201 AGATTTGCTGCTAACGGTGAAGG + Intergenic
923408839 1:233688262-233688284 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
923408859 1:233688345-233688367 GGACTTGCCACTAAGGGTGAAGG + Intergenic
923408878 1:233688409-233688431 GGACTTGCCACTAAGGGTGAAGG + Intergenic
923408912 1:233688534-233688556 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
923770915 1:236936849-236936871 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
923770962 1:236937034-236937056 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
923962526 1:239102057-239102079 GGACTTGCCACTAAGGGTGAAGG - Intergenic
923962559 1:239102181-239102203 GGACTTGCCGCTAAGAGTGAAGG - Intergenic
924180391 1:241434729-241434751 GGTCTTGCCGCTAAGGGTGAAGG - Intergenic
924180423 1:241434854-241434876 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
924332671 1:242955685-242955707 GGACTTGAACATAAGGGTGATGG + Intergenic
924896263 1:248340240-248340262 AGGCTTGCCACTAAGGGTGAAGG + Intergenic
1063081555 10:2772568-2772590 GGAATTGGCGCCCAGGGTGATGG - Intergenic
1063362867 10:5471617-5471639 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1063362900 10:5471742-5471764 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1063509818 10:6634381-6634403 GGACTTGCCACTAAGAGTGAAGG + Intergenic
1063509835 10:6634445-6634467 GGACTTGTCGCTAAGGGTGAAGG + Intergenic
1063509881 10:6634631-6634653 GGAATTGCTGCTAAGGGTGAAGG + Intergenic
1063527873 10:6801794-6801816 GGACTTGCCACTAAGAGTGAAGG + Intergenic
1063527932 10:6802041-6802063 GAAATTGCCGCTAAGGGTGAAGG + Intergenic
1064664003 10:17631469-17631491 GGACTTGCCTCTAAGGGTGAAGG + Intergenic
1064664038 10:17631595-17631617 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1064672763 10:17732985-17733007 GGACTTACAGCCAAGGGTGGAGG + Intergenic
1064887242 10:20124083-20124105 GAACTTGCCGCTAAGGATGAAGG + Intronic
1065437391 10:25717257-25717279 GTACTTGCCGCTAAGGGTGAAGG - Intergenic
1065443401 10:25773910-25773932 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1065443420 10:25773974-25773996 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1066005935 10:31146244-31146266 TGACTTGCTGCTAAGGTGGAAGG + Intergenic
1066211204 10:33240538-33240560 AGACTTGCAGATGAGGGTGATGG + Intronic
1068058555 10:52038536-52038558 GGACTTGCCGCTAAGAGTGAAGG + Intronic
1068058587 10:52038661-52038683 GGACTTGCTGCTAAGGGTGAAGG + Intronic
1068179850 10:53503734-53503756 GGACTTGCCGCTAAGCGTGAAGG + Intergenic
1068179882 10:53503859-53503881 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1068230721 10:54167551-54167573 GGACTTGCCGCTAAGGGTGAAGG - Intronic
1068360608 10:55972339-55972361 GTACTTGCCTCTAAGGGTGAAGG - Intergenic
1068456049 10:57255421-57255443 GGACTTGGGGGAAAGGGTGAGGG - Intergenic
1068592562 10:58865789-58865811 GGACTTGCCACTAAGGATGAAGG + Intergenic
1068592596 10:58865914-58865936 GGATTTGCTGCTAAGGGTGAAGG + Intergenic
1070474599 10:76819147-76819169 GGACTTGCCGCTAAGGGCGAAGG - Intergenic
1070474619 10:76819211-76819233 GGACTTGCCGCTGAGGGTGAAGG - Intergenic
1070474639 10:76819275-76819297 GGACTTGCCGCTGAGGGTGAAGG - Intergenic
1070474658 10:76819339-76819361 GGACTTGCCGCTGAGGGTGAAGG - Intergenic
1070474678 10:76819403-76819425 GGACTTGCCGCTGAGGGTGAAGG - Intergenic
1070474697 10:76819467-76819489 GGACTTGCCGCTGAGGGTGAAGG - Intergenic
1070474716 10:76819531-76819553 GGACTTGCCGCTGAGGGTGAAGG - Intergenic
1070474734 10:76819595-76819617 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1071897932 10:90085769-90085791 GGACTTGCCGCTAAGAGTGAAGG + Intergenic
1071897967 10:90085894-90085916 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
1071915967 10:90295848-90295870 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1071916012 10:90296030-90296052 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1071960849 10:90808166-90808188 GGACTTGCCGCTAAGGGTGAAGG - Intronic
1071960882 10:90808284-90808306 GGACTTGCTGCTAAGAGTGAAGG - Intronic
1071960910 10:90808405-90808427 GGACTTGCCGCTAAGGATGAAGG - Intronic
1072011522 10:91306402-91306424 CTACTTGCCGCTAAGGGTGAAGG + Intergenic
1072011538 10:91306462-91306484 GTACTTGCTGCTAAGGGTCAAGG + Intergenic
1073683348 10:105728444-105728466 GTACTTGCCACTAAGGGTGAAGG - Intergenic
1073709662 10:106022189-106022211 GTACTTGCCGCTAAGGGTGAAGG + Intergenic
1074018810 10:109563296-109563318 GTACTTGCTGCTAAGGGTGAAGG - Intergenic
1074740535 10:116481523-116481545 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1074740568 10:116481644-116481666 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1075248488 10:120845834-120845856 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1075248507 10:120845898-120845920 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1077590079 11:3484377-3484399 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
1077611935 11:3648746-3648768 GGACTTGCCGCTAAGGGTGAAGG - Intronic
1077611966 11:3648871-3648893 GGACTTGCCGCTAAGGGTGAAGG - Intronic
1077766645 11:5165244-5165266 GGATTTGCCGCTAAGGGTGAAGG + Intronic
1077851043 11:6074795-6074817 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1077851061 11:6074858-6074880 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1077851087 11:6074983-6075005 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1077883165 11:6366875-6366897 GTACTTGCCACTAAGGGTGAAGG - Intergenic
1078046344 11:7916953-7916975 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1078046362 11:7917017-7917039 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1079447252 11:20568752-20568774 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1079447269 11:20568816-20568838 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1079672753 11:23188582-23188604 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
1079672818 11:23188831-23188853 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1079727293 11:23891943-23891965 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1079727325 11:23892064-23892086 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1080028123 11:27633843-27633865 GGACTTGCCACTAAGAGTGAAGG + Intergenic
1080028141 11:27633907-27633929 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1080028175 11:27634032-27634054 GGACCTGCCGCTAAGGGTGAAGG + Intergenic
1080227146 11:29974230-29974252 ATGCTTGCCGCTAAGGGTGAAGG - Intergenic
1081356597 11:42121536-42121558 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1081356615 11:42121600-42121622 GGACTTGCTGCTGAGGTTGAAGG - Intergenic
1084046932 11:66574467-66574489 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1084046961 11:66574592-66574614 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1084232061 11:67760524-67760546 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1084232092 11:67760645-67760667 GGTCTTGCCACTAAGGGTGAAGG - Intergenic
1084245797 11:67856149-67856171 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
1084353793 11:68623639-68623661 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1084355323 11:68634600-68634622 GTACTTGCCACTAAGGGCGAAGG - Intergenic
1084355347 11:68634694-68634716 GGACTTGCCACTCAGGGTGAAGG - Intergenic
1084613480 11:70219052-70219074 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
1084613539 11:70219294-70219316 GGACTTGCCGCTATGGGTGAAGG + Intergenic
1084653474 11:70502231-70502253 GGACTTGGAGCGCAGGGTGAGGG + Exonic
1084826873 11:71738365-71738387 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1084826887 11:71738429-71738451 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1085987773 11:81807007-81807029 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1085987801 11:81807126-81807148 GTACTTGCTGCTAAGGGTGAAGG - Intergenic
1086132912 11:83419987-83420009 ATGCTTGCCACTAAGGGTGAAGG - Intergenic
1086136507 11:83447723-83447745 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1086452513 11:86930999-86931021 GGACTTGCTCCTAAGGGCAATGG + Intronic
1086550013 11:88044243-88044265 GTACTTTCTGCTAAGGGTGAAGG - Intergenic
1087098867 11:94346566-94346588 AGACTTGCCACTAAGGGTGAAGG - Intergenic
1087098899 11:94346690-94346712 GGACTTGCCACTTAGGGTGAAGG - Intergenic
1087127566 11:94642435-94642457 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1087127601 11:94642555-94642577 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1087196649 11:95310328-95310350 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1087196700 11:95310514-95310536 GGACTTGCCACTGAGGGTGAAGG - Intergenic
1087196719 11:95310578-95310600 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1087314381 11:96588514-96588536 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1087314412 11:96588639-96588661 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1087314429 11:96588703-96588725 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1087314446 11:96588767-96588789 GAACTTGCCACTAAGAGTGAAGG - Intergenic
1087839761 11:102908917-102908939 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1087839788 11:102909039-102909061 GGACTTGCCACTAAAGGTGAAGG + Intergenic
1089348903 11:117810308-117810330 GGACTTGCCACTAAGGGTGAAGG - Intronic
1089472286 11:118730868-118730890 GTACTTGCCGCTAAGGGTGAAGG + Intergenic
1089472320 11:118730989-118731011 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1089867266 11:121642656-121642678 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1089953018 11:122547466-122547488 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1089987183 11:122825392-122825414 GGACTTGCCACTAAGAGTGAAGG - Intergenic
1089987229 11:122825572-122825594 GGACTTCCTGCTAAGGGTGAAGG - Intergenic
1090526999 11:127547481-127547503 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1090527021 11:127547606-127547628 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1090546696 11:127773849-127773871 GGACTTGCCACTAAGGGTGGAGG + Intergenic
1090546707 11:127773913-127773935 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1090546729 11:127774038-127774060 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1090850790 11:130569006-130569028 GGACTTGCCGCTGAGGGTGAAGG + Intergenic
1090850808 11:130569070-130569092 GGACTTGCCACTAAGGATGAAGG + Intergenic
1090872145 11:130758150-130758172 GGACTTGCCGCTGAGGGTGAAGG + Intergenic
1090872180 11:130758275-130758297 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1090927174 11:131259286-131259308 GTACTTGCCGCTAAGGGTGAAGG + Intergenic
1090927198 11:131259405-131259427 GTACTTGCTGCTAAGGGTGAAGG + Intergenic
1090943044 11:131405468-131405490 GGATTTGATGTTAAGGGTGAAGG - Intronic
1091886284 12:4019420-4019442 GGACTTGCCGCTGAGGTTGAAGG - Intergenic
1091886313 12:4019545-4019567 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1092416380 12:8293279-8293301 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
1092474226 12:8805710-8805732 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1092474260 12:8805831-8805853 GGACTTGCCACTAAGAGTGAAGG - Intergenic
1092592917 12:9967643-9967665 GTACTTGCCGCTAAGGGTGAAGG + Intronic
1092592959 12:9967817-9967839 GTACTTGTCGCTAAGGGTGAAGG + Intronic
1092626944 12:10337617-10337639 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1092626977 12:10337742-10337764 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
1092723932 12:11466984-11467006 GGATTTGCCGCTAAGGGTGAAGG + Intronic
1092723967 12:11467109-11467131 GGACTTGCCAGTAAGGGTGAAGG + Intronic
1092739524 12:11614399-11614421 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1092789471 12:12059217-12059239 GGACTTGCCGCTAAGGGTGAAGG - Intronic
1092789506 12:12059338-12059360 GGACTTGCCGCTAAGGGTGAAGG - Intronic
1092925048 12:13264658-13264680 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1093071389 12:14709696-14709718 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1093268201 12:17026348-17026370 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1093268236 12:17026473-17026495 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1093578496 12:20763798-20763820 GGACTTTCTGCTAAGGGTGAAGG - Intergenic
1093578528 12:20763923-20763945 GGACTTGCCACTAAGAGTGAAGG - Intergenic
1093578541 12:20763987-20764009 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1093584693 12:20821600-20821622 GGACTTGCCACTAAGGGTGAAGG + Intronic
1093584730 12:20821725-20821747 GGACTTGCGGCTAAGGGTGAAGG + Intronic
1093813030 12:23510665-23510687 GTACTTGCCGCTAAGGGTGAAGG + Intergenic
1093950847 12:25164061-25164083 GTACTTGCCGCTAAGGGTGAAGG - Intronic
1093950890 12:25164236-25164258 GTACTTGCTGCTAAGGGTGAAGG - Intronic
1094316261 12:29139718-29139740 GTACTTGCTGCTAAGGGTGAAGG + Intergenic
1094316304 12:29139896-29139918 GTACTTGCCACTAAGGGTGAAGG + Intergenic
1094400449 12:30056929-30056951 GTACTTGCCACTAAGGGTGCAGG - Intergenic
1094400466 12:30056990-30057012 GTACTTGCCACTAAGGGTGAAGG - Intergenic
1094400481 12:30057050-30057072 GTACTTGCTGCTAAGGGTGAGGG - Intergenic
1094400498 12:30057110-30057132 GTACTTGCCTCCAAGGTTGAAGG - Intergenic
1094825525 12:34266482-34266504 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1094825556 12:34266607-34266629 GGACTTGATGCTAAGGGTGAAGG - Intergenic
1095345559 12:41144865-41144887 GGGATTGCGTCTAAGGGTGAGGG - Intergenic
1097398304 12:59102515-59102537 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1097398381 12:59102823-59102845 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1097417247 12:59327915-59327937 GGACTTGCCGCCAAGGGTGAAGG + Intergenic
1097417265 12:59327979-59328001 GGACTTGCCGCTAAGAGTGAAGG + Intergenic
1097417282 12:59328043-59328065 AGACTTGCCACTAAGGGTGAAGG + Intergenic
