ID: 977217315

View in Genome Browser
Species Human (GRCh38)
Location 4:94297757-94297779
Sequence GCCGCTAAGGGTGAAGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 919
Summary {0: 197, 1: 354, 2: 164, 3: 42, 4: 162}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977217308_977217315 -2 Left 977217308 4:94297736-94297758 CCCCCTAGAAAAGCAGGACTTGC No data
Right 977217315 4:94297757-94297779 GCCGCTAAGGGTGAAGGAGAAGG 0: 197
1: 354
2: 164
3: 42
4: 162
977217309_977217315 -3 Left 977217309 4:94297737-94297759 CCCCTAGAAAAGCAGGACTTGCC 0: 31
1: 190
2: 354
3: 230
4: 230
Right 977217315 4:94297757-94297779 GCCGCTAAGGGTGAAGGAGAAGG 0: 197
1: 354
2: 164
3: 42
4: 162
977217310_977217315 -4 Left 977217310 4:94297738-94297760 CCCTAGAAAAGCAGGACTTGCCG 0: 13
1: 152
2: 413
3: 413
4: 271
Right 977217315 4:94297757-94297779 GCCGCTAAGGGTGAAGGAGAAGG 0: 197
1: 354
2: 164
3: 42
4: 162
977217311_977217315 -5 Left 977217311 4:94297739-94297761 CCTAGAAAAGCAGGACTTGCCGC 0: 68
1: 346
2: 425
3: 284
4: 202
Right 977217315 4:94297757-94297779 GCCGCTAAGGGTGAAGGAGAAGG 0: 197
1: 354
2: 164
3: 42
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977217315 Original CRISPR GCCGCTAAGGGTGAAGGAGA AGG Intergenic
900462315 1:2807592-2807614 GAGGCTCAGGGTGCAGGAGAGGG - Intergenic
900840584 1:5045857-5045879 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
901654537 1:10761919-10761941 CCCGCAAAGGGGGAAGGAAAGGG - Intronic
903296863 1:22349378-22349400 GCCACTTAGGGTGAAGGGCATGG - Intergenic
904494925 1:30881215-30881237 GCAGCTAGGGGTGAAGTAGATGG - Intronic
904500421 1:30909573-30909595 GCCGCTGGGGATGAAGGTGAAGG - Intergenic
904711435 1:32433304-32433326 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
905499573 1:38426078-38426100 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
906080709 1:43086472-43086494 GCCACTAAGGGTAAAGGAGAAGG - Intergenic
906744747 1:48213833-48213855 GCCTATAAGGGTGAAGGAGAAGG + Intergenic
907292429 1:53425314-53425336 GCTGCTAAGGATGAAGGAGAAGG - Intergenic
907503780 1:54902621-54902643 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
908461906 1:64354684-64354706 GCCGCTAAGAGTGAAAGAGAAGG + Intergenic
908461922 1:64354748-64354770 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
908592185 1:65646709-65646731 GCCACTAAGAGTGAAGGAGAAGG + Intergenic
908592229 1:65646900-65646922 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
908671060 1:66548117-66548139 ACCGGAGAGGGTGAAGGAGAAGG + Intronic
908852176 1:68387179-68387201 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
908852194 1:68387243-68387265 GCCGCTAAAGGTGAAGGAGAAGG - Intergenic
908852209 1:68387307-68387329 GTCACTAAGGGTGAAGGAGAAGG - Intergenic
908993982 1:70129489-70129511 GACGTTACGGGAGAAGGAGATGG + Intronic
909035277 1:70589353-70589375 GCCACTAAGAGTGAAAGAGAAGG - Intergenic
909222850 1:72984522-72984544 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
909223849 1:72992505-72992527 GCTGCTAAGGGTGAAGGAGAAGG + Intergenic
909223867 1:72992569-72992591 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
909223886 1:72992633-72992655 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
909788471 1:79643507-79643529 GCTGCTAAGGGTGAAGGAGAAGG + Intergenic
909909733 1:81246287-81246309 GCCGCAAAGGGTGAAGGAGCAGG - Intergenic
909978641 1:82072162-82072184 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
909984213 1:82140697-82140719 GCTGCTAAGGTGGAAGGAGCAGG + Intergenic
911570173 1:99510506-99510528 GCCACGAAGGGTGAAGGAGAAGG - Intergenic
911570190 1:99510570-99510592 GCCACTAAGAGTGAAGGAGAAGG - Intergenic
912254684 1:108046933-108046955 GAGGCTGAGGGTGAAGGAGAAGG - Intergenic
912296273 1:108473939-108473961 GCTGCTAAGAGTGAAGGAGAAGG - Intergenic
915686797 1:157642227-157642249 GCAGCCAGGAGTGAAGGAGAGGG - Intergenic
916023063 1:160811057-160811079 GCCGCTCAGGGCCAAGGAGGTGG - Intronic
916456709 1:164978427-164978449 GCTGGGAAGGGTGTAGGAGAAGG - Intergenic
916496413 1:165352374-165352396 GCGGCACAGGTTGAAGGAGAGGG + Intronic
918346914 1:183614688-183614710 GTTGCTAAGGGTGAAGGAGAAGG - Intergenic
918567884 1:185953049-185953071 GCCACTAAGGGTGAAGGAGAAGG + Intronic
918567903 1:185953113-185953135 GCCACTAAGGGTGAAGGAGAAGG + Intronic
918714602 1:187770186-187770208 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
918714620 1:187770250-187770272 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
919476163 1:198035612-198035634 GCCTCTAAGGGTGAAGGAGAAGG - Intergenic
920458031 1:206116121-206116143 GCAGCTAAGGTGGAAGGTGAGGG + Exonic
920613091 1:207461314-207461336 ACTTGTAAGGGTGAAGGAGATGG + Intronic
920829162 1:209449806-209449828 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
920829179 1:209449870-209449892 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
920829198 1:209449934-209449956 GCCGCTCAGGGTGAAGGAGAAGG - Intergenic
921212216 1:212910510-212910532 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
921459996 1:215414720-215414742 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
921519928 1:216146548-216146570 GCCGCTAAGGGTGAAGGAGAAGG - Intronic
921733179 1:218598499-218598521 GTCGCTAAGGGTGAAGGAGAAGG + Intergenic
921733196 1:218598563-218598585 GGCGCTAAGGGTGAAGGAGAAGG + Intergenic
921733214 1:218598627-218598649 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
921822597 1:219634751-219634773 GCAGGTAAGGGTGAGGGAGATGG - Intergenic
922048206 1:221966913-221966935 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
922048224 1:221966977-221966999 ACCGCTAAGGGTGAAGGAGAAGG - Intergenic
922049753 1:221977875-221977897 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
922906180 1:229175326-229175348 GCTGCTAAGTGTGAAGGAGAAGG - Intergenic
922934607 1:229413356-229413378 GCCGCTAAGAGTGAAGCAGAAGG - Intergenic
922934636 1:229413481-229413503 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
923075002 1:230602202-230602224 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
923244539 1:232119112-232119134 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
923257487 1:232233980-232234002 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
923408840 1:233688268-233688290 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
923408860 1:233688351-233688373 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
923408879 1:233688415-233688437 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
923408913 1:233688540-233688562 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
923770916 1:236936855-236936877 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
923962558 1:239102175-239102197 GCCGCTAAGAGTGAAGGAGAAGG - Intergenic
924180422 1:241434848-241434870 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
1062975443 10:1679188-1679210 CCCTCCAAGGATGAAGGAGAGGG - Intronic
1063362899 10:5471736-5471758 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1063509819 10:6634387-6634409 GCCACTAAGAGTGAAGGAGAAGG + Intergenic
1063509836 10:6634451-6634473 GTCGCTAAGGGTGAAGGAGAAGG + Intergenic
1063527874 10:6801800-6801822 GCCACTAAGAGTGAAGGAGAAGG + Intergenic
1064250741 10:13704602-13704624 GCCATGAAGGGTGAAGGACAGGG - Intronic
1064664004 10:17631475-17631497 GCCTCTAAGGGTGAAGGAGAAGG + Intergenic
1064887214 10:20123968-20123990 GCTGCTAAGGGTGAAGAAGAAGG + Intronic
1065443402 10:25773916-25773938 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1066144913 10:32547530-32547552 GACCCTAAGGGTGAAGGTCATGG + Intronic
1068058556 10:52038542-52038564 GCCGCTAAGAGTGAAGGAGAAGG + Intronic
1068179851 10:53503740-53503762 GCCGCTAAGCGTGAAGGAGAAGG + Intergenic
1068230748 10:54167670-54167692 GCTGCTAAGGGTGAAAGAGGAGG - Intronic
1068592545 10:58865731-58865753 GCCGCTAAGGGTGAAAGAGAAGG + Intergenic
1068592563 10:58865795-58865817 GCCACTAAGGATGAAGGAGAAGG + Intergenic
1069581913 10:69572350-69572372 GGTGCTAAGGGTAAGGGAGAGGG - Exonic
1070474618 10:76819205-76819227 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1070474638 10:76819269-76819291 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1070474657 10:76819333-76819355 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1070474677 10:76819397-76819419 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1070474696 10:76819461-76819483 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1070474715 10:76819525-76819547 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1070474733 10:76819589-76819611 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
1070979542 10:80633173-80633195 GCCTCTCAGGGTCATGGAGATGG + Intronic
1071897933 10:90085775-90085797 GCCGCTAAGAGTGAAGGAGAAGG + Intergenic
1071916011 10:90296024-90296046 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1071960881 10:90808278-90808300 GCTGCTAAGAGTGAAGGAGAAGG - Intronic
1071960909 10:90808399-90808421 GCCGCTAAGGATGAAGGAGAAGG - Intronic