1097542420 12:60956757-60956779 GGACTTGCCTCTAAGGGTGAAGG + Intergenic
1097592186 12:61587922-61587944 GTGCTTGCCGCTAAGGGTGAAGG - Intergenic
1098173827 12:67771319-67771341 GAACTTGCCGCTAAGGGTGAAGG + Intergenic
1098173856 12:67771444-67771466 GGACTTGCCGCTAAAGGTGAAGG + Intergenic
1098401975 12:70086167-70086189 GGACTTGTCGCTAAGGCTGAAGG - Intergenic
1098401993 12:70086231-70086253 GGACTTGCCGCTGAGGGTGAAGG - Intergenic
1098402012 12:70086295-70086317 GGACTTGCCGCTGAGGGTGAAGG - Intergenic
1098402030 12:70086359-70086381 GGACTTGCCGCTGAGGGTGAAGG - Intergenic
1098402049 12:70086423-70086445 GGACTTGCCGCTGAGGGTGAAGG - Intergenic
1098628814 12:72704101-72704123 GGACTTGCTGATAAGGGCGAAGG - Intergenic
1098628855 12:72704287-72704309 GGACTTGCTGCTAAGAGTGAAGG - Intergenic
1098654011 12:73006620-73006642 GTATTTGCTGCTAAGGTTGAAGG + Intergenic
1098654073 12:73006855-73006877 GTATCTGCCACTAAGGGTGAAGG + Intergenic
1099188474 12:79540727-79540749 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1099188506 12:79540852-79540874 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1099292312 12:80787915-80787937 GGACTTGCCACTAAGAGTGAAGG + Intergenic
1099292345 12:80788036-80788058 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
1099710876 12:86223282-86223304 GGACTTGCCACTAGGGAGGATGG - Intronic
1099762370 12:86939694-86939716 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1099836285 12:87912026-87912048 GTACTTCCCACTAAGGGTGAAGG + Intergenic
1100561044 12:95749711-95749733 GGACTTGCCACTAAGGGTGAAGG - Intronic
1100561076 12:95749836-95749858 GGACTTGCCGCTAAGGGTGAAGG - Intronic
1100561093 12:95749900-95749922 GGACTTGCCACTAAGGGTGAAGG - Intronic
1100561112 12:95749964-95749986 GGACTTGCCACTAAGGGTGAAGG - Intronic
1100561131 12:95750028-95750050 GGACTTGCCGCTAAGAGTGAAGG - Intronic
1100940059 12:99716034-99716056 GGACTTGCTGCTAAGGGTGAAGG - Intronic
1101278629 12:103227530-103227552 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1101278659 12:103227655-103227677 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1105031979 12:132890405-132890427 TTACTTGCCACTAAGGGTGAAGG - Intronic
1106319637 13:28625328-28625350 GTCCTTGCCACTAAAGGTGATGG - Intergenic
1106943212 13:34799564-34799586 GGACTTGCCGCTGAGGGTGAAGG - Intergenic
1106943230 13:34799628-34799650 GGACTTGCCGCTGAGGGTGAAGG - Intergenic
1106943247 13:34799692-34799714 GGACTTGCTGCTGAGGGTGAAGG - Intergenic
1107075321 13:36317207-36317229 GGACTTGCCGCTAAGGGTGAAGG - Intronic
1107075356 13:36317332-36317354 GGACTTGCTGCTAAGAGTGAAGG - Intronic
1107220502 13:37973908-37973930 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1107220519 13:37973972-37973994 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1107220553 13:37974097-37974119 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1107683340 13:42872116-42872138 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1107683357 13:42872180-42872202 GCACTTGCTGCTAAGGGTGAAGG + Intergenic
1107683377 13:42872244-42872266 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1108202440 13:48057204-48057226 GGACTTGCCGCTAAGGGTGAAGG - Intronic
1108512756 13:51170755-51170777 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1108512774 13:51170819-51170841 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1108512790 13:51170883-51170905 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1108913622 13:55582998-55583020 GGACTTGCCACTAAGAGTGAAGG + Intergenic
1108913640 13:55583062-55583084 GGACTTGCCACTAAGGTTGAAGG + Intergenic
1108913674 13:55583187-55583209 GGACTTGTCGCTAAGGGTGAAGG + Intergenic
1108919764 13:55659768-55659790 GGACTTACCACTAAGGGTGAAGG + Intergenic
1108919792 13:55659895-55659917 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1108947198 13:56041130-56041152 GAACTTGCTGCTAAGGGTGAAGG - Intergenic
1108947241 13:56041317-56041339 GGACTTGCAGCTAAGAGTGAAGG - Intergenic
1108953166 13:56117233-56117255 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1108953195 13:56117358-56117380 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1109343366 13:61089303-61089325 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1109370500 13:61415014-61415036 GAACCTGCCGGTAAGGGTTAGGG - Exonic
1109499046 13:63213958-63213980 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1109499080 13:63214078-63214100 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1109709855 13:66146017-66146039 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1109709886 13:66146142-66146164 GGACTTGCCGCTAAGGATGAAGG + Intergenic
1109716986 13:66231250-66231272 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1109717004 13:66231314-66231336 GGACTTGCTGATAAGGGTGAAGG + Intergenic
1109717034 13:66231439-66231461 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1110650732 13:77938457-77938479 GTACTTGCTGCTAAGGGTGAAGG + Intergenic
1110765217 13:79274927-79274949 GGACTTGCCGCTAAGGGTGAGGG - Intergenic
1110765250 13:79275048-79275070 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1110845086 13:80184399-80184421 GGACTTGCAGCTAAGGGTGAAGG - Intergenic
1110845118 13:80184520-80184542 GGACTTGCTGCTCAGGGTCAAGG - Intergenic
1110978222 13:81866945-81866967 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1110978256 13:81867066-81867088 TTACTTGCTGCTAAGGGTGAAGG - Intergenic
1111126239 13:83912951-83912973 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1111301765 13:86359056-86359078 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1111301798 13:86359181-86359203 GAACTTGCCGCTAAGGGTGAAGG - Intergenic
1111362315 13:87191115-87191137 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1111362349 13:87191240-87191262 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1111459074 13:88517642-88517664 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1111459090 13:88517706-88517728 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1111459124 13:88517831-88517853 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1111630241 13:90840431-90840453 GGACTTGCCGCTAAGGCTGAAGG - Intergenic
1111630271 13:90840556-90840578 GGACTTGCCGCTAACGGTGAAGG - Intergenic
1111631923 13:90853380-90853402 GGACTTGCCGCTAAAGGTGAAGG + Intergenic
1112236595 13:97643153-97643175 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1112236627 13:97643278-97643300 GGACTTGCCACTAACGGTGAAGG - Intergenic
1112889539 13:104212850-104212872 GTACTTGCTGCTAAGGGTGAAGG + Intergenic
1113324028 13:109265959-109265981 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1113324092 13:109266206-109266228 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1113324111 13:109266270-109266292 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1113863234 13:113504487-113504509 GGACTTGGGGCAAAGGGTGGTGG - Intronic
1115021924 14:28692243-28692265 GGACTTGTCTCTAAGGGGGATGG + Intergenic
1115240788 14:31249968-31249990 GGACTTGCTGCTAAGGATGAAGG + Intergenic
1115240805 14:31250032-31250054 GGACTTGCCGCTGAGGGTGAAGG + Intergenic
1115240822 14:31250088-31250110 GGACTTGCCGCTGAGGGTGAAGG + Intergenic
1115240842 14:31250152-31250174 GGACTTGCCGCTGAGGGTGAAGG + Intergenic
1115240863 14:31250216-31250238 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1115904545 14:38191523-38191545 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1116179427 14:41516751-41516773 GGACTTGACACTAAGGGTGAAGG - Intergenic
1116179458 14:41516876-41516898 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1116534983 14:46017117-46017139 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1116535018 14:46017238-46017260 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
1116573243 14:46544911-46544933 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1116573276 14:46545038-46545060 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1116613296 14:47105120-47105142 GGACTTGCCGCTAAGGGTGAAGG - Intronic
1116613315 14:47105184-47105206 GGACTTGCCACTAAGGGTGAAGG - Intronic
1116702598 14:48260079-48260101 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1116703527 14:48267291-48267313 GGACTTGCCGCTCAGGGTGAAGG + Intergenic
1116952674 14:50894050-50894072 GGACTTGCCGCTAAGGGTGAAGG - Intronic
1116952709 14:50894175-50894197 GGACTTGCCACTAAGGATGAAGG - Intronic
1116952727 14:50894239-50894261 GGACTTGCCGCTAAGGGTGAAGG - Intronic
1117958121 14:61138169-61138191 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1118937556 14:70301081-70301103 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1119022155 14:71125055-71125077 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1119022190 14:71125176-71125198 GGACTTGCCACTAAGAGTGAAGG - Intergenic
1119022220 14:71125294-71125316 GGACTTGCTGCTAAGGGGGAAGG - Intergenic
1119316924 14:73704208-73704230 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1119858492 14:77919234-77919256 GGACTTGGGGAGAAGGGTGAGGG - Intronic
1120438273 14:84504996-84505018 GTACTTGCCGCTAAAGGTGAAGG + Intergenic
1120438305 14:84505113-84505135 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1120660178 14:87239804-87239826 GGATTTGCCACTAAGGGTGAAGG + Intergenic
1120660213 14:87239925-87239947 GGACTTGGCGCTAAGGGTGAAGG + Intergenic
1120761495 14:88289474-88289496 GGACTTGCAGCTTTGGGTGATGG + Intronic
1121703421 14:95973846-95973868 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1121703437 14:95973910-95973932 GGACTTGCCGCTAAGGGTGCAGG - Intergenic
1121703455 14:95973974-95973996 GGATTTGCCGCTAAGGTTGAAGG - Intergenic
1122040770 14:98986124-98986146 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1122040789 14:98986188-98986210 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1123036801 14:105474943-105474965 GGACTGGCCGCGAAGGGCGGCGG - Intronic
1124919798 15:34014766-34014788 GAATTTGCAGCTAAGGCTGAAGG + Intronic
1125045496 15:35239500-35239522 GGACTTGCCGCTAAGGGTGAAGG - Intronic
1125045531 15:35239626-35239648 GGACTTGCCGCTAAGGTTGAAGG - Intronic
1125045549 15:35239690-35239712 GGACTTGCCACTAAGGGTGAAGG - Intronic
1125045566 15:35239754-35239776 GGACTTGCTGCTAAGGGTGAAGG - Intronic
1125131811 15:36290788-36290810 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1125848906 15:42885613-42885635 GTGCTTGCTGCTAAGGGTGAAGG - Intronic
1126530342 15:49703768-49703790 GTACTTGCCACTAAGGGTGAAGG + Intergenic
1126530368 15:49703887-49703909 GTACTTGCCGCTAAGGTTGAAGG + Intergenic
1126843539 15:52739547-52739569 GGACTTGCCGCTAAAGGTGAAGG - Intergenic
1126912582 15:53431477-53431499 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1126912607 15:53431570-53431592 GGACTTGCGGCTAAGGGTGAAGG + Intergenic
1129259245 15:74354979-74355001 GTGCTTGCCACTAAGGGTGAAGG - Intronic
1130652651 15:85770810-85770832 GGACCTGGCGCTCAGAGTGATGG + Intronic
1130854841 15:87831984-87832006 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1130854884 15:87832170-87832192 GGACTTGCCGCTAAGAGTGAGGG - Intergenic
1130947687 15:88561225-88561247 GGACTTGCCGCTAGGGGTGAAGG + Intergenic
1130947716 15:88561350-88561372 AGACTTGCCGCTAAGAGTGAAGG + Intergenic
1131447458 15:92512210-92512232 GTACTTGCTGCTAAGGGTGAAGG - Intergenic
1131447488 15:92512328-92512350 GTACTTGCCGCTAAGGGTGAAGG - Intergenic
1131683945 15:94751600-94751622 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1131683980 15:94751725-94751747 GGACTTGCCGCCGAGGGTGAAGG - Intergenic
1131807740 15:96140519-96140541 GGAGTTGCCGCTACTGGTGCAGG + Intergenic
1131882731 15:96876638-96876660 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1131882750 15:96876702-96876724 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1132262755 15:100441048-100441070 GGACTTGCCGCTAAGGGTGAAGG - Intronic
1132340172 15:101073378-101073400 GGACTTGCCGCTAAGGGTGAAGG - Intronic
1132340208 15:101073499-101073521 GGACTTGCCGCTCAGGGTGAAGG - Intronic
1133651154 16:7815524-7815546 GGAATTGCCGCTAAGGGTGAAGG - Intergenic
1133651185 16:7815645-7815667 GTACTTGCCGCTAAGAGTGAAGG - Intergenic
1133765939 16:8837744-8837766 GGACTTGCCGCTAAGGGTGAAGG + Intronic
1133766908 16:8844450-8844472 GGACTTGCCGCTAAGGGTGAAGG + Intronic
1133766943 16:8844575-8844597 GGACTTGCCGCTAAGGGTTATGG + Intronic
1133869823 16:9676235-9676257 GGACTTGCTGCTAAGGGTGAAGG + Intronic
1133869850 16:9676360-9676382 AGACTTGCCACTAAGGGTGAAGG + Intronic
1137363251 16:47839587-47839609 CTACTTGCTGCTAAGGGTGAAGG - Intergenic
1138804652 16:60079425-60079447 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1138804723 16:60079733-60079755 GGACTTGCTGCTAAGAGTGAAGG - Intergenic
1139039417 16:62983775-62983797 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1139039454 16:62983898-62983920 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1139039491 16:62984023-62984045 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1139039527 16:62984148-62984170 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1139039627 16:62984517-62984539 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1139039663 16:62984642-62984664 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1139226110 16:65234519-65234541 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1139226129 16:65234583-65234605 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1139943228 16:70621100-70621122 GGACTTGTCGCTAAGGGTGAAGG + Intronic
1139943244 16:70621164-70621186 GGACTTGCCGCTAAGGTTGAAGG + Intronic
1139943912 16:70625430-70625452 GGACTTGCCGCTAAGGGCGAAGG + Intronic
1139943946 16:70625553-70625575 GGACTTGCTGCTAAGGGTGAAGG + Intronic
1141796501 16:86278785-86278807 GGACTTGCCGCTGAGGGTGAAGG - Intergenic
1141796521 16:86278849-86278871 GGACTTGCCGCTGAGGGTGAAGG - Intergenic
1141796541 16:86278913-86278935 GGACTTGCCGCTGAGGGTGAAGG - Intergenic
1141796561 16:86278977-86278999 GGACTTGCCGCTGAGGGTGAAGG - Intergenic
1141796580 16:86279041-86279063 GGACTTGCCGCTGAGGGTGAAGG - Intergenic
1141840368 16:86570261-86570283 GATCTGGCCGCTAAGGGGGATGG - Intergenic
1141865407 16:86746680-86746702 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1141865426 16:86746744-86746766 GGACTTGTCGCTGAGGGTGAAGG + Intergenic
1144104390 17:11972627-11972649 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1144104422 17:11972749-11972771 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1144557466 17:16294788-16294810 GGACATGCCACTTAGGGTGGAGG - Intronic
1146597635 17:34184050-34184072 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1146597667 17:34184175-34184197 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1151622254 17:75253480-75253502 GGACTTGCCGCTAAGGGTGAAGG - Intronic
1151622287 17:75253605-75253627 GGACTTACCGCTAAGGGTGAAGG - Intronic
1151839942 17:76610559-76610581 GGACTTACCGCTAAGGGTGAAGG + Intergenic
1151839959 17:76610623-76610645 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1152253775 17:79225735-79225757 GGACTTGCTGCTGAGGCAGAAGG - Intronic
1152378243 17:79929578-79929600 GGGCTGGCGGCTGAGGGTGAGGG + Intergenic
1155461634 18:26090577-26090599 GGACTTGCCGATAGTGGTGACGG - Exonic
1155697247 18:28697925-28697947 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1155697265 18:28697989-28698011 GGACTTGCCGCGAAGGGTGAAGG + Intergenic
1155941303 18:31804611-31804633 GGACTTGCTGCTAAAGGTGAAGG - Intergenic
1155941336 18:31804732-31804754 GGACTTGCCACTAAGAGTGATGG - Intergenic
1156237174 18:35216848-35216870 GTACTTGCCTCTAAGGGTGAAGG - Intergenic
1156302057 18:35844938-35844960 GTATTTGCTGCTAAGGGTGAAGG - Intergenic
1156915647 18:42462667-42462689 GTGCTTGCCACTAAGGGTGAAGG - Intergenic
1156924265 18:42557230-42557252 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1158336111 18:56416324-56416346 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1158336160 18:56416510-56416532 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1158336176 18:56416574-56416596 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1158336194 18:56416638-56416660 GGACTTGCCACTAAGAGTGAAGG - Intergenic
1158394869 18:57071466-57071488 GGACTTGCCACTAAGAGTGAAGG + Intergenic
1158394900 18:57071587-57071609 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1159164249 18:64682577-64682599 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1159834798 18:73325474-73325496 GGACTTGCCGCTAAGAGTGAAGG - Intergenic
1159834829 18:73325597-73325619 GAACTTGTGGCTAAGGGTGAAGG - Intergenic
1161661502 19:5549454-5549476 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1161661521 19:5549518-5549540 GGACTTGCCACTGAGGGTGAAGG - Intergenic
1162242393 19:9365556-9365578 GTACTTGCCGCTAAGGGTGAAGG + Intronic
1162294926 19:9806791-9806813 GGCCTTGCCCCAAGGGGTGATGG - Intergenic
1162303449 19:9857302-9857324 GGACCTGCAGCAACGGGTGATGG - Exonic
1163487073 19:17594363-17594385 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1163900496 19:20095748-20095770 GGACTTGCCGCTAAGGGTGAAGG + Intronic
1163900529 19:20095875-20095897 GGACTTGCCGCTAAGGGTGAAGG + Intronic
1163906795 19:20155401-20155423 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1163906825 19:20155528-20155550 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1163906844 19:20155592-20155614 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1164152753 19:22569191-22569213 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1164152772 19:22569255-22569277 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1164459426 19:28434574-28434596 GGACTTGCCTCTAAGGGTGAAGG + Intergenic
1164459440 19:28434638-28434660 GGACTTGCTGCTGACGGTGAAGG + Intergenic
1164459453 19:28434702-28434724 AGACTTGCTGCTAACAGTGAAGG + Intergenic
1164459468 19:28434766-28434788 GGACTTGCCATTAAGGGTGAAGG + Intergenic
1164459501 19:28434891-28434913 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1165249015 19:34514933-34514955 GTGCTTGCCACTAAGGGTGAAGG - Intergenic
1165352511 19:35283696-35283718 GGACTTGGGGATAAGGCTGAGGG + Intronic
1165497213 19:36160122-36160144 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1165510493 19:36264089-36264111 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
1165510524 19:36264210-36264232 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1165510557 19:36264335-36264357 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1165835130 19:38750494-38750516 GGACTTGCCACTAACGGTGAAGG - Intronic
1165835158 19:38750615-38750637 GGACTTGCTACTAAGGGTGAAGG - Intronic
1166499149 19:43328256-43328278 GGACTTACCGCTAAGGGTGAAGG + Intergenic
1166499216 19:43328502-43328524 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1166927342 19:46277974-46277996 GTACTTGCTGCTAAGGGTGAAGG + Intergenic
1167046790 19:47054394-47054416 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1167046821 19:47054517-47054539 GGACTTGCCACCAAGGATGAAGG + Intergenic
1167901918 19:52628632-52628654 GAACTTGCTGCTAAGGGTGAAGG - Intronic
1167901944 19:52628752-52628774 GGACTTGCTGCTAAGGGTGAAGG - Intronic
1168051384 19:53832294-53832316 GGACTTGCCGCTGAGGGTGAAGG - Intergenic
1168212320 19:54899618-54899640 GTACTTGCCACTAAGGGTGAAGG + Intergenic
1168212352 19:54899736-54899758 GTACTTGCCACTAAGGGTGAAGG + Intergenic
1168228176 19:55011446-55011468 GGACTTGCCGCTAAGAGTGAAGG + Intergenic
1168228213 19:55011567-55011589 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1168247957 19:55123662-55123684 GTGCTTGCCACTAAGGGTGAAGG - Intergenic
925544269 2:5001645-5001667 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
925544301 2:5001770-5001792 GGACTTGCTGTTAAGAGTGAAGG - Intergenic
925829033 2:7877409-7877431 GGACTTGCTACTAAGGGTGAAGG + Intergenic
925829049 2:7877473-7877495 GGACTTGCCACTAAGGGTGAAGG + Intergenic
925829066 2:7877537-7877559 GGACTTGCCACTAAGGGTGAAGG + Intergenic
925829084 2:7877601-7877623 GGACTTGCCACTAAGGGTGAAGG + Intergenic
925829101 2:7877665-7877687 GGACTTGCCACTAAGGGTGAAGG + Intergenic
925829119 2:7877729-7877751 GGACTTGCCACTAAGGGTGAAGG + Intergenic
925829137 2:7877793-7877815 GGACTTGCCACTAAGGGTGAAGG + Intergenic
925829152 2:7877857-7877879 GGACTTGCCACTAAGGGTGAAGG + Intergenic
925829183 2:7877981-7878003 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
925911330 2:8575359-8575381 GGACCCGACGCTCAGGGTGAGGG - Intergenic
926407506 2:12570547-12570569 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
926407538 2:12570672-12570694 GGACTTGCCACTAAGGGTGAAGG - Intergenic
926407557 2:12570736-12570758 GGACTTGCCACTAAGGGTGAAGG - Intergenic
926413328 2:12627209-12627231 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
926413375 2:12627395-12627417 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
926413393 2:12627460-12627482 GAACTTGCCACTAAGAGTGAAGG - Intergenic
926464284 2:13168677-13168699 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
926464318 2:13168802-13168824 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
926815749 2:16796638-16796660 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
926815800 2:16796824-16796846 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
927133993 2:20083452-20083474 GTGCTTGCCACTAAAGGTGAAGG - Intergenic
928770805 2:34700495-34700517 GTACTTGCTGCTAAGGTTGAAGG + Intergenic
928778082 2:34790667-34790689 GTACTTACCACTAAGGGTGAAGG - Intergenic
928778110 2:34790786-34790808 GTACTTGCTGCTAAGGGTGAAGG - Intergenic
928779904 2:34805734-34805756 GTACTTGCCGCTAAGGATGAAGG + Intergenic
928827834 2:35441731-35441753 GGACATGCCGCTAAGGGTGAAGG + Intergenic
928928330 2:36599964-36599986 GGACTTGCCGCTAAGGGTGAAGG - Intronic
928928362 2:36600090-36600112 GGACTTGCCGCTAAGGGTGAAGG - Intronic
929076897 2:38085545-38085567 GGACTTGCCGCTCAGGGTGAAGG + Intronic
929076931 2:38085666-38085688 GGACTTGCCGCTAAGGGTGAAGG + Intronic
929793286 2:45039176-45039198 GGGCTTGTCACTAAGGGTGAAGG + Intergenic
929793316 2:45039301-45039323 GGACTTGCCACTAAGGGTGAAGG + Intergenic
930954876 2:57193934-57193956 GGACTTGCCGCTAAGGGTGATGG - Intergenic
930954895 2:57193998-57194020 GGACTTGCCACTAAGGGTGAAGG - Intergenic
930954914 2:57194062-57194084 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
930958185 2:57229903-57229925 GTACTTGCCGCTAAGGGTGAAGG - Intergenic
930958212 2:57230019-57230041 GTACTTGCCACTAAGGATGAAGG - Intergenic
931026580 2:58118049-58118071 GGACTTGCTGCTAAGGGTGAAGG + Intronic
931026598 2:58118113-58118135 GGACTTGCCACTAAGGGTGAAGG + Intronic
931026633 2:58118238-58118260 GGACTTGCCGCTAAGGGTGAAGG + Intronic
931042454 2:58314996-58315018 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
931042489 2:58315118-58315140 GGAGTTGCCACTCAGGGTGAAGG - Intergenic
931236640 2:60418273-60418295 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
931236658 2:60418335-60418357 GGACTTGCTGCTGAGGTTGAAGG - Intergenic
931236675 2:60418399-60418421 GGACTTGCTGCTGAGGGTGAAGG - Intergenic
931236694 2:60418463-60418485 GGACTTGCCACTGAGCGTGAAGG - Intergenic
931236709 2:60418527-60418549 GGACTTGCCGCTGAGGGTGAAGG - Intergenic
931236728 2:60418591-60418613 GGACTTGCCGCTGAGGGTGAAGG - Intergenic
931236744 2:60418655-60418677 GGACTTGCCGCTGAGGGTGAAGG - Intergenic
931625517 2:64253329-64253351 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
931625553 2:64253454-64253476 GGACTTGCCGCTGAGGGTGAAGG - Intergenic
931625571 2:64253518-64253540 GGACTTGCCACTGAGCGTGAAGG - Intergenic
931850179 2:66244774-66244796 GAACTTGCCGCTAAGGGTGAAGG - Intergenic
931850209 2:66244899-66244921 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
931850227 2:66244963-66244985 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
931948008 2:67332355-67332377 GCACTTGCCACTAAGGGTGAAGG - Intergenic
931948035 2:67332480-67332502 GGACTTGCCACTAAGGGTGAAGG - Intergenic
932159692 2:69448461-69448483 GTGCTTGCCGCTAAGGCTGAAGG + Intergenic
932295584 2:70621337-70621359 GGACTTGCCGCTAAGGGTGAAGG - Intronic
932295616 2:70621458-70621480 GGACTTGCCACTAAGAGTGAAGG - Intronic
932295647 2:70621580-70621602 GGACTTGCTGCTAAGAGTGAAGG - Intronic
932359024 2:71089781-71089803 GGACTTGCCGCTAAGGGCGAAGG + Intergenic
932359041 2:71089845-71089867 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
932359060 2:71089909-71089931 GGACTTGCCGCTAAGGGCGAAGG + Intergenic
932359103 2:71090097-71090119 GGACTTGCCGCTAAGGATGAAGG + Intergenic
932367842 2:71164386-71164408 GGACTTGCCGCTGAGGGTGAAGG + Intergenic
932367872 2:71164511-71164533 GGACTTGCCACTAAGGGTGAAGG + Intergenic
932367921 2:71164697-71164719 GGACTTGCCACTAAGGGTGAAGG + Intergenic
932854404 2:75218483-75218505 GGACTTGCCGCAAAGGGTGAAGG + Intergenic
932854436 2:75218608-75218630 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
932974171 2:76578657-76578679 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
932974205 2:76578784-76578806 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
933012830 2:77089114-77089136 GGACTTGCCCCTAAGGGTGAAGG - Intronic
933079037 2:77966008-77966030 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
933079056 2:77966072-77966094 GGACTTGCCACTAAGGGTGAAGG - Intergenic
933079075 2:77966136-77966158 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
933163504 2:79052227-79052249 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
933163536 2:79052348-79052370 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
933179997 2:79216671-79216693 GTACTTGTGGCTAAGGGTGAAGG + Intronic
933180044 2:79216846-79216868 GTACTTGCCACTAAGGGTGAAGG + Intronic
933329713 2:80879147-80879169 GGACTTGCCACTAAGGGTGAAGG + Intergenic
933552595 2:83793610-83793632 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
934948831 2:98562530-98562552 GTACATGCCCCTTAGGGTGAGGG - Intronic
936175739 2:110218770-110218792 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
936175771 2:110218896-110218918 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
936175784 2:110218960-110218982 GGACTTGCCACTAAGGGTGAAGG - Intergenic
936883112 2:117279643-117279665 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
936883146 2:117279770-117279792 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
939083346 2:137687671-137687693 GAACTTGCCACTAAGGGTGAAGG + Intergenic
939460914 2:142494483-142494505 GTGCTTGCCGCTAAGAGTGAAGG + Intergenic
939563526 2:143759541-143759563 GGACTTATTTCTAAGGGTGATGG - Intronic
939708412 2:145483633-145483655 GGACTTACCATTTAGGGTGACGG + Intergenic
940107145 2:150113607-150113629 GTACTTGCCACTAAGGGTGAAGG - Intergenic
940529951 2:154868165-154868187 GGATTTGCCACTAAGGGTGAAGG - Intergenic
940529984 2:154868286-154868308 GGACTTGCCACTCAGGGTGAAGG - Intergenic
940676021 2:156724858-156724880 GGACTTGCCACTCAGGGTGAAGG + Intergenic
940676048 2:156724979-156725001 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
941340163 2:164296692-164296714 GGACTTACCGCTAAGGGTGAAGG - Intergenic
941340194 2:164296817-164296839 GGACTTGCCACTAAGGGTGAAGG - Intergenic
941340211 2:164296881-164296903 GGACTTGCCACTAAGGGTGAAGG - Intergenic
941353173 2:164460081-164460103 GGACTTGCCACTAAGGGTGAAGG - Intergenic
941353192 2:164460145-164460167 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
941456393 2:165715192-165715214 GGACTTGCCACTAAGGGTGAAGG + Intergenic
941456412 2:165715256-165715278 GGACTTGCCACTAAGGGTGAAGG + Intergenic
941936105 2:170982400-170982422 GGACTTGCTGCTAAGGGTGAGGG + Intergenic
941936136 2:170982525-170982547 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