1072011523 10:91306408-91306430 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1072805456 10:98421124-98421146 CCCGTTAAGGGTAGAGGAGAGGG - Intronic
1074740567 10:116481638-116481660 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1075248506 10:120845892-120845914 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1075564284 10:123492398-123492420 GCAGCTAAGGGAGAAGGGGGAGG + Intergenic
1076248903 10:128969053-128969075 CCCGCCAAGGCTGCAGGAGAGGG - Intergenic
1076430647 10:130399559-130399581 GCTGTTCAGGTTGAAGGAGACGG + Intergenic
1077219452 11:1409188-1409210 GCTGCAAGGGGTGAAGGGGATGG - Intronic
1077426043 11:2478258-2478280 ACCGTTCAGGGTGAAGGGGAAGG + Intronic
1077611965 11:3648865-3648887 GCCGCTAAGGGTGAAGGAGAAGG - Intronic
1077851044 11:6074801-6074823 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
1077851062 11:6074864-6074886 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
1078046345 11:7916959-7916981 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
1078758293 11:14232204-14232226 GCCGGGAAGGGTGAGGGGGAGGG - Intronic
1079313912 11:19391258-19391280 GAAGCTAAGGGTGAAGCAGGGGG - Intronic
1079672754 11:23188588-23188610 GCTGCTAAGGGTGAAGGAGAAGG + Intergenic
1079727294 11:23891949-23891971 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1080028124 11:27633849-27633871 GCCACTAAGAGTGAAGGAGAAGG + Intergenic
1080028142 11:27633913-27633935 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1081356614 11:42121594-42121616 GCTGCTGAGGTTGAAGGAGAAGG - Intergenic
1082000421 11:47391077-47391099 GCAGCCCAGGGTGAAGGAGCAGG + Intergenic
1083351874 11:62035399-62035421 ACCTCTATGGGTGAAGGAGGAGG - Intergenic
1084046960 11:66574586-66574608 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1084110869 11:67013545-67013567 GCCTCGAAGGGTGAATGGGATGG - Intronic
1084232091 11:67760639-67760661 GCCACTAAGGGTGAAGGAAAAGG - Intergenic
1084355346 11:68634688-68634710 GCCACTCAGGGTGAAGGAGAAGG - Intergenic
1084613481 11:70219058-70219080 GCTGCTAAGGGTGAAGGAGAAGG + Intergenic
1084613508 11:70219179-70219201 GCTGCTAAGAGTGAAGAAGAAGG + Intergenic
1084826886 11:71738423-71738445 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
1084961575 11:72719641-72719663 ACGGGTAGGGGTGAAGGAGAAGG - Intronic
1085987800 11:81807120-81807142 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
1087098898 11:94346684-94346706 GCCACTTAGGGTGAAGGAGAAGG - Intergenic
1087127600 11:94642549-94642571 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1087196699 11:95310508-95310530 GCCACTGAGGGTGAAGGAGAAGG - Intergenic
1087196718 11:95310572-95310594 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1087314428 11:96588697-96588719 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1087314445 11:96588761-96588783 GCCACTAAGAGTGAAGGAGAAGG - Intergenic
1087839762 11:102908923-102908945 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
1088332744 11:108670303-108670325 TCCGTGAAGGCTGAAGGAGAGGG + Intronic
1089348902 11:117810302-117810324 GCCACTAAGGGTGAAGGAGAAGG - Intronic
1089472287 11:118730874-118730896 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1089502368 11:118940165-118940187 TGCCCTAAGGGTGCAGGAGATGG - Intronic
1089987182 11:122825386-122825408 GCCACTAAGAGTGAAGGAGAAGG - Intergenic
1089987227 11:122825566-122825588 CCTGCTAAGGGTGAAGGAGAAGG - Intergenic
1090527000 11:127547487-127547509 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
1090546697 11:127773855-127773877 GCCACTAAGGGTGGAGGAGAAGG + Intergenic
1090546708 11:127773919-127773941 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1090850791 11:130569012-130569034 GCCGCTGAGGGTGAAGGAGAAGG + Intergenic
1090872146 11:130758156-130758178 GCCGCTGAGGGTGAAGGAGAAGG + Intergenic
1090927175 11:131259292-131259314 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1090943042 11:131405462-131405484 GATGTTAAGGGTGAAGGAAAGGG - Intronic
1091886312 12:4019539-4019561 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1092474259 12:8805825-8805847 GCCACTAAGAGTGAAGGAGAAGG - Intergenic
1092592918 12:9967649-9967671 GCCGCTAAGGGTGAAGGAGAAGG + Intronic
1092626945 12:10337623-10337645 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1092723933 12:11466990-11467012 GCCGCTAAGGGTGAAGGAGAAGG + Intronic
1092789505 12:12059332-12059354 GCCGCTAAGGGTGAAGGATAAGG - Intronic
1093268202 12:17026354-17026376 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
1093578540 12:20763981-20764003 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1093584694 12:20821606-20821628 GCCACTAAGGGTGAAGGAGAAGG + Intronic
1093813031 12:23510671-23510693 GCCGCTAAGGGTGAAGGACCAGG + Intergenic
1093950889 12:25164230-25164252 GCTGCTAAGGGTGAAGGAGAAGG - Intronic
1094316262 12:29139724-29139746 GCTGCTAAGGGTGAAGGAGAAGG + Intergenic
1094400465 12:30056984-30057006 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1094400480 12:30057044-30057066 GCTGCTAAGGGTGAGGGAGAAGG - Intergenic
1094825555 12:34266601-34266623 GATGCTAAGGGTGAAGGAGAAGG - Intergenic
1096369150 12:51054119-51054141 GCCTCTAGGGATGATGGAGAAGG - Intronic
1097176403 12:57145875-57145897 GCAGCTGAGGGTAAAGGAGCTGG + Intronic
1097398380 12:59102817-59102839 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
1097417248 12:59327921-59327943 GCCGCCAAGGGTGAAGGAGAAGG + Intergenic
1098173828 12:67771325-67771347 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1098401992 12:70086225-70086247 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1098402011 12:70086289-70086311 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1098402048 12:70086417-70086439 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1098628854 12:72704281-72704303 GCTGCTAAGAGTGAAGGAGAAGG - Intergenic
1098654012 12:73006626-73006648 GCTGCTAAGGTTGAAGGAGAAGG + Intergenic
1099188505 12:79540846-79540868 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1099292313 12:80787921-80787943 GCCACTAAGAGTGAAGGAGAAGG + Intergenic
1099762368 12:86939688-86939710 GCCGCTAAGGGTGAAGGAGAGGG - Intergenic
1100561075 12:95749830-95749852 GCCGCTAAGGGTGAAGGAGAAGG - Intronic
1100561092 12:95749894-95749916 GCCACTAAGGGTGAAGGAGAAGG - Intronic
1100561111 12:95749958-95749980 GCCACTAAGGGTGAAGGAGAAGG - Intronic
1100561130 12:95750022-95750044 GCCGCTAAGAGTGAAGGAGAAGG - Intronic
1103601003 12:122054562-122054584 GCAGCTAAGTGTGCAGGAGAGGG + Intronic
1104216824 12:126741925-126741947 ACTGCTTAGGGTGAAGGAAAGGG - Intergenic
1105405286 13:20128053-20128075 GGCGGTCAGGCTGAAGGAGAGGG - Intergenic
1105584485 13:21731259-21731281 GCCTCTCAGGGAGAGGGAGAGGG + Intergenic
1106943211 13:34799558-34799580 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1106943229 13:34799622-34799644 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1106943246 13:34799686-34799708 GCTGCTGAGGGTGAAGGAGAAGG - Intergenic
1107037824 13:35919487-35919509 GCTGCTCCGGCTGAAGGAGAGGG + Intronic
1107075355 13:36317326-36317348 GCTGCTAAGAGTGAAGGAGAAGG - Intronic
1107220503 13:37973914-37973936 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
1107220520 13:37973978-37974000 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1107222140 13:37995572-37995594 GCTGATGAGGGTGAAGTAGAAGG - Intergenic
1107683341 13:42872122-42872144 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1107683360 13:42872186-42872208 GCTGCTAAGGGTGAAGGGGAAGG + Intergenic
1107811437 13:44204133-44204155 GCTGCCAGGGGTTAAGGAGAGGG - Intergenic
1108512773 13:51170813-51170835 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1108512789 13:51170877-51170899 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1108913623 13:55583004-55583026 GCCACTAAGAGTGAAGGAGAAGG + Intergenic
1108913641 13:55583068-55583090 GCCACTAAGGTTGAAGGAGAAGG + Intergenic
1108919765 13:55659774-55659796 ACCACTAAGGGTGAAGGAGAAGG + Intergenic
1108947240 13:56041311-56041333 GCAGCTAAGAGTGAAGGAGAAGG - Intergenic
1109499079 13:63214072-63214094 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1109709856 13:66146023-66146045 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1109716969 13:66231192-66231214 GCCACTAAGGGTGAATTAGAAGG + Intergenic
1109716987 13:66231256-66231278 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1109717005 13:66231320-66231342 GCTGATAAGGGTGAAGGAGAAGG + Intergenic
1110650733 13:77938463-77938485 GCTGCTAAGGGTGAAGGAGAAGG + Intergenic
1110765249 13:79275042-79275064 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
1110845117 13:80184514-80184536 GCTGCTCAGGGTCAAGGAGAAGG - Intergenic
1110978255 13:81867060-81867082 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
1111301797 13:86359175-86359197 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1111362316 13:87191121-87191143 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1111459058 13:88517584-88517606 GCCACTAAGGGTGAAAGAGAGGG + Intergenic
1111459091 13:88517712-88517734 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1111630270 13:90840550-90840572 GCCGCTAACGGTGAAGGAGAAGG - Intergenic
1111631908 13:90853322-90853344 GCCGCTAAGGGTGAAAGAGAAGG + Intergenic
1112236626 13:97643272-97643294 GCCACTAACGGTGAAGGAGAAGG - Intergenic
1112771128 13:102795943-102795965 GCCTGTAAGAGGGAAGGAGATGG + Intronic
1112889540 13:104212856-104212878 GCTGCTAAGGGTGAAGGAGAAGG + Intergenic
1113324091 13:109266200-109266222 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1113324110 13:109266264-109266286 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1113896001 13:113764871-113764893 GCCTCTAAGGAGGCAGGAGATGG + Intronic
1115240789 14:31249974-31249996 GCTGCTAAGGATGAAGGAGAAGG + Intergenic
1115240808 14:31250038-31250060 GCCGCTGAGGGTGAAGGGGAAGG + Intergenic
1115240825 14:31250094-31250116 GCCGCTGAGGGTGAAGGGGAAGG + Intergenic
1115240845 14:31250158-31250180 GCCGCTGAGGGTGAAGGGGAAGG + Intergenic
1115647800 14:35382379-35382401 GCAGGGAAGGGTGAAAGAGAGGG + Intergenic
1115904577 14:38191642-38191664 GCCACTCAGGGTGAAAGAGAAGG - Intergenic
1116179457 14:41516870-41516892 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1116534984 14:46017123-46017145 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1116573275 14:46545032-46545054 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
1116613314 14:47105178-47105200 GCCACTAAGGGTGAAGGAGAAGG - Intronic
1116703528 14:48267297-48267319 GCCGCTCAGGGTGAAGGAGAAGG + Intergenic
1116952708 14:50894169-50894191 GCCACTAAGGATGAAGGAGAAGG - Intronic
1116952726 14:50894233-50894255 GCCGCTAAGGGTGAAGGAGAAGG - Intronic
1117793113 14:59361784-59361806 CCTGCTCTGGGTGAAGGAGACGG + Intronic
1117958122 14:61138175-61138197 GCCGCTAAGGGTGAAGGAAAAGG + Intergenic
1118937522 14:70300965-70300987 CTTGCTAAGGGTGAAGGAGAAGG + Intergenic
1118971814 14:70643256-70643278 GCTGCTAGGGGTGAAGGAAAAGG + Intronic
1119022189 14:71125170-71125192 GCCACTAAGAGTGAAGGAGAAGG - Intergenic
1119022219 14:71125288-71125310 GCTGCTAAGGGGGAAGGAGAAGG - Intergenic
1120203246 14:81561231-81561253 TCAGCCAAGGGTGATGGAGATGG + Intergenic
1120438274 14:84505002-84505024 GCCGCTAAAGGTGAAGGAGAAGG + Intergenic
1120660179 14:87239810-87239832 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
1121703420 14:95973840-95973862 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1121703436 14:95973904-95973926 GCCGCTAAGGGTGCAGGAGAAGG - Intergenic
1121703453 14:95973968-95973990 GCCGCTAAGGTTGAAGGAGGAGG - Intergenic
1122040788 14:98986182-98986204 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1124159155 15:27253377-27253399 CACGCTAAGGCAGAAGGAGAGGG - Intronic
1124897253 15:33788673-33788695 GCCCGTAAGGATGGAGGAGATGG - Intronic
1125045530 15:35239620-35239642 GCCGCTAAGGTTGAAGGAGAAGG - Intronic
1125045548 15:35239684-35239706 GCCACTAAGGGTGAAGGAGAAGG - Intronic
1125045565 15:35239748-35239770 GCTGCTAAGGGTGAAGGAGAAGG - Intronic
1125131753 15:36290547-36290569 GCTGCTAAGGGTGAAGTAGAAGG + Intergenic
1125455135 15:39850540-39850562 GTTGCTAGGGGTTAAGGAGAGGG + Intronic
1126530343 15:49703774-49703796 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
1126721149 15:51581311-51581333 ACAGCGAGGGGTGAAGGAGAGGG - Intronic
1126843538 15:52739541-52739563 GCCGCTAAAGGTGAAGGAGAAGG - Intergenic
1126912584 15:53431483-53431505 GCCACTAAGGGTGAAGGAGAGGG + Intergenic
1129921573 15:79323630-79323652 CCCTCAGAGGGTGAAGGAGAAGG - Intronic
1130854883 15:87832164-87832186 GCCGCTAAGAGTGAGGGAGAAGG - Intergenic
1130947688 15:88561231-88561253 GCCGCTAGGGGTGAAGGAGAAGG + Intergenic
1131683979 15:94751719-94751741 GCCGCCGAGGGTGAAGGAGAAGG - Intergenic
1131882732 15:96876644-96876666 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1131882751 15:96876708-96876730 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1132340207 15:101073493-101073515 GCCGCTCAGGGTGAAGGAGAAGG - Intronic
1133651184 16:7815639-7815661 GCCGCTAAGAGTGAAGGAGAAGG - Intergenic
1133701249 16:8311240-8311262 GCCACTAAGGGTGAAGATGTTGG - Intergenic
1133766909 16:8844456-8844478 GCCGCTAAGGGTGAAGGAGAAGG + Intronic
1133869824 16:9676241-9676263 GCTGCTAAGGGTGAAGGAGAAGG + Intronic
1138804722 16:60079727-60079749 GCTGCTAAGAGTGAAGGAGAAGG - Intergenic
1139039418 16:62983781-62983803 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1139039455 16:62983904-62983926 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1139039492 16:62984029-62984051 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1139039528 16:62984154-62984176 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1139039628 16:62984523-62984545 GCCACTAAGGGTGAAGGAAAAGG + Intergenic
1139226111 16:65234525-65234547 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
1139359870 16:66390880-66390902 GAAGCTGAGGGTGAAGGAGCTGG + Intronic
1139871566 16:70112641-70112663 GCCGATCATGGTGATGGAGAAGG + Intergenic
1139943229 16:70621106-70621128 GTCGCTAAGGGTGAAGGAGAAGG + Intronic
1139943913 16:70625436-70625458 GCCGCTAAGGGCGAAGGAGAAGG + Intronic
1140364369 16:74369845-74369867 GCCGATCATGGTGATGGAGAAGG - Intergenic
1141796500 16:86278779-86278801 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1141796520 16:86278843-86278865 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1141796540 16:86278907-86278929 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1141796560 16:86278971-86278993 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1141865408 16:86746686-86746708 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1141884304 16:86881212-86881234 CTCGCTCAGGCTGAAGGAGAAGG - Intergenic
1142598821 17:1043028-1043050 GAGGCTAAGGGTGCAGGAGTGGG + Intronic
1143561970 17:7701802-7701824 GCCTCCAAGGGAGGAGGAGAGGG + Intronic
1143621089 17:8080587-8080609 GCCGCCAAGGTTGGGGGAGAGGG + Exonic
1144104421 17:11972743-11972765 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1145903796 17:28505695-28505717 GCCCCTGAGGGAGAGGGAGATGG + Intronic
1146461973 17:33053442-33053464 GAGGCTAAGGGAGAAGGAAAAGG - Intronic
1146597666 17:34184169-34184191 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1146597685 17:34184233-34184255 GCCACTAAGGGTGAAAGAGAAGG - Intergenic
1147794253 17:43031390-43031412 TCGGCTAAGGGTACAGGAGAGGG + Intergenic
1147933744 17:43999299-43999321 GCGCCTAAGGGAGAACGAGAGGG + Intronic
1150228352 17:63535964-63535986 GCTGCTGAAGGTGAAGTAGAGGG - Exonic
1150427112 17:65085816-65085838 GACCCGAAGAGTGAAGGAGATGG + Intergenic
1150744111 17:67802443-67802465 GCCAGGAAGGGTGGAGGAGAGGG + Intergenic
1151622286 17:75253599-75253621 ACCGCTAAGGGTGAAGGAGAAGG - Intronic
1151839943 17:76610565-76610587 ACCGCTAAGGGTGAAGGAGAAGG + Intergenic
1152808973 17:82372210-82372232 GTCGCTAGGGGGGAAGGGGAGGG - Intergenic
1152885742 17:82848181-82848203 GCCGCTCAGGGCGAAGGTGTTGG - Intronic
1152908378 17:82982929-82982951 GCAGCTGGGGGTGGAGGAGATGG + Intronic
1155697248 18:28697931-28697953 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1155941335 18:31804726-31804748 GCCACTAAGAGTGATGGAGAAGG - Intergenic
1157776086 18:50397293-50397315 GCTGCTTAGAGGGAAGGAGAGGG + Intergenic
1158336159 18:56416504-56416526 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1158336193 18:56416632-56416654 GCCACTAAGAGTGAAGGAGAAGG - Intergenic
1158394870 18:57071472-57071494 GCCACTAAGAGTGAAGGAGAAGG + Intergenic
1159834828 18:73325591-73325613 GTGGCTAAGGGTGAAGGAGAAGG - Intergenic
1159834846 18:73325655-73325677 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
1160208554 18:76857652-76857674 GCGGGCAAGGGTGCAGGAGATGG - Intronic
1160258581 18:77268522-77268544 GGCGGTAAGGGAGAAGAAGAAGG - Intronic
1161661520 19:5549512-5549534 GCCACTGAGGGTGAAGGAGAAGG - Intergenic
1161716002 19:5876707-5876729 GCCGCTCAGGAGGAGGGAGAAGG + Intronic
1163900497 19:20095754-20095776 GCCGCTAAGGGTGAAGGAGAAGG + Intronic
1163906843 19:20155586-20155608 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1164152771 19:22569249-22569271 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1164459427 19:28434580-28434602 GCCTCTAAGGGTGAAGGAGAAGG + Intergenic
1164459441 19:28434644-28434666 GCTGCTGACGGTGAAGGACAAGG + Intergenic
1164459469 19:28434772-28434794 GCCATTAAGGGTGAAGGAGAAGG + Intergenic
1165047579 19:33117843-33117865 GACGCACAGGCTGAAGGAGAAGG + Exonic
1165408095 19:35642822-35642844 ACCCCTGAGGGTGAAGGAAAAGG + Intronic
1165510494 19:36264095-36264117 GCTGCTAAGGGTGAAGGAGAAGG + Intergenic
1165510525 19:36264216-36264238 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
1165835129 19:38750488-38750510 GCCACTAACGGTGAAGGAGAAGG - Intronic
1165835157 19:38750609-38750631 GCTACTAAGGGTGAAGGAGAAGG - Intronic
1166499150 19:43328262-43328284 ACCGCTAAGGGTGAAGGAGAAGG + Intergenic
1167046791 19:47054400-47054422 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
1167901943 19:52628746-52628768 GCTGCTAAGGGTGAAGGAGAAGG - Intronic
1168212321 19:54899624-54899646 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