942096855 2:172542641-172542663 GTACTTGCTGCTAAGGGTGACGG - Intergenic
942096888 2:172542760-172542782 GTACTTGCTGCTAAGGGTGAAGG - Intergenic
942096903 2:172542820-172542842 GTACTTGCCACTAAGAGTGAAGG - Intergenic
943061375 2:183044921-183044943 GTGCTTGCCACTAAGGGCGAAGG - Intergenic
943421794 2:187675237-187675259 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
943421822 2:187675362-187675384 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
943449957 2:188034353-188034375 GCATTTGCCGCTAAGGGTGAAGG - Intergenic
943461378 2:188173824-188173846 GTACTTGCCGCTAAGGGTGAAGG + Intergenic
943806339 2:192131016-192131038 GGACTTGCTGCTAAGGGTGAAGG - Intronic
943806431 2:192131385-192131407 GGACTTGCCGCTAAAGGTGAAGG - Intronic
943806448 2:192131449-192131471 GGACTTGCCACTAAGGGTGAAGG - Intronic
943834919 2:192506919-192506941 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
943834949 2:192507040-192507062 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
943865176 2:192919158-192919180 GTACTTGCCACTAAGATTGAAGG - Intergenic
943951513 2:194135672-194135694 GGACTTGGCGCTAAGGGTGAAGG + Intergenic
944387206 2:199180254-199180276 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
944387242 2:199180375-199180397 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
944393898 2:199247788-199247810 GGACTTCCTGCTAAGGGTGAAGG - Intergenic
944393928 2:199247912-199247934 GGACTTGCCACTAAGGGTGAAGG - Intergenic
944876338 2:203966699-203966721 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
944876370 2:203966816-203966838 GGACTTGCCGCTAAGCATGAAGG + Intergenic
945153318 2:206811608-206811630 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
945153349 2:206811733-206811755 GGACTTGCCGCTAAGGGTAAAGG + Intergenic
945173209 2:207018056-207018078 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
945173241 2:207018181-207018203 GGACTTGCCACTAAGGGTGAAGG - Intergenic
945301687 2:208220958-208220980 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
945301721 2:208221079-208221101 GGACTTGACGCTAGGGGTGAAGG + Intergenic
945361439 2:208900191-208900213 GTACGTGCCACTAAGGGTGAAGG - Intergenic
945375859 2:209078911-209078933 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
945375892 2:209079032-209079054 GGATTTGCCACTAAGGGTGAAGG - Intergenic
945394101 2:209300230-209300252 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
945394119 2:209300294-209300316 GGACTTGCCACTAAGGGTGAAGG - Intergenic
945938062 2:215923190-215923212 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
945938094 2:215923315-215923337 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
946090868 2:217222073-217222095 AGACTGGCCCCTAAGGGTCAGGG - Intergenic
946215211 2:218178621-218178643 GGACTTGCCACTAACGGTGAAGG + Intergenic
946215241 2:218178746-218178768 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
946215272 2:218178871-218178893 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
946215308 2:218178996-218179018 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
946781235 2:223194531-223194553 GGACTTGCCGCTAAGGGTGAAGG + Intronic
946781270 2:223194656-223194678 GGACTTGCTGCTAAGGGTGAAGG + Intronic
946871998 2:224092648-224092670 GTGCTTGCTGCTAAGGGTGAAGG + Intergenic
946886298 2:224226290-224226312 GGACTTGCCCCTAAGGGTGAAGG - Intergenic
946893022 2:224297482-224297504 GGACTTGCCATTAAGGGTGAAGG - Intergenic
946893055 2:224297603-224297625 AGACTTGCTGCTAAGGGTGAAGG - Intergenic
947750887 2:232531445-232531467 TCACTTGCCGATAAGGGGGATGG - Exonic
948390399 2:237607625-237607647 GGACTTGCCACTAAGGGTGAAGG - Intergenic
948390435 2:237607746-237607768 GGACTTGCCACTAAGGGGGAAGG - Intergenic
948911174 2:241003406-241003428 GGACTTACTGCTCAGGGTGCAGG - Intronic
949037315 2:241821807-241821829 GGAGTTGCCCCTAAGGCTCAGGG - Intergenic
1168739178 20:173659-173681 GTACTTGCTGCTAAGGGTGAAGG - Intergenic
1169701711 20:8454327-8454349 GGACTTGATGCCAAGGGAGATGG + Intronic
1170069069 20:12344987-12345009 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1170069086 20:12345051-12345073 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1170105985 20:12754705-12754727 GGACTTGCCGCTAAGGGCGAAGG - Intergenic
1170106025 20:12754870-12754892 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1170163169 20:13336489-13336511 TGACTTGCAGCTAAGTGTGTAGG - Intergenic
1170165650 20:13358825-13358847 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1170165699 20:13359013-13359035 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1170325691 20:15152566-15152588 GGACTTGCCACTAAGGGTGAAGG + Intronic
1170325725 20:15152689-15152711 GGACTTGCCGCTAAGGGTGAAGG + Intronic
1170551680 20:17482157-17482179 GGAATTGCCTGTACGGGTGATGG - Exonic
1170820892 20:19755767-19755789 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1170820927 20:19755893-19755915 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1172932759 20:38597925-38597947 GTACTTGCTGCTAAGAGTGAAGG + Intergenic
1173101638 20:40093970-40093992 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1173101669 20:40094095-40094117 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1173118635 20:40269940-40269962 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1173118669 20:40270065-40270087 GGACTTGCCATTAAGGGTGAAGG - Intergenic
1173118688 20:40270129-40270151 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1173781404 20:45760192-45760214 GGACTTGCCACTAAGGGTGAAGG - Intronic
1173781434 20:45760312-45760334 GGACTTGCCGCTAAGGGTGAAGG - Intronic
1175107383 20:56625261-56625283 GGACTCGCTGCGAAGGGCGAGGG + Intergenic
1177031364 21:15984443-15984465 GTACTTGCCGCAAAGGGTGAAGG + Intergenic
1177100390 21:16893052-16893074 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1177100425 21:16893177-16893199 GAACTTGCTGCTAAGGGTGAAGG - Intergenic
1177102479 21:16914969-16914991 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1177119327 21:17122332-17122354 GTACTTGCCGCTAAGGGTAAAGG - Intergenic
1177495182 21:21879541-21879563 GGACGTGGTGCTAAGGGTGGGGG + Intergenic
1179015477 21:37591646-37591668 GTACTTGCCGCTAAGGGTGAAGG + Intergenic
1179387286 21:40955647-40955669 GGACTTGCCGCTAAAGGTGAAGG - Intergenic
1179387316 21:40955771-40955793 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1179465360 21:41568144-41568166 GGACTTGGGGGCAAGGGTGACGG - Intergenic
1179576698 21:42312632-42312654 GGACTTGCTGGGGAGGGTGAAGG + Intronic
1179650557 21:42805674-42805696 GTACTTGCCGCTAAGGGTGAAGG + Intergenic
1180560671 22:16612214-16612236 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1180560690 22:16612278-16612300 GGACTTGCCGCTGAGGGTGAAGG - Intergenic
1180560710 22:16612342-16612364 GGACTTGCCACTAAGTGTGAAGG - Intergenic
1180560725 22:16612406-16612428 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1182113709 22:27742872-27742894 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1182113728 22:27742936-27742958 GGACTTGCCGCTGAGGGTGAAGG - Intergenic
1182113748 22:27743002-27743024 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1182732038 22:32503612-32503634 AGACTTGCCGCCAAGGGTGAAGG - Intergenic
949162305 3:895423-895445 GGACTTGCCGCTAAGAGTGAAGG + Intergenic
949162337 3:895544-895566 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
949190565 3:1244339-1244361 GGACTTGCCGCTGAGGGTGAAGG + Intronic
949190584 3:1244403-1244425 GGACTTGCCGCTGAGGGTGAAGG + Intronic
949190603 3:1244467-1244489 GGACTTGCCGCTGAGGGTGAAGG + Intronic
949670908 3:6398478-6398500 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
949827197 3:8177861-8177883 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
949827231 3:8177978-8178000 GGACTTGCCACTAAGGGTGAAGG - Intergenic
950926248 3:16745120-16745142 GGACTTGCCACTAAGGGTGAAGG - Intergenic
950926280 3:16745241-16745263 GGACTTGCCACTAAGGGTGATGG - Intergenic
951299015 3:20972240-20972262 GGACTTGCCACTAAGGGTGAAGG + Intergenic
951299049 3:20972361-20972383 GGACTTGCCACTAAGGGTGAAGG + Intergenic
951762993 3:26165015-26165037 GTACTTGCTGCTAAGGGTGAAGG + Intergenic
952343749 3:32466054-32466076 GGACTTGCCTCAAAGGGTGAAGG + Intronic
952663659 3:35879080-35879102 GGACTTGCCAATAAGGGTGAAGG + Intergenic
952663694 3:35879205-35879227 GGACTTACTGCTAAGGGTGAAGG + Intergenic
952895483 3:38075785-38075807 GGACTTGCCACTAAGGGTGAAGG + Intronic
952896728 3:38082615-38082637 GGACTTGCCGCTAAGGGTGAAGG + Intronic
952896780 3:38082797-38082819 GGACTTGCCGCTAAGGGTGAAGG + Intronic
952962994 3:38604441-38604463 GGACATGCCCATAAGAGTGAGGG - Intronic
953077358 3:39582636-39582658 GGACTTGCTGCTAAGAGTGAGGG + Intergenic
953077393 3:39582757-39582779 GGATTTGCCTCTAAGGGTGAAGG + Intergenic
953176932 3:40561735-40561757 GGACTTGCCGCTAAGGGTGAAGG - Intronic
953176965 3:40561856-40561878 GGACTTGCTGCTAAGGGTGAAGG - Intronic
953825914 3:46251021-46251043 GGACTTGCCACTAAGAGTGAAGG + Intronic
953825946 3:46251146-46251168 GGACTTGCTGCTAAGGGTGAAGG + Intronic
954969463 3:54639178-54639200 GGACTTGCTGCTAAGGGTGAAGG + Intronic
954969480 3:54639242-54639264 GGACTTGCCGCTAAGGGTGAAGG + Intronic
954969499 3:54639306-54639328 GGACTTGCCGCTAAGGGTGAAGG + Intronic
955253164 3:57304704-57304726 GTACTTGCTGCTAAGGGTGAAGG - Intronic
955792222 3:62600414-62600436 GGAGGTGCCTCTATGGGTGATGG - Intronic
956233679 3:67043291-67043313 GTGCTTGCCACTAAGGGTGAAGG + Intergenic
956425447 3:69129855-69129877 GGCCTTGCAGCTATGGGTCAGGG - Intergenic
956549156 3:70439478-70439500 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
956549168 3:70439542-70439564 GTACTTGCCGCTACGGGTGAAGG + Intergenic
957060105 3:75474807-75474829 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
957060123 3:75474872-75474894 GGACTTGCCACTAAGGGTGAAGG + Intergenic
957294964 3:78324533-78324555 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
957294997 3:78324658-78324680 GGACTTGCAGCTAAGAGTGAAGG - Intergenic
957317524 3:78587894-78587916 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
957317557 3:78588016-78588038 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
957735083 3:84192568-84192590 GTGTTTGCCACTAAGGGTGAAGG + Intergenic
957905062 3:86543140-86543162 GTGCTTGCCACTAAGGGTGAAGG + Intergenic
958750785 3:98191904-98191926 GTGCTTGACACTAAGGGTGAAGG - Intronic
959288570 3:104444769-104444791 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
959288599 3:104444892-104444914 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
959485966 3:106927396-106927418 GGACTTGCCACTAAGGGTGAAGG + Intergenic
959485995 3:106927521-106927543 GGACTTGCCGCTAAGGATGAAGG + Intergenic
959972473 3:112422327-112422349 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
959972506 3:112422452-112422474 GGACTTGCCGTTAAGGGTGAAGG + Intergenic
960283067 3:115798130-115798152 GGACTTGCCACTAAGGGTGAAGG + Intergenic
960283099 3:115798255-115798277 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
960310341 3:116110092-116110114 GGACTTGCTGCTAAGGGTGAAGG + Intronic
960310400 3:116110339-116110361 GGTCTTGCCGCTAAGGGTGAAGG + Intronic
961164964 3:124757232-124757254 GGACTTGCCGCTAAGGATGAAGG + Intergenic
961164984 3:124757296-124757318 GGACTTGCCACTAAGGGTGAAGG + Intergenic
961293262 3:125864534-125864556 GGACTTGCCACTAAGGGTGAAGG - Intergenic
961293280 3:125864599-125864621 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
961711802 3:128833800-128833822 GGACTTGCCACTAAGGGTGAAGG + Intergenic
961711870 3:128834047-128834069 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
961730353 3:128960685-128960707 GGACTAGCCGCTAAGGGTGAAGG - Intronic
961730370 3:128960749-128960771 GGACTTGCCGCTGAGGGTGAAGG - Intronic
961730389 3:128960813-128960835 GGACTTGCCGCTGAGGGTGAAGG - Intronic
961730408 3:128960877-128960899 GGACTTGCCGCTAAGGGTGAAGG - Intronic
961880779 3:130059986-130060008 GGACTTGCCACTAAGGGTGAAGG - Intergenic
961880812 3:130060111-130060133 GGACTTGCCACTAAGGGTGAAGG - Intergenic
961880846 3:130060232-130060254 GGACTTGCCACTAAGGGTGAAGG - Intergenic
961893920 3:130151878-130151900 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
962022350 3:131513701-131513723 GTGCTTGCCACTAAGGGTGAAGG + Intergenic
962034946 3:131641996-131642018 GGACTTGGGGGAAAGGGTGAGGG + Intronic
962660434 3:137596490-137596512 GGACTTGCCGCTAAAGGTGAAGG - Intergenic
963058355 3:141205748-141205770 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
963058390 3:141205869-141205891 GTACTTGCCACTAAGGGTGAAGG - Intergenic
963424993 3:145113914-145113936 GGACTTGCCACTAAGGGTGAAGG - Intergenic
963425027 3:145114039-145114061 GGACTTGTCGCTAAGGGTGAAGG - Intergenic
963456882 3:145555929-145555951 GGACTTGCCACTAAGGGTGAAGG + Intergenic
963456917 3:145556050-145556072 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
963468421 3:145711408-145711430 GGACTTGCCGCTGAGGGTGAAGG - Intergenic
963521388 3:146362935-146362957 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
963663068 3:148152387-148152409 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
963663100 3:148152507-148152529 GGACTTGCCACTCAGGGTGAAGG - Intergenic
963684070 3:148415123-148415145 GGACTTTCCGCTAAGGGTGAAGG - Intergenic
963684101 3:148415248-148415270 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
963684119 3:148415312-148415334 GGACTTGCTGCTAAGAGTGAAGG - Intergenic
964067578 3:152597861-152597883 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
964067606 3:152597978-152598000 GGACTTGCCACTAAGGGTGAAGG - Intergenic
964125727 3:153231652-153231674 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
964300464 3:155279934-155279956 GTACTTGCCACTAAGGATGAAGG + Intergenic