1168228177 19:55011452-55011474 GCCGCTAAGAGTGAAGGAGAAGG + Intergenic
925478802 2:4247760-4247782 GCAGCTAGGGGTGACGGGGAAGG - Intergenic
925544300 2:5001764-5001786 GCTGTTAAGAGTGAAGGAGAAGG - Intergenic
925829034 2:7877415-7877437 GCTACTAAGGGTGAAGGAGAAGG + Intergenic
925829050 2:7877479-7877501 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
925829067 2:7877543-7877565 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
925829085 2:7877607-7877629 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
925829102 2:7877671-7877693 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
925829120 2:7877735-7877757 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
925829153 2:7877863-7877885 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
926407556 2:12570730-12570752 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
926413374 2:12627389-12627411 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
926413392 2:12627454-12627476 GCCACTAAGAGTGAAGGAGAAGG - Intergenic
926464285 2:13168683-13168705 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
926815750 2:16796644-16796666 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
928296731 2:30090201-30090223 GCTGCTAAGGGTGAAGGTGAAGG - Intergenic
928779905 2:34805740-34805762 GCCGCTAAGGATGAAGGAGAAGG + Intergenic
928928361 2:36600084-36600106 GCCGCTAAGGGTGAAGGAGAAGG - Intronic
929030969 2:37649606-37649628 GCTGCTGAGGGTGCAGGGGAGGG + Intronic
929076898 2:38085551-38085573 GCCGCTCAGGGTGAAGGAGAAGG + Intronic
929562781 2:42966279-42966301 GCTGATAAGGGTGAAGAAGAGGG - Intergenic
929793287 2:45039182-45039204 GTCACTAAGGGTGAAGGAGAAGG + Intergenic
930954894 2:57193992-57194014 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
930954913 2:57194056-57194078 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
930958211 2:57230013-57230035 GCCACTAAGGATGAAGGAGAAGG - Intergenic
931026581 2:58118055-58118077 GCTGCTAAGGGTGAAGGAGAAGG + Intronic
931026599 2:58118119-58118141 GCCACTAAGGGTGAAGGAGAAGG + Intronic
931042488 2:58315112-58315134 GCCACTCAGGGTGAAGGAGAAGG - Intergenic
931236657 2:60418329-60418351 GCTGCTGAGGTTGAAGGAGAAGG - Intergenic
931236674 2:60418393-60418415 GCTGCTGAGGGTGAAGGAGAAGG - Intergenic
931236693 2:60418457-60418479 GCCACTGAGCGTGAAGGAGAAGG - Intergenic
931236708 2:60418521-60418543 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
931236727 2:60418585-60418607 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
931236743 2:60418649-60418671 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
931625552 2:64253448-64253470 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
931625570 2:64253512-64253534 GCCACTGAGCGTGAAGGAGAAGG - Intergenic
931704777 2:64938168-64938190 GCAGCTAAGGCTGAAGCAGGGGG - Intergenic
931850208 2:66244893-66244915 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
931850226 2:66244957-66244979 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
931948034 2:67332474-67332496 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
932152592 2:69386984-69387006 GCCGCTAAGGCCCAAGGCGACGG - Intronic
932295615 2:70621452-70621474 GCCACTAAGAGTGAAGGAGAAGG - Intronic
932295646 2:70621574-70621596 GCTGCTAAGAGTGAAGGAGAAGG - Intronic
932359042 2:71089851-71089873 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
932367843 2:71164392-71164414 GCCGCTGAGGGTGAAGGAGAAGG + Intergenic
932367873 2:71164517-71164539 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
932367922 2:71164703-71164725 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
932741303 2:74293053-74293075 GGAGCTGAGGGTGAAGCAGAGGG + Intronic
932854405 2:75218489-75218511 GCCGCAAAGGGTGAAGGAGAAGG + Intergenic
932974172 2:76578663-76578685 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
933079055 2:77966066-77966088 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
933079074 2:77966130-77966152 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
933163535 2:79052342-79052364 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
933179998 2:79216677-79216699 GTGGCTAAGGGTGAAGGAGAAGG + Intronic
933329714 2:80879153-80879175 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
936175770 2:110218890-110218912 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
936175783 2:110218954-110218976 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
936883144 2:117279764-117279786 GCCGCTAAGGGTGAAGGAGAGGG - Intergenic
938181570 2:129189489-129189511 GTCACCCAGGGTGAAGGAGAAGG + Intergenic
939083347 2:137687677-137687699 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
939865723 2:147470174-147470196 GCCCCTCAGGGTGAACAAGATGG - Intergenic
940529983 2:154868280-154868302 GCCACTCAGGGTGAAGGAGAAGG - Intergenic
940676022 2:156724864-156724886 GCCACTCAGGGTGAAGGAGAAGG + Intergenic
941340193 2:164296811-164296833 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
941340210 2:164296875-164296897 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
941353191 2:164460139-164460161 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
941456394 2:165715198-165715220 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
941936106 2:170982406-170982428 GCTGCTAAGGGTGAGGGAGAAGG + Intergenic
942096887 2:172542754-172542776 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
942096902 2:172542814-172542836 GCCACTAAGAGTGAAGGAGAAGG - Intergenic
943421795 2:187675243-187675265 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
943806430 2:192131379-192131401 GCCGCTAAAGGTGAAGGAGAAGG - Intronic
943806447 2:192131443-192131465 GCCACTAAGGGTGAAGGAGAAGG - Intronic
943834948 2:192507034-192507056 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
944387241 2:199180369-199180391 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
944393927 2:199247906-199247928 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
944608991 2:201380907-201380929 GGCTCAAAGGGTAAAGGAGAAGG + Exonic
945153319 2:206811614-206811636 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
945173240 2:207018175-207018197 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
945301688 2:208220964-208220986 GCTGCTAAGGGTGAAGGAGAAGG + Intergenic
945375891 2:209079026-209079048 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
945394118 2:209300288-209300310 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
945938093 2:215923309-215923331 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
946070024 2:217026351-217026373 GGCGTTAAGGGTCAAGAAGAGGG - Intergenic
946215212 2:218178627-218178649 GCCACTAACGGTGAAGGAGAAGG + Intergenic
946215242 2:218178752-218178774 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
946215273 2:218178877-218178899 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
946781236 2:223194537-223194559 GCCGCTAAGGGTGAAGGAGAAGG + Intronic
946886297 2:224226284-224226306 GCCCCTAAGGGTGAAGGAGAAGG - Intergenic
946893054 2:224297597-224297619 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
948158294 2:235802172-235802194 GCGATTTAGGGTGAAGGAGAAGG + Intronic
948179150 2:235966192-235966214 TCCTCTAAGGATGGAGGAGAGGG + Intronic
948179198 2:235966345-235966367 TCCTCTAAGGATGGAGGAGAGGG + Intronic
948390434 2:237607740-237607762 GCCACTAAGGGGGAAGGAGAAGG - Intergenic
948603553 2:239120830-239120852 GCAGCTGAGGGTGGAGGGGAGGG + Intronic
1170069070 20:12344993-12345015 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
1170106024 20:12754864-12754886 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1170165698 20:13359007-13359029 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1170325692 20:15152572-15152594 GCCACTAAGGGTGAAGGTGAAGG + Intronic
1170820893 20:19755773-19755795 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1171174475 20:23041262-23041284 GCCACTAAGAGGGAAGTAGATGG - Intergenic
1171983064 20:31640477-31640499 GCCTTTAAGGGTGAAGAGGAGGG + Intronic
1172013605 20:31860763-31860785 GCCCCTCATGGTGGAGGAGAGGG + Intronic
1172179575 20:32993431-32993453 GCTGCTACTGGTGAAAGAGAAGG + Intronic
1172786785 20:37473781-37473803 GGTGCTGAGGGTGAAGGCGAGGG + Intergenic
1173101668 20:40094089-40094111 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1173118668 20:40270059-40270081 GCCATTAAGGGTGAAGGAGAAGG - Intergenic
1173118687 20:40270123-40270145 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1173764877 20:45598178-45598200 GAAGCTAAGGGTGCTGGAGATGG + Intergenic
1173781433 20:45760306-45760328 GCCGCTAAGGGTGAAGGAGAAGG - Intronic
1174541614 20:51293846-51293868 GCCGCTTAGGATCAAGGACATGG + Intergenic
1174656646 20:52177366-52177388 GCTGCCAAGGGACAAGGAGAAGG - Intronic
1175302459 20:57952573-57952595 GTCACCAGGGGTGAAGGAGAGGG + Intergenic
1177100424 21:16893171-16893193 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
1179387315 21:40955765-40955787 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1180560626 22:16611926-16611948 GAAGCTAAGGGAGAAGGAGGAGG - Intergenic
1180560689 22:16612272-16612294 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1180560707 22:16612336-16612358 GCCACTAAGTGTGAAGGGGAAGG - Intergenic
1180560724 22:16612400-16612422 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1182113727 22:27742930-27742952 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
1182113747 22:27742996-27743018 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1183080535 22:35452998-35453020 GCTGCTCAGGGTGAAGCTGAGGG + Intergenic
1185064097 22:48622086-48622108 CCCACTCAGGGTGCAGGAGAAGG - Intronic
1185234733 22:49705239-49705261 GTCGCTAAGGGGGATGGAGGAGG + Intergenic
949162306 3:895429-895451 GCCGCTAAGAGTGAAGGAGAAGG + Intergenic
949190566 3:1244345-1244367 GCCGCTGAGGGTGAAGGAGAAGG + Intronic
949190585 3:1244409-1244431 GCCGCTGAGGGTGAAGGAGAAGG + Intronic
949190604 3:1244473-1244495 GCCGCTGAGGGTGAAGGAGAAGG + Intronic
949670942 3:6398593-6398615 GCCGCTAAGAGTGAATTAGAAGG - Intergenic
949827230 3:8177972-8177994 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
950926279 3:16745235-16745257 GCCACTAAGGGTGATGGAGAAGG - Intergenic
951299016 3:20972246-20972268 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
952663660 3:35879086-35879108 GCCAATAAGGGTGAAGGAGAAGG + Intergenic
952729826 3:36626953-36626975 TGAGCTAAGGATGAAGGAGATGG + Intergenic
952895484 3:38075791-38075813 GCCACTAAGGGTGAAGGAGAAGG + Intronic
952896729 3:38082621-38082643 GCCGCTAAGGGTGAAGGAGAAGG + Intronic
952967569 3:38630760-38630782 TCAGCTAAGGGAGAAGGGGAGGG - Intronic
953077359 3:39582642-39582664 GCTGCTAAGAGTGAGGGAGAAGG + Intergenic
953176964 3:40561850-40561872 GCTGCTAAGGGTGAAGGAGAAGG - Intronic
953364085 3:42326904-42326926 GCCCATAAGAGTGAGGGAGAAGG - Intergenic
953825915 3:46251027-46251049 GCCACTAAGAGTGAAGGAGAAGG + Intronic
954969464 3:54639184-54639206 GCTGCTAAGGGTGAAGGAGAAGG + Intronic
954969481 3:54639248-54639270 GCCGCTAAGGGTGAAGGAGAAGG + Intronic
956549157 3:70439484-70439506 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
957060106 3:75474813-75474835 GCTGCTAAGGGTGAAGGAGAAGG + Intergenic
957294996 3:78324652-78324674 GCAGCTAAGAGTGAAGGAGAAGG - Intergenic
957317525 3:78587900-78587922 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
959288571 3:104444775-104444797 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
959485967 3:106927402-106927424 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
959972474 3:112422333-112422355 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
960283068 3:115798136-115798158 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
960310342 3:116110098-116110120 GCTGCTAAGGGTGAAGGAGAAGG + Intronic
961164967 3:124757238-124757260 GCCGCTAAGGATGAAGGGGAAGG + Intergenic
961293279 3:125864593-125864615 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
961702521 3:128757366-128757388 GCCACTGATGGTGCAGGAGAGGG + Intronic
961711803 3:128833806-128833828 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
961730369 3:128960743-128960765 GCCGCTGAGGGTGAAGGAGAAGG - Intronic
961730388 3:128960807-128960829 GCCGCTGAGGGTGAAGGAGAAGG - Intronic
961730407 3:128960871-128960893 GCCGCTAAGGGTGAAGGAGAAGG - Intronic
961747368 3:129073114-129073136 GCCACCAAGGCTGGAGGAGAGGG + Intergenic
961880811 3:130060105-130060127 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
961880845 3:130060226-130060248 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
963058389 3:141205863-141205885 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
963425026 3:145114033-145114055 GTCGCTAAGGGTGAAGGAGAAGG - Intergenic
963456883 3:145555935-145555957 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
963468420 3:145711402-145711424 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
963521420 3:146363054-146363076 CTTGCTAAGGGTGAAGGAGAAGG - Intergenic
963684100 3:148415242-148415264 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
963684118 3:148415306-148415328 GCTGCTAAGAGTGAAGGAGAAGG - Intergenic
964067605 3:152597972-152597994 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
964906736 3:161726673-161726695 GCTGCTAAGGGTGAAGGAGAAGG + Intergenic
964906769 3:161726794-161726816 GCCACTAAGATTGAAGGAGAAGG + Intergenic
964983457 3:162713459-162713481 GCAACTAAGGGTGAAGGAGAAGG - Intergenic
965031638 3:163376778-163376800 GCTGCTAATGGTGATGAAGAAGG - Intergenic
965105430 3:164346861-164346883 GCCGCTAAGGATGAAGGAGAAGG + Intergenic
965262853 3:166505499-166505521 GCCACTAAGGGTGAAAGAGAAGG + Intergenic
965286919 3:166828717-166828739 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
965336127 3:167432184-167432206 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
965625095 3:170677285-170677307 GCCACTAAGGGTGAAGGAGAAGG + Intronic
965626524 3:170688110-170688132 GCCACTAAGGGTGAAGGAGAAGG + Intronic
965626557 3:170688229-170688251 GCCACTAAGAGTGAAGGAGAAGG + Intronic
965640265 3:170822790-170822812 GCCACTAAGGGTGAAGGAGAAGG + Intronic
965713176 3:171577334-171577356 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
965713195 3:171577398-171577420 GCCACTAAGGGTGAAAGAGAAGG - Intergenic
966066591 3:175828489-175828511 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
966085232 3:176062307-176062329 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
966103264 3:176302455-176302477 GCTGAAAAGTGTGAAGGAGATGG - Intergenic
966105273 3:176326269-176326291 GCTGCTAAGGGTGAAGGAGAAGG + Intergenic
966105290 3:176326333-176326355 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
966233026 3:177670457-177670479 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
966278982 3:178208141-178208163 GCCTCTAAGGGTGAAGGAGAAGG - Intergenic
966279014 3:178208261-178208283 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
966279046 3:178208374-178208396 GCCACTAAGGGTGAAGGGGAAGG - Intergenic
966279082 3:178208493-178208515 GCCTATAAGGGTGAAGGAGAAGG - Intergenic
966279113 3:178208611-178208633 GCTGCTATGGGTGAAGGAGAAGG - Intergenic
966924339 3:184634697-184634719 TCCACTCAAGGTGAAGGAGAGGG - Intronic
967212373 3:187180243-187180265 GCTGCTAATGGTGAAGGAGAAGG + Intronic
967232839 3:187356898-187356920 GCAGATAAAGGTGAAGGAGCTGG + Intergenic
967244374 3:187471027-187471049 GCCACTAAAAGTGAAGGAGAAGG + Intergenic
967496026 3:190145542-190145564 GCTGCTAAGAGTGAAGAAGAAGG - Intergenic
967561198 3:190921168-190921190 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
967624868 3:191671283-191671305 GCCACTAAGAGTGAAGGAGAAGG + Intergenic
967624887 3:191671347-191671369 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
967644035 3:191900125-191900147 GCTGCTAAGGGTGAAGGAGAAGG + Intergenic
967658329 3:192075880-192075902 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
967740277 3:192996615-192996637 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
969654345 4:8487680-8487702 ACCACTAAGCGTGAAGGAGAAGG + Intronic
969809908 4:9639827-9639849 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
970041903 4:11807303-11807325 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
970060304 4:12026026-12026048 GCAGCTAAGGATGAAGGATATGG - Intergenic
970087362 4:12364760-12364782 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
970256632 4:14175272-14175294 GCCTCTAAGGGTGAAGAAGAAGG + Intergenic
970332784 4:15002864-15002886 GCCGCCGAGGGGGACGGAGAAGG - Exonic
971123387 4:23726724-23726746 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
971123420 4:23726849-23726871 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
971180360 4:24324275-24324297 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
971199967 4:24502168-24502190 GCCATTAAGGGTGAAGGAGAAGG - Intergenic
974004233 4:56539823-56539845 GCTGGTAAGGCAGAAGGAGAGGG - Intronic
974428605 4:61769023-61769045 GCCGCTAAGGGTGAAGGAGAAGG + Intronic
975865320 4:78718702-78718724 GCCGCTAAGAATGAAGGAGAAGG + Intergenic
975934112 4:79558753-79558775 GCTGCTAAGGGTGAAGGAGAAGG + Intergenic
976696322 4:87922798-87922820 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
977010094 4:91624991-91625013 GCCGCTAAGGGTGAAAGAGAAGG - Intergenic
977010108 4:91625055-91625077 GCCGCTAAGAATGAAGGAGAAGG - Intergenic
977013158 4:91659484-91659506 GCTGCTAACAGTGAAGGAGAAGG + Intergenic
977013173 4:91659548-91659570 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
977041831 4:92026921-92026943 GCCGCTAAGGATGAAGGAGAAGG - Intergenic
977041848 4:92026985-92027007 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
977062802 4:92276628-92276650 GCCGCTAAGGGTGCAGGAGAAGG + Intergenic
977075400 4:92443635-92443657 GCCGCTAAGAGTGAAGGAGAAGG + Intronic
977198629 4:94089316-94089338 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
977217315 4:94297757-94297779 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
977217331 4:94297821-94297843 GCCGCTAAGCGTGAAGGAGAAGG + Intergenic