964906735 3:161726667-161726689 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
964906768 3:161726788-161726810 GGACTTGCCACTAAGATTGAAGG + Intergenic
964983428 3:162713346-162713368 GTACTTGCCGCTAAGGGTGAAGG - Intergenic
964983458 3:162713465-162713487 ATACTTGCAACTAAGGGTGAAGG - Intergenic
965070092 3:163908376-163908398 GGACTTGCCACTAAGGGTGAAGG - Intergenic
965105429 3:164346855-164346877 GGACTTGCCGCTAAGGATGAAGG + Intergenic
965105458 3:164346980-164347002 GGACTTGCCACTAAGGGTGAAGG + Intergenic
965262867 3:166505557-166505579 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
965286918 3:166828711-166828733 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
965286950 3:166828836-166828858 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
965334873 3:167423285-167423307 GTGCTTGCCACTAAGGGTAAAGG - Intergenic
965336114 3:167432126-167432148 GGACTTGCCACAAAGGGTGAAGG - Intergenic
965336128 3:167432190-167432212 GTACTTGCCGCTAAGGGTGAAGG - Intergenic
965625094 3:170677279-170677301 GGACTTGCCACTAAGGGTGAAGG + Intronic
965625130 3:170677400-170677422 GGACTTGCCGCTAAGGGTGAAGG + Intronic
965626523 3:170688104-170688126 GAACTTGCCACTAAGGGTGAAGG + Intronic
965626556 3:170688223-170688245 GGACTTGCCACTAAGAGTGAAGG + Intronic
965640264 3:170822784-170822806 GGACTTGCCACTAAGGGTGAAGG + Intronic
965640298 3:170822905-170822927 GGACTTGCCGCTAAGGGTGAAGG + Intronic
965713144 3:171577215-171577237 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
965713177 3:171577340-171577362 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
965862187 3:173160665-173160687 GTACTTGCCGCTAAGGGTGAAGG + Intergenic
966066558 3:175828374-175828396 GGACTTGCCACTAAGGGTGAAGG - Intergenic
966066592 3:175828495-175828517 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
966085204 3:176062188-176062210 GGACTTACCATTAAGGGTGAAGG - Intergenic
966085233 3:176062313-176062335 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
966105272 3:176326263-176326285 GAACTTGCTGCTAAGGGTGAAGG + Intergenic
966105289 3:176326327-176326349 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
966105321 3:176326451-176326473 GGACTTGCTGCTAAAGGTGAAGG + Intergenic
966233025 3:177670451-177670473 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
966278949 3:178208028-178208050 GTACTTGCCACTAAGGGTGAAGG - Intergenic
966278983 3:178208147-178208169 GTACTTGCCTCTAAGGGTGAAGG - Intergenic
966279015 3:178208267-178208289 GTACTTGCTGCTAAGGGTGAAGG - Intergenic
966279049 3:178208380-178208402 GTACTTGCCACTAAGGGTGAAGG - Intergenic
966279083 3:178208499-178208521 GTGCTTGCCTATAAGGGTGAAGG - Intergenic
966279114 3:178208617-178208639 GTACTTGCTGCTATGGGTGAAGG - Intergenic
966397472 3:179517920-179517942 GTACTTGCCACTAAGGGTGAAGG - Intergenic
967212372 3:187180237-187180259 GGACTTGCTGCTAATGGTGAAGG + Intronic
967212407 3:187180362-187180384 GGACTTGCCGCTAAGGGCGAAGG + Intronic
967244373 3:187471021-187471043 GGACTTGCCACTAAAAGTGAAGG + Intergenic
967244406 3:187471142-187471164 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
967495998 3:190145427-190145449 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
967561164 3:190921049-190921071 GGACTTGACGCTAAGGGTGAAGG - Intergenic
967561199 3:190921174-190921196 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
967624867 3:191671277-191671299 GGACTTGCCACTAAGAGTGAAGG + Intergenic
967624886 3:191671341-191671363 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
967624918 3:191671466-191671488 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
967644034 3:191900119-191900141 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
967658328 3:192075874-192075896 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
967658364 3:192075995-192076017 GGACTTGCCGCTAAGGGCAAAGG + Intergenic
967740244 3:192996496-192996518 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
967740278 3:192996621-192996643 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
968120400 3:196121760-196121782 TGACTTGCCGCTAAGTATGGTGG - Intergenic
968453430 4:685828-685850 GGACATTCCGTTAATGGTGAGGG - Exonic
968993162 4:3928276-3928298 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
969004027 4:4005033-4005055 GGACTTGCCACTAAGGGTGAAGG + Intergenic
969654344 4:8487674-8487696 GGACTTACCACTAAGCGTGAAGG + Intronic
969748840 4:9095190-9095212 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
969809891 4:9639768-9639790 GGACTTGCCACTAAGGGTGAAGG - Intergenic
969809909 4:9639833-9639855 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
970029424 4:11658414-11658436 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
970041904 4:11807309-11807331 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
970087347 4:12364702-12364724 GGACTTGCCACTAAGGGTGAAGG - Intergenic
970087363 4:12364766-12364788 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
970532517 4:16998627-16998649 GGACTTGCCTCTAAGGGTGAAGG - Intergenic
971123386 4:23726718-23726740 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
971123419 4:23726843-23726865 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
971123448 4:23726968-23726990 GGACTTGCCGCTAAGGGTAAAGG + Intergenic
971180328 4:24324155-24324177 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
971180361 4:24324281-24324303 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
971199887 4:24501865-24501887 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
971199968 4:24502174-24502196 GGACTTGCCATTAAGGGTGAAGG - Intergenic
971394227 4:26213904-26213926 GGATTTGCTGATAAGGGTGATGG + Intronic
972927779 4:44033201-44033223 AGACTTGAGGCTAAGTGTGATGG + Intergenic
974428604 4:61769017-61769039 GGACTTGCCGCTAAGGGTGAAGG + Intronic
974428623 4:61769081-61769103 GGACTTGCCGCTAAGGGTGAAGG + Intronic
974903603 4:68031746-68031768 ATACTTGCCACTAAGGGTGAAGG - Intergenic
975865319 4:78718696-78718718 GGACTTGCCGCTAAGAATGAAGG + Intergenic
975865354 4:78718821-78718843 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
975934111 4:79558747-79558769 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
975934129 4:79558809-79558831 GGACTTGCCACTAAGGGTGAAGG + Intergenic
976485461 4:85597454-85597476 GGAATTGCTGAAAAGGGTGAGGG + Intronic
976558386 4:86475665-86475687 GTACTTGCCGTTAAGGGTGAAGG - Intronic
976696290 4:87922679-87922701 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
976696323 4:87922804-87922826 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
976884777 4:89969496-89969518 GGACTTGCCACTCAGGGTGAAGG + Intergenic
976884812 4:89969617-89969639 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
977009996 4:91624516-91624538 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
977010054 4:91624811-91624833 GGACTTGCCGCTAAGGACGAAGG - Intergenic
977010109 4:91625061-91625083 GGACTTGCCGCTAAGAATGAAGG - Intergenic
977013157 4:91659478-91659500 GGACTTGCTGCTAACAGTGAAGG + Intergenic
977013172 4:91659542-91659564 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
977013199 4:91659667-91659689 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
977041765 4:92026680-92026702 GGACTTGCCAATAAGGGTGAAGG - Intergenic
977041832 4:92026927-92026949 GGACTTGCCGCTAAGGATGAAGG - Intergenic
977041849 4:92026991-92027013 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
977062801 4:92276622-92276644 GGACTTGCCGCTAAGGGTGCAGG + Intergenic
977062832 4:92276747-92276769 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
977075399 4:92443629-92443651 GGACTTGCCGCTAAGAGTGAAGG + Intronic
977075429 4:92443752-92443774 GGACTTGCCGCTAAGGGTGAAGG + Intronic
977198628 4:94089310-94089332 GGACTTGCCACTAAGGGTGAAGG + Intergenic
977198646 4:94089374-94089396 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
977217314 4:94297751-94297773 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
977217330 4:94297815-94297837 GAACTTGCCGCTAAGCGTGAAGG + Intergenic
977217349 4:94297879-94297901 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
977217384 4:94298004-94298026 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
977446611 4:97139191-97139213 GTGCTTGCCACTAAGGGTGAAGG + Intergenic
977782688 4:100996615-100996637 GTGGTTGCAGCTAAGGGTGAAGG + Intergenic
978001320 4:103558456-103558478 GGACTTGTCACTAAGGGTGAAGG + Intergenic
978001352 4:103558581-103558603 GGACTTGCCACTAAGGGTGAAGG + Intergenic
978031277 4:103942161-103942183 ATACTTGCCACTAAGGGTGAAGG - Intergenic
979054811 4:115980300-115980322 GGACTTGCGGCTCAGGGTGAAGG + Intergenic
979054843 4:115980421-115980443 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
979146385 4:117252947-117252969 GGACTTGCCACTAAGGGTGAAGG - Intergenic
979146415 4:117253067-117253089 GGACTTGCTGCTAAGAGTGAAGG - Intergenic
979379642 4:119994551-119994573 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
979379684 4:119994736-119994758 GGACTTGCCACTAAGAGTGAAGG - Intergenic
979850527 4:125566432-125566454 GGACTTGCCGCCAAGAGTGAAGG + Intergenic
979850562 4:125566557-125566579 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
979895359 4:126149822-126149844 GGACTTGCCACTAAGGGTGAAGG + Intergenic
979895377 4:126149886-126149908 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
980003551 4:127516174-127516196 GTACTTGCTCCTAAGGGTGAAGG + Intergenic
980035871 4:127881613-127881635 GGACTGGAAGCTCAGGGTGATGG - Intronic
980112149 4:128645619-128645641 GTACTTGCCGCTAAGGGTGAAGG + Intergenic
980112179 4:128645737-128645759 GTACTTGCCGCTAAGGGTGAAGG + Intergenic
980284757 4:130768376-130768398 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
980388676 4:132119020-132119042 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
980388706 4:132119139-132119161 GGACTTGCCGCTCAGGGTGAAGG - Intergenic
980491529 4:133533743-133533765 GTGCTTGCCACTAAGGGTGAAGG + Intergenic
980527651 4:134013060-134013082 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
980527680 4:134013185-134013207 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
980575835 4:134682575-134682597 GGACTTGTCACTAAGGGTGAAGG + Intergenic
980575870 4:134682696-134682718 GGACTTGCCACTAAGGGTGAAGG + Intergenic
980611962 4:135171977-135171999 GAACTTGCAGCTAAGGGTGAAGG + Intergenic
980611979 4:135172041-135172063 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
980612024 4:135172227-135172249 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
980903671 4:138928665-138928687 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
980903707 4:138928787-138928809 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
981040038 4:140214529-140214551 GGACTTGCCGCTAAGGGCGAAGG - Intergenic
981040071 4:140214654-140214676 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
981524896 4:145699711-145699733 GGACTTGCCACTAAGGGTGAAGG - Intronic
981524942 4:145699897-145699919 GGACTTGCCGCTAAGGGTGAAGG - Intronic
981524960 4:145699961-145699983 GGACTTGCCACCAAGGGTGAAGG - Intronic
981539454 4:145833449-145833471 GGACTTGCCACTAAGGGTGAAGG - Intronic
981539485 4:145833574-145833596 GGACTTGCCGCTAAGGGTGAAGG - Intronic
981714774 4:147742050-147742072 TGACTTGCCACCAAGAGTGAGGG - Intronic
982084149 4:151817248-151817270 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
982084183 4:151817369-151817391 GGACTTGCCACTAAGGGTGAAGG + Intergenic
982180666 4:152745994-152746016 GGACTTGCTGCTAAGGGTGAAGG + Intronic
982180684 4:152746058-152746080 GGACTTGCCACTGAGGGTGAAGG + Intronic
982180701 4:152746122-152746144 GGACTTGCCACTGAGGGTGAAGG + Intronic
982180734 4:152746247-152746269 GGACTTGCCGCTAAGGGTGAAGG + Intronic
982396956 4:154923693-154923715 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
982414398 4:155113204-155113226 AGACTTGTCGCTAAGAGTGAAGG + Intergenic
982414433 4:155113325-155113347 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
982497340 4:156108324-156108346 GGACTTGCCGCTAAGAGTGAAGG + Intergenic
982497373 4:156108445-156108467 AGACTTGCCGCTAAGGGTGAAGG + Intergenic
982535181 4:156601071-156601093 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
983023636 4:162710024-162710046 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
983023673 4:162710145-162710167 GGACTTGCCGCTCAGGGTTAAGG - Intergenic
983055260 4:163094042-163094064 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
983055296 4:163094186-163094208 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
983055315 4:163094250-163094272 GGACTTGCCACTAAGGGTGAAGG - Intergenic
983345363 4:166521538-166521560 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
983360144 4:166717010-166717032 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
983360175 4:166717135-166717157 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
983414911 4:167440505-167440527 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
983414943 4:167440632-167440654 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
983447832 4:167877150-167877172 GGACTTGATGCTAAGGGTGAAGG - Intergenic
983447849 4:167877212-167877234 GGACTTGCCACTAAGGGTGAAGG - Intergenic
983452094 4:167923744-167923766 GGACTTGCCACTAAGGGTGAAGG - Intergenic
983452128 4:167923863-167923885 GGACTTGCTGTTAAGGGTGAAGG - Intergenic
983659347 4:170117278-170117300 GGGCTTGCCGCTAAGGGTGAAGG - Intergenic
983707478 4:170678485-170678507 GGACTTACCGCTAAGGGTGAAGG - Intergenic
983707496 4:170678549-170678571 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
983884071 4:172961438-172961460 GTACTTGCTGCTAAGGGTGAAGG + Intronic
984099235 4:175466078-175466100 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