977217350 4:94297885-94297907 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
977922280 4:102658718-102658740 GCAGCTGAGGGTGCAAGAGATGG + Intronic
978001321 4:103558462-103558484 GTCACTAAGGGTGAAGGAGAAGG + Intergenic
978680609 4:111377120-111377142 GCCTCTAAGGGAAAAGTAGAAGG - Intergenic
979054812 4:115980306-115980328 GCGGCTCAGGGTGAAGGAGAAGG + Intergenic
979146414 4:117253061-117253083 GCTGCTAAGAGTGAAGGAGAAGG - Intergenic
979379683 4:119994730-119994752 GCCACTAAGAGTGAAGGAGAAGG - Intergenic
979850528 4:125566438-125566460 GCCGCCAAGAGTGAAGGAGAAGG + Intergenic
979895360 4:126149828-126149850 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
979895378 4:126149892-126149914 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
979915156 4:126422088-126422110 GGTGCTAAGTGTGATGGAGAGGG + Intergenic
980003552 4:127516180-127516202 GCTCCTAAGGGTGAAGGAGAAGG + Intergenic
980028561 4:127796796-127796818 GTTGCTAAGGGTTAAGGGGAAGG + Intronic
980112150 4:128645625-128645647 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
980284756 4:130768370-130768392 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
980388705 4:132119133-132119155 GCCGCTCAGGGTGAAGGAGAAGG - Intergenic
980527679 4:134013179-134013201 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
980575836 4:134682581-134682603 GTCACTAAGGGTGAAGGAGAAGG + Intergenic
980611963 4:135171983-135172005 GCAGCTAAGGGTGAAGGAGAAGG + Intergenic
980611980 4:135172047-135172069 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
980903706 4:138928781-138928803 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
981031694 4:140131813-140131835 GCTGTGAAGGGTGAAGGTGAAGG + Intronic
981040070 4:140214648-140214670 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
981524941 4:145699891-145699913 GCCGCTAAGGGTGAAGGAGAAGG - Intronic
981524959 4:145699955-145699977 GCCACCAAGGGTGAAGGAGAAGG - Intronic
981539484 4:145833568-145833590 GCCGCTAAGGGTGAAGGAGAAGG - Intronic
982084150 4:151817254-151817276 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
982180667 4:152746000-152746022 GCTGCTAAGGGTGAAGGAGAAGG + Intronic
982180685 4:152746064-152746086 GCCACTGAGGGTGAAGGAGAAGG + Intronic
982180702 4:152746128-152746150 GCCACTGAGGGTGAAGGAGAAGG + Intronic
982340477 4:154293076-154293098 GCAGCCAAGGGTGAAGGAAGAGG - Intronic
982414399 4:155113210-155113232 GTCGCTAAGAGTGAAGGAGAAGG + Intergenic
982497341 4:156108330-156108352 GCCGCTAAGAGTGAAGGAGAAGG + Intergenic
982535214 4:156601190-156601212 GCCGCTAAGGGTGAAAGAGAAGG - Intergenic
982535231 4:156601254-156601276 GCCGCTAAGGGTGAAAGAGAAGG - Intergenic
983023672 4:162710139-162710161 GCCGCTCAGGGTTAAGGAGAAGG - Intergenic
983055295 4:163094180-163094202 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
983055314 4:163094244-163094266 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
983360174 4:166717129-166717151 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
983414912 4:167440511-167440533 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
983447848 4:167877206-167877228 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
983452127 4:167923857-167923879 GCTGTTAAGGGTGAAGGAGAAGG - Intergenic
983707495 4:170678543-170678565 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
983913399 4:173265457-173265479 GCTGGTAAGGGTAAAGGATAAGG - Intronic
984099236 4:175466084-175466106 GCTGCTAAGGGTGAAGGAGAAGG + Intergenic
984393801 4:179169539-179169561 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
984700453 4:182815483-182815505 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
985390103 4:189484325-189484347 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
985435534 4:189926852-189926874 GCCATTAAGGGTGAAGGAGAAGG - Intergenic
985582072 5:703519-703541 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
985582135 5:703766-703788 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
985582154 5:703830-703852 GCCGCTAAGCGTGAAGGAGAAGG - Intergenic
986193327 5:5516531-5516553 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
986193344 5:5516595-5516617 GCCACTAAGCGTGAAGGAGAAGG - Intergenic
986288278 5:6377478-6377500 GCCAGTAAGGGGGATGGAGAGGG + Intronic
986388675 5:7264576-7264598 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
986555779 5:9008692-9008714 GCTGCTAAGGGTGAAGGAGGAGG + Intergenic
986555903 5:9009389-9009411 GCCACTAAGGATGAAGGAGAAGG + Intergenic
986555937 5:9009514-9009536 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
986905565 5:12490812-12490834 GCCGCTGAGGGTGAAGGAGAAGG - Intergenic
986905583 5:12490876-12490898 GCTGCTAAGGATGAAGGAGAAGG - Intergenic
986919804 5:12667318-12667340 GCCGCTAAGAGTGAAGGAGAAGG + Intergenic
987281824 5:16420933-16420955 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
987498338 5:18673572-18673594 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
987755575 5:22095611-22095633 GCCACTAAGGGTGAAGGAGAAGG - Intronic
990794866 5:59528452-59528474 GCTGCCAAGAGAGAAGGAGATGG + Intronic
992394436 5:76358249-76358271 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
992960617 5:81954186-81954208 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
993192484 5:84699359-84699381 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
993192502 5:84699423-84699445 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
993192519 5:84699487-84699509 GCCACTAAGGGTGAAAGAGAAGG - Intergenic
993400027 5:87438141-87438163 GGGGCTGAGGGTGAGGGAGAAGG - Intergenic
993836449 5:92824732-92824754 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
993836477 5:92824857-92824879 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
994060635 5:95472756-95472778 ACCACTGAGGGTGAAGGAGTGGG - Intronic
994294966 5:98080142-98080164 GCCGCTAAAGGTGAAGGAGAAGG - Intergenic
994532726 5:100988903-100988925 GCTGCTAACGGTGAAGGAGAAGG + Intergenic
994532742 5:100988967-100988989 GCCGCAAAGGGTGAAGGAGAAGG + Intergenic
994532806 5:100989214-100989236 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
994775495 5:104032662-104032684 GCCGCTAAAGGTGAAGGAGAAGG - Intergenic
994779246 5:104069397-104069419 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
994779262 5:104069461-104069483 GCCACTAACGGTGAAGGAGAAGG + Intergenic
995282493 5:110351937-110351959 GCCACTTAAGGTGAGGGAGATGG - Intronic
995899613 5:117051259-117051281 GCCACTAAGAGTGAAGGAGAAGG + Intergenic
996203480 5:120702391-120702413 GCCGCTAAGAGTGAAGGAGAAGG + Intergenic
996527849 5:124498003-124498025 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
996745739 5:126844679-126844701 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
997769884 5:136544382-136544404 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
997769903 5:136544446-136544468 GCTGCTAAGGGTGAAGGAGAAGG + Intergenic
997772883 5:136570227-136570249 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
998288871 5:140892904-140892926 GCTGGGAAGGGTGAAGGAAAAGG - Intronic
998988475 5:147788855-147788877 GCTGTTAAGGTTGAGGGAGAGGG + Intergenic
998996587 5:147873558-147873580 GCCGCTAAGGGTGAAGGAGAAGG + Intronic
999456097 5:151717515-151717537 GGGGCTAAGAGTGTAGGAGAGGG - Intergenic
999619067 5:153454401-153454423 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1000935868 5:167302693-167302715 GCCACTAAGGGTGAAGGAGAAGG + Intronic
1001331695 5:170766892-170766914 GCCACTAAGAGTGAAGGAGAAGG + Intronic
1001736843 5:174012025-174012047 GTTGCCAAGGGTTAAGGAGAGGG + Intergenic
1002611169 5:180419434-180419456 GCCGCTAAGGGCGAAGGAGAAGG + Intergenic
1003124943 6:3348679-3348701 GCCGCTAGGGGTGAAGTATCTGG - Intronic
1003430364 6:6032489-6032511 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
1003430382 6:6032553-6032575 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1003430401 6:6032617-6032639 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1004105996 6:12668135-12668157 ACTGCTAAGAGTGAAGGAGAAGG - Intergenic
1004106029 6:12668256-12668278 ACTGCTAAGAGTGAAGGAGAAGG - Intergenic
1004106061 6:12668377-12668399 GCTGCTAAGGGTGAAGAAGAAGG - Intergenic
1004283769 6:14301814-14301836 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1004508238 6:16263915-16263937 GCCGCTAAGTGTGAAGGAGAAGG + Intronic
1004575019 6:16886933-16886955 GCCGCTCAGGGTGAAGGAGAAGG - Intergenic
1004768808 6:18758913-18758935 GCCACTAAGAGTGAAGGAGAAGG + Intergenic
1005014879 6:21366247-21366269 GCCTCTAAGGGTGAAGGAGAAGG + Intergenic
1006147587 6:31968642-31968664 CCTGCTAAGGGGCAAGGAGAAGG + Intronic
1006582452 6:35084732-35084754 GCCCCTAAGAGGGAAGTAGAGGG - Intronic
1007799060 6:44376361-44376383 GCCTTTCTGGGTGAAGGAGAAGG + Exonic
1008476339 6:51939231-51939253 GCCACTAAGGGTGAAGGAGAAGG - Intronic
1008850400 6:56015453-56015475 GCCACTAGGGGTGAAGGAGAAGG + Intergenic
1008850432 6:56015572-56015594 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
1008850463 6:56015693-56015715 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
1008850495 6:56015812-56015834 GCTGCTAAGGGTGAAGGAGAAGG + Intergenic
1009343406 6:62586935-62586957 GCTGCTAAGGGTGAAGTAGAAGG - Intergenic
1009359176 6:62792575-62792597 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1010302891 6:74282280-74282302 GCAGCTGCGGGTGCAGGAGACGG + Intergenic
1010586915 6:77665306-77665328 GCCACTAAGGGTGAAAGATAAGG + Intergenic
1010586934 6:77665370-77665392 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1010586953 6:77665434-77665456 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1010625624 6:78133953-78133975 GCAGCTGAGGGAGAAGGAGGAGG - Intergenic
1010827118 6:80487127-80487149 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1010894810 6:81350159-81350181 GCCGCTAAGGGTGAAGGAGAGGG + Intergenic
1011368088 6:86602980-86603002 GCCACTAAGGGTGAAGTAGAAGG + Intergenic
1011771143 6:90674883-90674905 GTCACTAAGGGTGAAGGAGAAGG + Intergenic
1012014593 6:93834792-93834814 GCTGCTAGGAGTGAAGGAGAAGG + Intergenic
1012315596 6:97780506-97780528 GCCGCTAAGAGTGAAGGAGAAGG - Intergenic
1012689311 6:102293658-102293680 GACACTAAGGGTGAAGGAGAAGG - Intergenic
1012689330 6:102293722-102293744 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1012689347 6:102293786-102293808 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1013408109 6:109860591-109860613 GCCGCTAAGAGTGAAGGAGAAGG + Intergenic
1013843954 6:114427355-114427377 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1013891487 6:115032854-115032876 GCCACTAAGGGTGAAAGAGAAGG - Intergenic
1014360394 6:120467113-120467135 GCTGCTAAGGGTGAAGGAGAAGG + Intergenic
1014455079 6:121625155-121625177 GCCGCTAAGGGTGAAAGAGAAGG + Intergenic
1014455098 6:121625219-121625241 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
1014455114 6:121625283-121625305 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
1014555635 6:122840814-122840836 GCCGCTAAGAGTGAAGGAGAAGG - Intergenic
1014614880 6:123587040-123587062 GCTGCTCAGGGTGAAGGAAAAGG + Intronic
1014718401 6:124891397-124891419 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1014718420 6:124891461-124891483 GCCACTAAGTGTGAAGGAGAAGG - Intergenic
1014794207 6:125706620-125706642 GCCACTAAGAGTGAAGGAGAAGG + Intergenic
1014794222 6:125706684-125706706 GCCGCTAACAGTGAAGGAGAAGG + Intergenic
1014891346 6:126849771-126849793 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1015165001 6:130193265-130193287 GCTGCTAAGTGTGAAGGAGAAGG - Intronic
1015266538 6:131296475-131296497 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1015269437 6:131324305-131324327 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
1015271164 6:131339872-131339894 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
1015271183 6:131339936-131339958 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1015277968 6:131403915-131403937 GCCACTAGGGGTGAAGGAGAAGG - Intergenic
1015323617 6:131902613-131902635 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1016204332 6:141453781-141453803 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1016248617 6:142016665-142016687 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1016518600 6:144924165-144924187 GCCACTAAGGCTGAAGGAGAAGG - Intergenic
1016518633 6:144924290-144924312 GCCACTAACGGTGAAGGAGAAGG - Intergenic
1016535955 6:145107893-145107915 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
1016650496 6:146455149-146455171 GCTGCTAAGGGTGAAGGAGAAGG + Intergenic
1016650577 6:146455457-146455479 GTCGCTAAGGGTGAAGGAGAAGG + Intergenic
1016653496 6:146490273-146490295 GCTGCTCACTGTGAAGGAGAGGG + Intergenic
1017779533 6:157705389-157705411 GCTGCTAAGGGTGAAGGAGAAGG + Intronic
1017779563 6:157705510-157705532 GCCACTAAGAGTGAAGGAGAAGG + Intronic
1018084717 6:160291335-160291357 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1018495677 6:164343795-164343817 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1018521697 6:164656956-164656978 GCCACTAAGGATGAAGGAGAAGG + Intergenic
1018521730 6:164657077-164657099 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1019404671 7:877225-877247 GACGCAAAGGAAGAAGGAGAAGG - Intronic
1019405590 7:882337-882359 GCAGTTGAAGGTGAAGGAGAGGG + Intronic
1020315829 7:6904742-6904764 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1020532945 7:9358248-9358270 GCCGCTAAGAGTGAAGGAGAAGG + Intergenic
1021637106 7:22704277-22704299 GCCACTCAGGGTGAAGGAGAAGG - Intergenic
1021810452 7:24397255-24397277 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
1021978054 7:26028728-26028750 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1021978073 7:26028792-26028814 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1022372687 7:29785948-29785970 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
1022710217 7:32842459-32842481 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
1022854912 7:34304546-34304568 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
1022956579 7:35386637-35386659 GCCACTAACGGTGATGGAGGTGG - Intergenic
1023699099 7:42875340-42875362 GCCGCTAAGGCTGAAGGAGAAGG + Intergenic
1023699115 7:42875404-42875426 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1024520377 7:50300596-50300618 GCTGCTGGGGGTGAAGGAGCAGG - Intergenic
1024697369 7:51870828-51870850 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1024697388 7:51870892-51870914 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1024697407 7:51870956-51870978 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1024697425 7:51871020-51871042 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1027256631 7:76434926-76434948 GACACTAAGAGGGAAGGAGAAGG + Intronic
1027282265 7:76617392-76617414 GACACTAAGAGGGAAGGAGAAGG - Intronic
1028689978 7:93640898-93640920 GCTGCTAAGGGTGAAGGAGAAGG - Intronic
1030751674 7:113238134-113238156 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
1030751693 7:113238198-113238220 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1031004475 7:116456560-116456582 GCCGCTAAGGGTGAAGGAGAAGG - Intronic
1031355419 7:120781913-120781935 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1031364951 7:120890406-120890428 GCCACTAAGGGTGAAAGAGAAGG + Intergenic
1031399818 7:121316725-121316747 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
1031525341 7:122817727-122817749 GCCGCTAAGAGTGAAGGAGAAGG - Intronic
1031633649 7:124075197-124075219 GAAGCAAAGGGAGAAGGAGAAGG - Intergenic
1031728134 7:125263610-125263632 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1031776108 7:125910896-125910918 GCCACTAAGAGTGAAGGAGAAGG - Intergenic
1031777119 7:125918529-125918551 GCTGCTAAGGGTGAAGGGGCAGG - Intergenic
1032115659 7:129114772-129114794 GGGGATAAGGGTGGAGGAGAGGG + Intergenic
1033414041 7:141146813-141146835 GCGGCTTAGGGAGCAGGAGAAGG - Intronic
1033597305 7:142866919-142866941 GCTGGTCAGGGTGAAGGAGTGGG - Exonic
1033676165 7:143541938-143541960 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1033695668 7:143787501-143787523 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1033909696 7:146248246-146248268 GCCGCTCAGGGTGAAGGAGAAGG + Intronic
1034085006 7:148314631-148314653 GCCGCTGAGGGTGAAGGAGAAGG + Intronic
1034331844 7:150289494-150289516 GCTGCTAAGGGAGAGGGAGGTGG - Exonic
1034646504 7:152652437-152652459 GCCTCTATGGGAGCAGGAGAGGG - Intronic
1034666192 7:152820376-152820398 GCTGCTAAGGGAGAGGGAGGTGG + Exonic
1036071120 8:5441323-5441345 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1036192041 8:6679091-6679113 GCCGATAAGGTTCAAGGACAAGG + Intergenic
1036281253 8:7403287-7403309 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1036340213 8:7908285-7908307 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1036371926 8:8169573-8169595 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
1036472559 8:9064214-9064236 GCCGCTAAGGGTGAAGGAGAAGG + Intronic
1036609243 8:10335217-10335239 GGTGTTAAGGGTGAAGGAAAAGG - Intronic
1036878978 8:12496070-12496092 GCTGCTAAGGGTGAAGGAGAAGG + Intergenic
1037769143 8:21788931-21788953 GCCGCGAAGGGAGAAGGGGGCGG - Intronic
1042453310 8:68973977-68973999 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1043718122 8:83509955-83509977 GCTGCTAAGGGTGAAGGAGAAGG + Intergenic
1043837508 8:85063862-85063884 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
1044148696 8:88746843-88746865 GCTGTTAAGGGTGAAGGAGAAGG + Intergenic
1044416852 8:91948917-91948939 ACCGCTAAGGGTAAAGGAGAAGG - Intergenic
1044416888 8:91949042-91949064 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
1044921751 8:97176010-97176032 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1044921785 8:97176134-97176156 GCCACTAAAGGTGAAGGAGAAGG - Intergenic
1044924932 8:97201831-97201853 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1044924949 8:97201895-97201917 GCCACTAAGGGTGAAAGAGAAGG - Intergenic