984099271 4:175466220-175466242 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
984165556 4:176299538-176299560 GTACTTGCCGCTAAGGGTGAAGG + Intergenic
984321940 4:178207972-178207994 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
984393800 4:179169533-179169555 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
984393833 4:179169658-179169680 GGACTTGCCACTAAGGGTGAAGG + Intergenic
984437037 4:179721374-179721396 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
984700377 4:182815181-182815203 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
984700454 4:182815489-182815511 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
985079193 4:186246755-186246777 GTTCTTGCCACTAAGGGTGAAGG + Intronic
985390102 4:189484319-189484341 GGACTTGCCACTAAGGGTGAAGG + Intergenic
985390147 4:189484505-189484527 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
985435535 4:189926858-189926880 GAACTTGCCATTAAGGGTGAAGG - Intergenic
985537925 5:474954-474976 GGACTTGCTGCTGAGGCGGAAGG + Exonic
985582030 5:703339-703361 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
985582073 5:703525-703547 GGACTTGCCGCTGAGGGTGAAGG - Intergenic
985582136 5:703772-703794 GGACTTGCCGCTGAGGGTGAAGG - Intergenic
985582155 5:703836-703858 GGACTTGCCGCTAAGCGTGAAGG - Intergenic
985779841 5:1864737-1864759 GCACTGGCTCCTAAGGGTGATGG - Intergenic
986193296 5:5516412-5516434 GTACTTGCTGCTAAGGGTGAAGG - Intergenic
986193328 5:5516537-5516559 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
986193345 5:5516601-5516623 GGACTTGCCACTAAGCGTGAAGG - Intergenic
986388645 5:7264457-7264479 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
986388676 5:7264582-7264604 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
986555777 5:9008686-9008708 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
986555902 5:9009383-9009405 GGACTTGCCACTAAGGATGAAGG + Intergenic
986555936 5:9009508-9009530 GGACTTGCCACTAAGGGTGAAGG + Intergenic
986905548 5:12490754-12490776 GGACTTGCCGCTGAGGGTGAAGG - Intergenic
986905566 5:12490818-12490840 GGACTTGCCGCTGAGGGTGAAGG - Intergenic
986905584 5:12490882-12490904 GGACTTGCTGCTAAGGATGAAGG - Intergenic
986919803 5:12667312-12667334 GGACTTGCCGCTAAGAGTGAAGG + Intergenic
986919838 5:12667437-12667459 GGACTTGCCACTAAGGGCGAAGG + Intergenic
987281791 5:16420814-16420836 GGATTTGCTGCTAAGGGTGAAGG - Intergenic
987281825 5:16420939-16420961 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
987498321 5:18673502-18673524 GGACTTGACACTAAGGGTGAAGG + Intergenic
987498337 5:18673566-18673588 GGACTTGCCACTAAGGGTGAAGG + Intergenic
987498369 5:18673691-18673713 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
987755551 5:22095498-22095520 GTACTTGCCGCTAAGGGTGAAGG - Intronic
987755576 5:22095617-22095639 GTACTTGCCACTAAGGGTGAAGG - Intronic
992394409 5:76358130-76358152 AGACTTGCCGCTAAGGGTGAAGG - Intergenic
992394437 5:76358255-76358277 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
992452457 5:76886131-76886153 GTGCTTGCCGCTAAGGGTGAAGG + Intronic
992960584 5:81954071-81954093 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
992960618 5:81954192-81954214 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
993192422 5:84699097-84699119 GGACTTGCCACTAAGGGTGAAGG - Intergenic
993192485 5:84699365-84699387 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
993192503 5:84699429-84699451 GGACTTGCCACTAAGGGTGAAGG - Intergenic
993836415 5:92824613-92824635 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
993836450 5:92824738-92824760 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
993836478 5:92824863-92824885 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
994294948 5:98080084-98080106 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
994294967 5:98080148-98080170 GGACTTGCCGCTAAAGGTGAAGG - Intergenic
994532725 5:100988897-100988919 GGACTTGCTGCTAACGGTGAAGG + Intergenic
994532741 5:100988961-100988983 GGACTTGCCGCAAAGGGTGAAGG + Intergenic
994532805 5:100989208-100989230 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
994532841 5:100989333-100989355 GGACTTGCCACTAAGGGTGAAGG + Intergenic
994556719 5:101315867-101315889 GGACTTGCCGCTAAGGGCAAAGG - Intergenic
994775462 5:104032547-104032569 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
994775496 5:104032668-104032690 GGACTTGCCGCTAAAGGTGAAGG - Intergenic
994779245 5:104069391-104069413 GGACTTGCCACTAAGGGTGAAGG + Intergenic
994779261 5:104069455-104069477 GGACTTGCCACTAACGGTGAAGG + Intergenic
994779292 5:104069580-104069602 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
995125490 5:108573804-108573826 GTACTTGCCACTAAGGGTGAAGG + Intergenic
995899612 5:117051253-117051275 GGACTTGCCACTAAGAGTGAAGG + Intergenic
996203479 5:120702385-120702407 GGACTTGCCGCTAAGAGTGAAGG + Intergenic
996203512 5:120702510-120702532 GGACTTGCTGTTAAGGGTGAAGG + Intergenic
996279913 5:121716688-121716710 GGATTTGGCGGAAAGGGTGAGGG + Intergenic
996345016 5:122478272-122478294 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
996358799 5:122623460-122623482 GTAGTTGCCACTAAGGGTGAAGG + Intergenic
996509670 5:124304611-124304633 GTACTTGCCTCTAAGGGTGAAGG - Intergenic
996527820 5:124497884-124497906 GGACTTGCCACTAAGGGTGAAGG - Intergenic
996527850 5:124498009-124498031 AGACTTGCTGCTAAGGGTGAAGG - Intergenic
996575200 5:124971251-124971273 GTGCTTGCTGCTAAGGGTGAAGG + Intergenic
996745738 5:126844673-126844695 GGACTTGCCACTAAGGGTGAAGG + Intergenic
996745769 5:126844798-126844820 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
997679089 5:135736630-135736652 GTGCTTGCTGCTATGGGTGAAGG + Intergenic
997746182 5:136302268-136302290 GGACTTGCCGCTAAGGGTGAAGG - Intronic
997769883 5:136544376-136544398 GGACTTGCCACTAAGGGTGAAGG + Intergenic
997769902 5:136544440-136544462 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
997769919 5:136544504-136544526 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
997772882 5:136570221-136570243 GGACTTGCCACTAAGGGTGAAGG + Intergenic
997772912 5:136570346-136570368 GGACTTGCCACTAAGGGTGAAGG + Intergenic
997788738 5:136737870-136737892 GTACTTGCCACTAAGAGTGAAGG - Intergenic
998996586 5:147873552-147873574 GGACTTGCCGCTAAGGGTGAAGG + Intronic
998996605 5:147873616-147873638 GGACTTGCCGCTAAGGGTGAAGG + Intronic
999619066 5:153454395-153454417 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
999619098 5:153454516-153454538 GGACTTGCCGCTAAGTGTGAAGG + Intergenic
1000438345 5:161240816-161240838 GGACTTGCTCCTAAGGGTGAAGG - Intergenic
1000439469 5:161249260-161249282 GGACTTGCTGCTAAGCATGAAGG - Intergenic
1000519631 5:162280167-162280189 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1000519662 5:162280288-162280310 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1000885533 5:166743793-166743815 GTACTTGCTGCTAAGGGGGAAGG + Intergenic
1000935867 5:167302687-167302709 GTACTTGCCACTAAGGGTGAAGG + Intronic
1000935899 5:167302808-167302830 GGACTTGCCGCTAAGGGTGAAGG + Intronic
1001331694 5:170766886-170766908 GGACTTGCCACTAAGAGTGAAGG + Intronic
1001331730 5:170767004-170767026 GGACTTGCCGCTAAGGGTGAAGG + Intronic
1002307352 5:178291623-178291645 GGGCTTGGTTCTAAGGGTGAAGG + Intronic
1002611168 5:180419428-180419450 GGACTTGCCGCTAAGGGCGAAGG + Intergenic
1002611219 5:180419614-180419636 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1003430363 6:6032483-6032505 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1003430381 6:6032547-6032569 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1003430400 6:6032611-6032633 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1003430434 6:6032736-6032758 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1004105963 6:12668020-12668042 GGACTTGCCGCTAAGGATGAAGG - Intergenic
1004105997 6:12668141-12668163 GGACTTACTGCTAAGAGTGAAGG - Intergenic
1004106030 6:12668262-12668284 GGACTTACTGCTAAGAGTGAAGG - Intergenic
1004283768 6:14301808-14301830 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1004283800 6:14301933-14301955 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1004508237 6:16263909-16263931 GGACTTGCCGCTAAGTGTGAAGG + Intronic
1004508269 6:16264030-16264052 GGACTTGCCGCTAAGGGTGAAGG + Intronic
1004574988 6:16886818-16886840 AGACTTGCCGCTAAGGGTGAAGG - Intergenic
1004575020 6:16886939-16886961 GGACTTGCCGCTCAGGGTGAAGG - Intergenic
1004768807 6:18758907-18758929 GGACTTGCCACTAAGAGTGAAGG + Intergenic
1004768843 6:18759028-18759050 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
1004836795 6:19539876-19539898 GGACTTGCCGCTAAGGGTAAAGG - Intergenic
1005014878 6:21366241-21366263 GGACTTGCCTCTAAGGGTGAAGG + Intergenic
1007128659 6:39449010-39449032 GGAGTTGCCGCTAGAGCTGATGG - Intronic
1008431671 6:51425124-51425146 GGACTTGGGGGAAAGGGTGAGGG + Intergenic
1008476303 6:51939116-51939138 GTACTTGCTGCTAAGGGTGAAGG - Intronic
1008476340 6:51939237-51939259 GTACTTGCCACTAAGGGTGAAGG - Intronic
1008850399 6:56015447-56015469 GTACTTGCCACTAGGGGTGAAGG + Intergenic
1008850431 6:56015566-56015588 GTACTTGCCACTAAGGGTGAAGG + Intergenic
1008850462 6:56015687-56015709 GTACTTGCCACTAAGGGTGAAGG + Intergenic
1008850494 6:56015806-56015828 GTACTTGCTGCTAAGGGTGAAGG + Intergenic
1008850527 6:56015926-56015948 GTACTTGCCGCTAAGGGTGAAGG + Intergenic
1009359144 6:62792462-62792484 GTACTTGTTGCTAAGGGTGAAGG - Intergenic
1009359177 6:62792581-62792603 GTACTTGCCACTAAGGGTGAAGG - Intergenic
1009464172 6:63951029-63951051 GTGCTTGACACTAAGGGTGAAGG - Intronic
1009750487 6:67873547-67873569 GTGCTTGCCACTAAGGGTGAAGG + Intergenic
1010071913 6:71753202-71753224 GTACTTGCCACTAAGGGTGAAGG + Intergenic
1010586933 6:77665364-77665386 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1010586952 6:77665428-77665450 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1010586985 6:77665553-77665575 GGATTTGCTGCTAAGGGTGAAGG + Intergenic
1010827117 6:80487121-80487143 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1010827150 6:80487247-80487269 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1010841505 6:80652465-80652487 ACACTTGCCACTAAGGGTCAAGG + Intergenic
1010894808 6:81350153-81350175 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1010894838 6:81350278-81350300 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1011368103 6:86603033-86603055 GTACTTGCCGCTAAGGGTGAAGG + Intergenic
1011771142 6:90674877-90674899 GGACTTGTCACTAAGGGTGAAGG + Intergenic
1012014592 6:93834786-93834808 GGACTTGCTGCTAGGAGTGAAGG + Intergenic
1012014609 6:93834850-93834872 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1012066758 6:94558674-94558696 GGACTTGCGGCTAAGGGTGAAGG + Intergenic
1012315565 6:97780387-97780409 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1012315597 6:97780512-97780534 GGACTTGCCGCTAAGAGTGAAGG - Intergenic
1012674902 6:102102961-102102983 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1012689296 6:102293600-102293622 AGACTTGCTGCTAAGGGTAAAGG - Intergenic
1012689312 6:102293664-102293686 GGACTTGACACTAAGGGTGAAGG - Intergenic
1012689331 6:102293728-102293750 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1012689348 6:102293792-102293814 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1013408108 6:109860585-109860607 GGACTTGCCGCTAAGAGTGAAGG + Intergenic
1013408145 6:109860706-109860728 GGACTTGCCGCGAAGGGTGAAGG + Intergenic
1013843953 6:114427349-114427371 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1013891436 6:115032670-115032692 GGACTTGCTGCTGAGGGTGAAGG - Intergenic
1013891470 6:115032796-115032818 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1014360393 6:120467107-120467129 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
1014360423 6:120467232-120467254 GGACTTGCTACTAAGGGTGAAGG + Intergenic
1014395759 6:120925675-120925697 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1014455097 6:121625213-121625235 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1014455113 6:121625277-121625299 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1014455145 6:121625402-121625424 GGACTTGCTGCTAAGCGTGAAGG + Intergenic
1014555590 6:122840634-122840656 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1014555636 6:122840820-122840842 GGACTTGCCGCTAAGAGTGAAGG - Intergenic
1014589275 6:123243174-123243196 GGGCCTGCCACTAAGGATGATGG - Intronic
1014611883 6:123557702-123557724 GTGCTTGCTGCTAAGGGTGAAGG - Intronic
1014614879 6:123587034-123587056 GGACTTGCTGCTCAGGGTGAAGG + Intronic
1014614910 6:123587155-123587177 GGACTTGCCACTAAGGATGAAGG + Intronic
1014718369 6:124891278-124891300 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1014718402 6:124891403-124891425 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1014718421 6:124891467-124891489 GGACTTGCCACTAAGTGTGAAGG - Intergenic
1014794206 6:125706614-125706636 GGACTTGCCACTAAGAGTGAAGG + Intergenic
1014794221 6:125706678-125706700 GGACTTGCCGCTAACAGTGAAGG + Intergenic
1014794269 6:125706863-125706885 GGACTTGCCGATAAGGGTGAAGG + Intergenic
1014891327 6:126849714-126849736 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1014891347 6:126849777-126849799 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1015164967 6:130193150-130193172 GGACTTCCTGCTAAAGGTGAAGG - Intronic
1015165002 6:130193271-130193293 GGACTTGCTGCTAAGTGTGAAGG - Intronic
1015266479 6:131296235-131296257 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1015266539 6:131296481-131296503 GGATTTGCCGCTAAGGGTGAAGG - Intergenic