1045197266 8:99944671-99944693 GCTGTTAAGGGTGAAGGAGAAGG - Intergenic
1045644586 8:104286960-104286982 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1046293916 8:112196835-112196857 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1046313758 8:112473761-112473783 GACTCCAAGGGTGAAGGAGCAGG - Intronic
1046386578 8:113514358-113514380 GCTGCTAAGGGTGAAGGAGAAGG + Intergenic
1046439849 8:114242602-114242624 GCTGCTAGGAGTGAAGGAGAAGG - Intergenic
1046442984 8:114282694-114282716 GCCGCTAAGGGTGAAGGCGAAGG - Intergenic
1046443001 8:114282758-114282780 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1046511884 8:115213250-115213272 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1046559072 8:115815612-115815634 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1047699137 8:127432682-127432704 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1047829732 8:128616598-128616620 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1048097393 8:131311119-131311141 GCCGCTAAGAGTGAAGGAGAAGG - Intergenic
1048168631 8:132084908-132084930 GCCGCTAAGGGTGAAGGAGAAGG + Intronic
1048168650 8:132084972-132084994 GCCGCTAAGGGTGAAGGAGAAGG + Intronic
1048585627 8:135771880-135771902 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1048764427 8:137829521-137829543 GCTGCTAAGGGTGAAGGAGAAGG + Intergenic
1049869028 8:144959012-144959034 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
1051052419 9:12949323-12949345 GCCTCTAAGGGTGAAGAAGAAGG - Intergenic
1051075382 9:13227433-13227455 GCAGCTCAGGTTGAAGCAGATGG + Intronic
1051849494 9:21490414-21490436 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1052191614 9:25669875-25669897 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1052653100 9:31327305-31327327 TGCTCTAAGGGTGAAGGAGAAGG - Intergenic
1053057762 9:35004255-35004277 GCAGCTAAGGGTGAAGGAGAAGG - Intergenic
1055232829 9:74086579-74086601 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1055232848 9:74086643-74086665 GCCGCTAAGGGTGAAAGAGAAGG - Intergenic
1055347919 9:75356481-75356503 GCCGCTAAGAGTGAAGGAGAAGG + Intergenic
1055626484 9:78181654-78181676 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1055881546 9:81009976-81009998 GCCGCTAAGGCTGAAGGAGAAGG - Intergenic
1056044913 9:82705265-82705287 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1056044935 9:82705329-82705351 CCCGCTAAGGGTGAAGGGGAAGG + Intergenic
1056060968 9:82884803-82884825 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
1056323622 9:85459393-85459415 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1056437433 9:86587980-86588002 GCCGCTGAGGGTGAAGGAGAAGG + Intergenic
1056437450 9:86588044-86588066 GCCGCTAAGGGTGAACGAGAAGG + Intergenic
1056437468 9:86588108-86588130 GCCGCTGAGGATGAAGGAGAAGG + Intergenic
1056437487 9:86588172-86588194 GCCGCTGAGGGTGAAGGAGAAGG + Intergenic
1056437506 9:86588236-86588258 GCCGCTGAGGGTGAAGGAGAAGG + Intergenic
1056437525 9:86588300-86588322 GCCACTGAGGGTGAAGGAGAAGG + Intergenic
1056437543 9:86588364-86588386 GCCGCTGAGGGTGAAGGAGAAGG + Intergenic
1056522231 9:87411888-87411910 GCTGCTAAGAGTGAAGGAGAAGG - Intergenic
1056597818 9:88022025-88022047 GCCGCTCATTGTGGAGGAGACGG - Intergenic
1056782969 9:89565036-89565058 TGCGCTCAGGGTGAGGGAGAGGG - Intergenic
1057234621 9:93348536-93348558 GCCGCTAAGAGTGAAGGAGAAGG - Intergenic
1057377777 9:94540804-94540826 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1057683710 9:97215443-97215465 GCCGCTGAGGGTGAAGGGGAAGG - Intergenic
1057683731 9:97215507-97215529 GCCGCTGAGGGTGAAGGGGAAGG - Intergenic
1057683752 9:97215569-97215591 GCCGCTGAGGGTGAAGGGGAAGG - Intergenic
1057683773 9:97215632-97215654 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
1057981778 9:99670718-99670740 GCCACTAAGCTTGAAGGAGAAGG - Intergenic
1057981794 9:99670782-99670804 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1057981812 9:99670845-99670867 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1058026444 9:100145541-100145563 GCCACTAAGGGTGAAGGAGAAGG + Intronic
1058612211 9:106789240-106789262 GCTGCTAAGGGTGATGGAGAAGG - Intergenic
1058795739 9:108496669-108496691 TCCGTTAGGGGTGAAGGAAAAGG - Intergenic
1059546360 9:115179349-115179371 GCCGCTAAGGGTGAAAGAGAAGG + Intronic
1059574388 9:115474252-115474274 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1059574406 9:115474316-115474338 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1059574423 9:115474380-115474402 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1059606910 9:115843909-115843931 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1059863691 9:118490378-118490400 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1185858795 X:3559149-3559171 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
1185960861 X:4545040-4545062 GCTGCTAAGGGTGAAGGAGAAGG + Intergenic
1185960878 X:4545104-4545126 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
1185960899 X:4545170-4545192 ACCGCTAAGGGTGAAGGAGAAGG + Intergenic
1185990859 X:4892608-4892630 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1186113097 X:6276952-6276974 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1186309623 X:8303271-8303293 GCCATTAAGGGTGAAAGTGAGGG - Intergenic
1186783866 X:12940835-12940857 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1187086739 X:16049449-16049471 GCCACTCAGGGTGAAGGAGAAGG + Intergenic
1187100077 X:16183333-16183355 GCCGCTAAGGGTAAAGGAGAAGG + Intergenic
1187100105 X:16183450-16183472 GCCGCTAAGAGTGAAGGAGAAGG + Intergenic
1188463589 X:30453833-30453855 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
1188540358 X:31242950-31242972 GCCTATGAGAGTGAAGGAGATGG - Intronic
1193885740 X:86982840-86982862 GCCACTAAGGGTGAAGGCAAAGG - Intergenic
1193941276 X:87682809-87682831 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
1194186439 X:90778010-90778032 GCTGCTAAGGGTGAAGGAGAAGG + Intergenic
1194293817 X:92104921-92104943 GCCACTAAGGGTGAAGGAGAAGG + Intronic
1194308747 X:92277785-92277807 GCCACTAACAGTGAAGGAGATGG + Intronic
1194351070 X:92825441-92825463 GCCGCTAAGGGTGAAGGAGAGGG - Intergenic
1194351090 X:92825505-92825527 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1194366898 X:93023924-93023946 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1194822969 X:98528989-98529011 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
1194822988 X:98529053-98529075 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1195553688 X:106197278-106197300 GCTGCTCAGGGAGAAGTAGAAGG - Intronic
1195841261 X:109179333-109179355 GCCCCTAAGGGTGAAGGAGAAGG - Intergenic
1195908877 X:109869906-109869928 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1196072853 X:111544806-111544828 GCTGCTCAGAGTGAAGGAGAAGG - Intergenic
1196165293 X:112531401-112531423 GCCGCTAAGAGTGAAGGAGAAGG - Intergenic
1196165323 X:112531526-112531548 GCTGCTAAGAGTGAAGGAGAAGG - Intergenic
1196299811 X:114040987-114041009 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1196330587 X:114467608-114467630 GCCGCTAAGAGTGAAGGAGAAGG - Intergenic
1196341954 X:114606162-114606184 GCCACTAAGGGTGAAGGAGAAGG + Intronic
1196341970 X:114606224-114606246 GCCGCTAAGGGTGAAGGAGAAGG + Intronic
1196525686 X:116725664-116725686 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
1196533739 X:116817192-116817214 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1196533758 X:116817256-116817278 GCCACTAAGGGTGAAGGAGAAGG + Intergenic
1196572319 X:117280258-117280280 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1196572336 X:117280322-117280344 GCTGCTAAGGGTGAAGGAGAGGG - Intergenic
1196774060 X:119322461-119322483 GCTGCTAAGGGTGAAGGAGAAGG + Intergenic
1197064702 X:122223014-122223036 GCCGCTAAGGGTGAAGGAGAAGG - Intergenic
1197352259 X:125393544-125393566 GCTGCTAAGGGTGAAGGAGAAGG + Intergenic
1197932867 X:131713002-131713024 GCTGCTAAGAGTGAAGGAGAAGG - Intergenic
1198149174 X:133891270-133891292 AGGGCTAGGGGTGAAGGAGATGG + Intronic
1198598219 X:138259618-138259640 ACCACTAAGGGTGAAGGAGAAGG - Intergenic
1198599605 X:138269055-138269077 GCTGCTAAGGGTGAAGGAGAAGG + Intergenic
1199576249 X:149316591-149316613 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
1199576282 X:149316716-149316738 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1200533038 Y:4360086-4360108 GCCGCTAAGGGTGAAGGAGAAGG + Intergenic
1200611334 Y:5329462-5329484 GCCACTAAGGGTGAAGGAGAAGG + Intronic
1200659399 Y:5942121-5942143 GCCGCTAAGGGTGAAGGAGAGGG - Intergenic
1200659418 Y:5942185-5942207 GCTGCTAAGGGTGAAGGAGAAGG - Intergenic
1200675120 Y:6140180-6140202 GCCACTAAGGGTGAAGGAGAAGG - Intergenic
1201581180 Y:15513274-15513296 GCCACTAAGGGTAAAGGAGAAGG - Intergenic
1201622974 Y:15980822-15980844 GCCTCTAAGTGTGAAGGTGCAGG - Intergenic
1201936866 Y:19419440-19419462 GCCGCTAAGGGTGAAGAAGAAGG - Intergenic
1202076756 Y:21044165-21044187 GCTGCTAAAGGTGAAAGAGAAGG + Intergenic