1015269408 6:131324186-131324208 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1015269438 6:131324311-131324333 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1015271114 6:131339690-131339712 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1015271165 6:131339878-131339900 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1015271184 6:131339942-131339964 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1015277933 6:131403797-131403819 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1015277969 6:131403921-131403943 GGACTTGCCACTAGGGGTGAAGG - Intergenic
1015323565 6:131902432-131902454 GGACTTGCCGCTACGGGTGAAGG - Intergenic
1015323618 6:131902619-131902641 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1015801633 6:137066247-137066269 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1016114372 6:140262208-140262230 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1016204303 6:141453661-141453683 GAACTTGCTGCTAAGGGTGAAGG - Intergenic
1016204333 6:141453787-141453809 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1016248587 6:142016546-142016568 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1016248618 6:142016671-142016693 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1016518567 6:144924046-144924068 GGACTTGCCGCCAAGGGTGAAGG - Intergenic
1016518601 6:144924171-144924193 GGACTTGCCACTAAGGCTGAAGG - Intergenic
1016518634 6:144924296-144924318 GGACTTGCCACTAACGGTGAAGG - Intergenic
1016535954 6:145107887-145107909 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1016535986 6:145108008-145108030 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1016650495 6:146455143-146455165 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
1016650576 6:146455451-146455473 GGACTTGTCGCTAAGGGTGAAGG + Intergenic
1016650605 6:146455576-146455598 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1016751019 6:147631001-147631023 GTGCTTGCCACTAAGGGTGAAGG - Intronic
1016853022 6:148640608-148640630 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1017779532 6:157705383-157705405 GGACTTGCTGCTAAGGGTGAAGG + Intronic
1017779562 6:157705504-157705526 GGACTTGCCACTAAGAGTGAAGG + Intronic
1017779595 6:157705625-157705647 GGACTTGCCACTAAGGGTGAAGG + Intronic
1018084716 6:160291329-160291351 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1018084751 6:160291450-160291472 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1018495676 6:164343789-164343811 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1018495707 6:164343909-164343931 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1018521696 6:164656950-164656972 GGACTTGCCACTAAGGATGAAGG + Intergenic
1018521729 6:164657071-164657093 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1018521763 6:164657192-164657214 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1020315798 7:6904623-6904645 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1020315830 7:6904748-6904770 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1020324153 7:6961450-6961472 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
1020532944 7:9358242-9358264 GGACATGCCGCTAAGAGTGAAGG + Intergenic
1020532959 7:9358306-9358328 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1020541349 7:9463303-9463325 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
1021172490 7:17414924-17414946 GTGCTTGCCACTAAAGGTGAAGG - Intergenic
1021393413 7:20121605-20121627 GTACTTGCTGCTAAGGGTGAAGG - Intergenic
1021637089 7:22704223-22704245 GTACTTGCTGCTAAGGGTGAAGG - Intergenic
1021637107 7:22704283-22704305 GCACTTGCCACTCAGGGTGAAGG - Intergenic
1021810422 7:24397136-24397158 GGACTTGCCGCTAATGGTGAAGG - Intergenic
1021810453 7:24397261-24397283 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1021978053 7:26028722-26028744 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1021978072 7:26028786-26028808 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1021978105 7:26028911-26028933 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1022372656 7:29785829-29785851 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1022372688 7:29785954-29785976 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1022708873 7:32833454-32833476 GTACTTGCCGCTAAGGGTGAAGG - Intergenic
1022710216 7:32842453-32842475 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1022710266 7:32842639-32842661 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1022854911 7:34304540-34304562 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1022854945 7:34304672-34304694 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1023452720 7:40304587-40304609 GGACTTGCAGGAAAGGGTGGGGG - Intronic
1023699098 7:42875334-42875356 GGACTTGCCGCTAAGGCTGAAGG + Intergenic
1023699114 7:42875398-42875420 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1023699133 7:42875462-42875484 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1024697351 7:51870770-51870792 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1024697370 7:51870834-51870856 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1024697389 7:51870898-51870920 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1024697408 7:51870962-51870984 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1024697426 7:51871026-51871048 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1026416239 7:70183650-70183672 GCACTTGACCCAAAGGGTGATGG - Intronic
1026901361 7:74039261-74039283 GAACTTCCAGCTCAGGGTGAAGG + Intronic
1027297494 7:76792541-76792563 AGACTTCCAGGTAAGGGTGAGGG - Intergenic
1027851709 7:83460542-83460564 GGACTTGCCGCTAAAGGTGAAGG - Intronic
1028689946 7:93640783-93640805 GGACTTGCTGCTAAGGGTGAAGG - Intronic
1028689979 7:93640904-93640926 GGACTTGCTGCTAAGGGTGAAGG - Intronic
1029500002 7:100923107-100923129 GTACTTTCCACTAAGGGTGAAGG - Intergenic
1030441887 7:109596726-109596748 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1030445957 7:109646702-109646724 GTGCTTGCCACTAAGGGTGAAGG + Intergenic
1030751673 7:113238128-113238150 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1030751692 7:113238192-113238214 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1030751743 7:113238378-113238400 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1031004456 7:116456502-116456524 GGACTTGCCGCTAAGGGTGGAGG - Intronic
1031004476 7:116456566-116456588 GGACTTGCCGCTAAGGGTGAAGG - Intronic
1031355418 7:120781907-120781929 GTACTTGCCGCTAAGGGTGAAGG + Intergenic
1031355448 7:120782026-120782048 GTACTTGCCACTAAGGGTGAAGG + Intergenic
1031399695 7:121316257-121316279 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1031399819 7:121316731-121316753 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1031422682 7:121568808-121568830 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
1031525312 7:122817608-122817630 GGACTTGCCACTAAGGGTGAAGG - Intronic
1031525342 7:122817733-122817755 GGACTTGCCGCTAAGAGTGAAGG - Intronic
1031728133 7:125263604-125263626 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1031728163 7:125263729-125263751 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1031776090 7:125910840-125910862 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1031776109 7:125910902-125910924 GGACTTGCCACTAAGAGTGAAGG - Intergenic
1031777091 7:125918410-125918432 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1031777122 7:125918535-125918557 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1033211312 7:139462279-139462301 GTGCTTGCTGCTAAGGGTGAAGG - Intronic
1033465267 7:141583581-141583603 GTGGTTGCCACTAAGGGTGAAGG + Intronic
1033676164 7:143541932-143541954 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1033676199 7:143542057-143542079 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1033695634 7:143787382-143787404 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1033695669 7:143787507-143787529 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1033909695 7:146248240-146248262 GGACTTGCCGCTCAGGGTGAAGG + Intronic
1033909727 7:146248353-146248375 GGACTTGCCGCTAAGGGTGAAGG + Intronic
1034085005 7:148314625-148314647 GTACTTGCCGCTGAGGGTGAAGG + Intronic
1034085035 7:148314744-148314766 GTACTTGCCACTAAGGGTGAAGG + Intronic
1036071119 8:5441317-5441339 GTACTTGCCGCTAAGGGTGAAGG + Intergenic
1036071153 8:5441436-5441458 GTACTTGCCACTAAGGGTGAAGG + Intergenic
1036281254 8:7403293-7403315 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1036340212 8:7908279-7908301 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1036371911 8:8169515-8169537 GGTCTTGCTGCTAAGGGTGAAGG - Intergenic
1036371927 8:8169579-8169601 GGACATGCTGCTAAGGGTGAAGG - Intergenic
1036472558 8:9064208-9064230 ATACTTGCCGCTAAGGGTGAAGG + Intronic
1036472594 8:9064331-9064353 GTACTTGCCGCTAAGGGTGAGGG + Intronic
1036639215 8:10571952-10571974 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1036878977 8:12496064-12496086 GGACATGCTGCTAAGGGTGAAGG + Intergenic
1036878993 8:12496128-12496150 GGTCTTGCTGCTAAGGGTGAAGG + Intergenic
1041652028 8:60311109-60311131 GTGCTTGCTACTAAGGGTGAAGG + Intergenic
1042453281 8:68973858-68973880 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1042453311 8:68973983-68974005 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1042707145 8:71675816-71675838 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1043353876 8:79390793-79390815 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1043718121 8:83509949-83509971 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
1043718155 8:83510070-83510092 GGACTTCCCGCTAAGGGTGAAGG + Intergenic
1043837462 8:85063679-85063701 GGACTTGCTGCTAAGGGCAAAGG - Intergenic
1043837492 8:85063804-85063826 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1043837509 8:85063868-85063890 GTACTTGCTGCTAAGGGTGAAGG - Intergenic
1044148695 8:88746837-88746859 GGACTTGCTGTTAAGGGTGAAGG + Intergenic
1044148726 8:88746962-88746984 GGGCTTGCCACTAAGGGTGAAGG + Intergenic
1044258809 8:90094850-90094872 GGACTTGCCGCTAAGGGTGAAGG + Intronic
1044258837 8:90094975-90094997 GGACTTGCTGCTAAGGGTGAAGG + Intronic
1044416834 8:91948859-91948881 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1044416853 8:91948923-91948945 GGACTTACCGCTAAGGGTAAAGG - Intergenic
1044416889 8:91949048-91949070 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1044921716 8:97175891-97175913 GGACTTGCCGCTAAGGGTGGAGG - Intergenic
1044921752 8:97176016-97176038 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1044921786 8:97176140-97176162 GGACTTGCCACTAAAGGTGAAGG - Intergenic
1044924885 8:97201649-97201671 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1044924933 8:97201837-97201859 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1045197233 8:99944552-99944574 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1045197267 8:99944677-99944699 AGACTTGCTGTTAAGGGTGAAGG - Intergenic
1045644538 8:104286779-104286801 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1045644587 8:104286966-104286988 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1046293883 8:112196716-112196738 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1046293917 8:112196841-112196863 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1046386577 8:113514352-113514374 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
1046386609 8:113514477-113514499 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1046439821 8:114242483-114242505 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1046439850 8:114242608-114242630 GGACTTGCTGCTAGGAGTGAAGG - Intergenic
1046442951 8:114282575-114282597 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1046442985 8:114282700-114282722 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1046443002 8:114282764-114282786 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1046511856 8:115213131-115213153 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1046511885 8:115213256-115213278 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1046559038 8:115815492-115815514 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1046559073 8:115815618-115815640 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1047699108 8:127432584-127432606 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1047699138 8:127432688-127432710 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1047829731 8:128616592-128616614 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1047829763 8:128616717-128616739 AGACTTGCCGCTAAGGGTGAAGG + Intergenic
1047856147 8:128915307-128915329 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1048097394 8:131311125-131311147 GGACTTGCCGCTAAGAGTGAAGG - Intergenic
1048168630 8:132084902-132084924 GGACTTGCCGCTAAGGGTGAAGG + Intronic
1048168649 8:132084966-132084988 GGATGTGCCGCTAAGGGTGAAGG + Intronic
1048168682 8:132085091-132085113 GGACTTGCCGCTAAGGGTGAAGG + Intronic
1048475870 8:134741909-134741931 GGACTTGCTGATCAGGGAGAGGG - Intergenic
1048585626 8:135771874-135771896 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1048585689 8:135772120-135772142 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1048728619 8:137413018-137413040 GGACTCGCCACTAAGGGTAAAGG + Intergenic
1048764426 8:137829515-137829537 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
1048764442 8:137829579-137829601 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1048764477 8:137829704-137829726 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1049869027 8:144959006-144959028 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1049869059 8:144959127-144959149 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1050117380 9:2276541-2276563 GTAGTTGGCACTAAGGGTGAAGG - Intergenic
1050258317 9:3815908-3815930 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1050473929 9:6020905-6020927 GTGCTTGCCGCTAAAGGTGAAGG - Intergenic
1050895887 9:10885820-10885842 GTACTTGCCGCTAAGGGTGAAGG - Intergenic
1051052401 9:12949265-12949287 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1051849493 9:21490408-21490430 GGACTCGCCGCTAAGGGTGAAGG + Intergenic
1051849538 9:21490596-21490618 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1051953593 9:22663197-22663219 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1052191585 9:25669763-25669785 GTACTTGCCACTAAGGGTGAAGG - Intergenic
1052191615 9:25669881-25669903 GTACTTGCCACTAAGGGTGAAGG - Intergenic
1052327363 9:27229764-27229786 GGACTGGCTGCTACAGGTGAGGG - Exonic
1052653072 9:31327191-31327213 GTACTTGCTGCTAAGGGTGAAGG - Intergenic
1053057735 9:35004144-35004166 GTACTTGCTGCTAAGGGTGAAGG - Intergenic
1053057763 9:35004261-35004283 GTACTTGCAGCTAAGGGTGAAGG - Intergenic
1054807687 9:69409445-69409467 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1055232797 9:74086458-74086480 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1055232830 9:74086585-74086607 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1055347918 9:75356475-75356497 GTACTTGCCGCTAAGAGTGAAGG + Intergenic
1055347966 9:75356653-75356675 GTACTTGTCACTAAGAGTGAAGG + Intergenic
1055626452 9:78181535-78181557 GGACTTGCCACTAAGGACCAAGG - Intergenic
1055626485 9:78181660-78181682 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1055809796 9:80138169-80138191 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1055809825 9:80138294-80138316 GGACTTGCCGCTAAGAGTGAAGG - Intergenic
1055881531 9:81009919-81009941 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1055881547 9:81009982-81010004 GGACTTGCCGCTAAGGCTGAAGG - Intergenic
1056044912 9:82705259-82705281 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1056044931 9:82705323-82705345 GGACTTCCCGCTAAGGGTGAAGG + Intergenic
1056044953 9:82705387-82705409 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1056060921 9:82884623-82884645 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1056060969 9:82884809-82884831 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1056323575 9:85459213-85459235 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1056323623 9:85459399-85459421 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1056437432 9:86587974-86587996 GGACTTGCCGCTGAGGGTGAAGG + Intergenic
1056437467 9:86588102-86588124 GGACTTGCCGCTGAGGATGAAGG + Intergenic
1056437486 9:86588166-86588188 GGACTTGCCGCTGAGGGTGAAGG + Intergenic
1056437505 9:86588230-86588252 GGACTTGCCGCTGAGGGTGAAGG + Intergenic
1056437524 9:86588294-86588316 GGACTTGCCACTGAGGGTGAAGG + Intergenic
1056437542 9:86588358-86588380 GGACTTGCCGCTGAGGGTGAAGG + Intergenic
1056522156 9:87411586-87411608 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1056522232 9:87411894-87411916 GGACTTGCTGCTAAGAGTGAAGG - Intergenic
1056882775 9:90413584-90413606 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1057234604 9:93348478-93348500 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1057234622 9:93348542-93348564 GGACTTGCCGCTAAGAGTGAAGG - Intergenic
1057377752 9:94540711-94540733 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1057377778 9:94540810-94540832 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1057683701 9:97215405-97215427 GCCCTTGCCACTAAGGGTGAAGG - Intergenic
1057683713 9:97215449-97215471 GGACTTGCCGCTGAGGGTGAAGG - Intergenic
1057683734 9:97215513-97215535 GGACTTGCCGCTGAGGGTGAAGG - Intergenic
1057683755 9:97215575-97215597 GGACTTGCCGCTGAGGGTGAAGG - Intergenic
1057683774 9:97215638-97215660 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1057981761 9:99670660-99670682 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1057981779 9:99670724-99670746 GGACTTGCCACTAAGCTTGAAGG - Intergenic
1057981795 9:99670788-99670810 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1057981813 9:99670851-99670873 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1058026443 9:100145535-100145557 GTACTTGCCACTAAGGGTGAAGG + Intronic
1058026472 9:100145655-100145677 GTACTTGCTGCTAAGGGTGAAGG + Intronic
1058612185 9:106789121-106789143 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1058612212 9:106789246-106789268 GGACTTGCTGCTAAGGGTGATGG - Intergenic
1058902887 9:109457638-109457660 GGAATTGCAGCTAAGGGGGAAGG - Intronic
1059546388 9:115179468-115179490 GGACTTGCTGCTAAGGGTGAAGG + Intronic
1059574340 9:115474072-115474094 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1059574389 9:115474258-115474280 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1059574407 9:115474322-115474344 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1059574424 9:115474386-115474408 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1059606909 9:115843903-115843925 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1059606943 9:115844028-115844050 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1059674244 9:116522504-116522526 GGACTTGGGGGAAAGGGTGAGGG + Intronic
1059863690 9:118490372-118490394 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1059863718 9:118490497-118490519 GGACTTGCTGCTAAGAGTGAAGG + Intergenic
1060225919 9:121790888-121790910 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1060318673 9:122535287-122535309 GGACTTGCCACTAAGGGTAAAGG + Intergenic
1060738107 9:126079430-126079452 GGACTTGCCGCTAAGGTTAAAGG + Intergenic
1060738139 9:126079555-126079577 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1185858794 X:3559143-3559165 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1185858825 X:3559268-3559290 GGACTTGTCGCTAAGGGTGAAGG + Intergenic
1185960860 X:4545034-4545056 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
1185960877 X:4545098-4545120 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1185960898 X:4545164-4545186 GGACTTACCGCTAAGGGTGAAGG + Intergenic
1185960961 X:4545411-4545433 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
1185990831 X:4892489-4892511 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1185990860 X:4892614-4892636 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1186113096 X:6276946-6276968 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1186113130 X:6277067-6277089 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1186783867 X:12940841-12940863 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1187086738 X:16049443-16049465 GGACTTGCCACTCAGGGTGAAGG + Intergenic
1187086771 X:16049564-16049586 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1187100076 X:16183327-16183349 GGACTTGCCGCTAAGGGTAAAGG + Intergenic
1187100104 X:16183444-16183466 GGACTTGCCGCTAAGAGTGAAGG + Intergenic
1187509808 X:19907577-19907599 GGACTTGAGGCAAAGGGTGGGGG + Intergenic
1188301234 X:28506994-28507016 GTGCTTGCCACTAAGGATGAAGG + Intergenic
1188333215 X:28897248-28897270 GTACTTGCCGCTAAGGGTGAAGG + Intronic
1188463588 X:30453827-30453849 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1188463616 X:30453951-30453973 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1188552462 X:31378604-31378626 GTACTTGCCGCTAAAGGTGAAGG - Intronic
1192705895 X:73528561-73528583 GTGATTGCTGCTAAGGGTGAAGG - Intergenic
1193715886 X:84934514-84934536 GGACTGGCCGCCAAGGGTTGCGG + Intergenic
1193885708 X:86982725-86982747 GGACTTGCTGCTAAGGGTGCAGG - Intergenic
1193885741 X:86982846-86982868 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1193941218 X:87682568-87682590 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1193941277 X:87682815-87682837 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1194186438 X:90778004-90778026 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
1194186497 X:90778245-90778267 GGACTTTCCGCTAAGGGTGAAGG + Intergenic
1194293816 X:92104915-92104937 GGACTTGCCACTAAGGGTGAAGG + Intronic
1194293833 X:92104979-92105001 AGACTTGCCACCAAGGGTGAAGG + Intronic
1194308746 X:92277779-92277801 GGACTTGCCACTAACAGTGAAGG + Intronic
1194308777 X:92277904-92277926 GGACTTGCCGCTAAGGGTGAAGG + Intronic
1194351038 X:92825320-92825342 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1194351072 X:92825447-92825469 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1194351091 X:92825511-92825533 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1194366864 X:93023809-93023831 GGACTTGTCGCTAAGGGTGAAGG - Intergenic
1194366899 X:93023930-93023952 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1194503197 X:94703593-94703615 GGACTTGCCACTCAGGGTGAAGG + Intergenic
1194503230 X:94703714-94703736 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1194660439 X:96624845-96624867 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1194822968 X:98528983-98529005 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1194822987 X:98529047-98529069 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1194823021 X:98529172-98529194 GGACTTGACGCTAAGGGTGAAGG + Intergenic
1194874051 X:99164325-99164347 GGGCTTGCAGCTAAGGTTGAAGG + Intergenic
1195327068 X:103766468-103766490 GTGCTTGCCACTAAGGGTGAAGG + Intergenic
1195841228 X:109179218-109179240 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1195841262 X:109179339-109179361 GGACTTGCCCCTAAGGGTGAAGG - Intergenic
1195908876 X:109869900-109869922 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1195908895 X:109869962-109869984 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1196072821 X:111544687-111544709 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1196072854 X:111544812-111544834 GGACTTGCTGCTCAGAGTGAAGG - Intergenic
1196165265 X:112531282-112531304 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1196165294 X:112531407-112531429 GGACTTGCCGCTAAGAGTGAAGG - Intergenic
1196165324 X:112531532-112531554 GGACTTGCTGCTAAGAGTGAAGG - Intergenic
1196221214 X:113113525-113113547 GTACTTGCTGCTAAGGGTGAAGG + Intergenic
1196299812 X:114040993-114041015 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1196330570 X:114467550-114467572 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1196330588 X:114467614-114467636 GGACTTGCCGCTAAGAGTGAAGG - Intergenic
1196341953 X:114606156-114606178 GGACTTGCCACTAAGGGTGAAGG + Intronic
1196341969 X:114606218-114606240 GGACTTGCCGCTAAGGGTGAAGG + Intronic
1196341997 X:114606343-114606365 GGACTTGCCGCTTAAGGTGAAGG + Intronic
1196525685 X:116725658-116725680 GTACTTGCCACTAAGGGTGAAGG + Intergenic
1196525734 X:116725836-116725858 GTACTTGCTGTTAAGGGTGAAGG + Intergenic
1196533738 X:116817186-116817208 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1196533757 X:116817250-116817272 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1196533774 X:116817314-116817336 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1196572255 X:117280018-117280040 GGACTTGCTGCAAAGGGTGAAGG - Intergenic
1196572320 X:117280264-117280286 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1196572338 X:117280328-117280350 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1196774059 X:119322455-119322477 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
1196774091 X:119322580-119322602 GGACTTGCCACTAAGGGTGAAGG + Intergenic
1196992930 X:121347814-121347836 GTACTTGCCGGTAAGGGTGAAGG + Intergenic
1197064672 X:122222894-122222916 GGACTTGCGGCTAAGGGTGAAGG - Intergenic
1197064703 X:122223020-122223042 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1197352258 X:125393538-125393560 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
1197352288 X:125393663-125393685 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1197470722 X:126863950-126863972 GGACTTGCAGCTAAGGGTGAAGG - Intergenic
1197932868 X:131713008-131713030 GGACTTGCTGCTAAGAGTGAAGG - Intergenic
1198598185 X:138259499-138259521 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1198598220 X:138259624-138259646 GGACTTACCACTAAGGGTGAAGG - Intergenic
1198599604 X:138269049-138269071 GGACTTGCTGCTAAGGGTGAAGG + Intergenic
1198599636 X:138269170-138269192 GGACTTGCCGCTAAGGGTAAAGG + Intergenic
1199419555 X:147628964-147628986 TGACTTGCCTCTAAAGATGAAGG - Intergenic
1199576216 X:149316472-149316494 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1199576250 X:149316597-149316619 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1199576283 X:149316722-149316744 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1200533037 Y:4360080-4360102 GGACTTGCCGCTAAGGGTGAAGG + Intergenic
1200533098 Y:4360321-4360343 GGACTTTCTGCTAAGGGTGAAGG + Intergenic
1200611333 Y:5329456-5329478 GGACTTGCCACTAAGGGTGAAGG + Intronic
1200611352 Y:5329520-5329542 GGACTTGCCGCCAAGGGTGAAGG + Intronic
1200659365 Y:5942000-5942022 GGACTTGCCGCTAAGGGTGAAGG - Intergenic
1200659401 Y:5942127-5942149 GGGCTTGCCGCTAAGGGTGAAGG - Intergenic
1200659419 Y:5942191-5942213 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1200675087 Y:6140065-6140087 GGACTTGTCGCTAAGGTTGAAGG - Intergenic
1200675121 Y:6140186-6140208 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1201229988 Y:11854938-11854960 GGACTTGAACATAAGGGTGATGG + Intergenic
1201307672 Y:12564507-12564529 GTGCTTGCCCCTAAGGGTGAAGG + Intergenic
1201581148 Y:15513159-15513181 GGACTTGCTGCTAAGGGTGAAGG - Intergenic
1201581181 Y:15513280-15513302 GGACTTGCCACTAAGGGTAAAGG - Intergenic
1201936844 Y:19419342-19419364 GGACTTGCCACTAAGGGTGAAGG - Intergenic
1202076784 Y:21044285-21044307 GGCCTTGCTGCCAAGGGTGAAGG + Intergenic