ID: 977217318

View in Genome Browser
Species Human (GRCh38)
Location 4:94297759-94297781
Sequence CGCTAAGGGTGAAGGAGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1002
Summary {0: 202, 1: 356, 2: 150, 3: 62, 4: 232}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977217310_977217318 -2 Left 977217310 4:94297738-94297760 CCCTAGAAAAGCAGGACTTGCCG 0: 13
1: 152
2: 413
3: 413
4: 271
Right 977217318 4:94297759-94297781 CGCTAAGGGTGAAGGAGAAGGGG 0: 202
1: 356
2: 150
3: 62
4: 232
977217309_977217318 -1 Left 977217309 4:94297737-94297759 CCCCTAGAAAAGCAGGACTTGCC 0: 31
1: 190
2: 354
3: 230
4: 230
Right 977217318 4:94297759-94297781 CGCTAAGGGTGAAGGAGAAGGGG 0: 202
1: 356
2: 150
3: 62
4: 232
977217308_977217318 0 Left 977217308 4:94297736-94297758 CCCCCTAGAAAAGCAGGACTTGC No data
Right 977217318 4:94297759-94297781 CGCTAAGGGTGAAGGAGAAGGGG 0: 202
1: 356
2: 150
3: 62
4: 232
977217311_977217318 -3 Left 977217311 4:94297739-94297761 CCTAGAAAAGCAGGACTTGCCGC 0: 68
1: 346
2: 425
3: 284
4: 202
Right 977217318 4:94297759-94297781 CGCTAAGGGTGAAGGAGAAGGGG 0: 202
1: 356
2: 150
3: 62
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977217318 Original CRISPR CGCTAAGGGTGAAGGAGAAG GGG Intergenic
900374338 1:2346721-2346743 CGAGATGGGGGAAGGAGAAGGGG - Intronic
900806545 1:4771428-4771450 CCCTGAGCGTGAAGGGGAAGGGG + Intronic
900840581 1:5045855-5045877 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
901300455 1:8196573-8196595 GGCTGAGGGAGAGGGAGAAGAGG - Intergenic
901945077 1:12695399-12695421 TGGTAAGGGTGAGGGGGAAGTGG - Intergenic
901957614 1:12797813-12797835 CCCTGAAGCTGAAGGAGAAGTGG - Intergenic
902226163 1:14997697-14997719 CCCTGAGGGTGGAGGAGCAGGGG + Intronic
902552497 1:17227649-17227671 AGCGAAGGGTGAAGGGGAATCGG - Intronic
903305062 1:22407605-22407627 GGCTGAGGGTGAAGGAGAAGAGG + Intergenic
903396172 1:23003406-23003428 GGCTAAGGGAGAAGGAGGAATGG + Intergenic
904500418 1:30909571-30909593 CGCTGGGGATGAAGGTGAAGGGG - Intergenic
904711433 1:32433302-32433324 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
904900349 1:33852154-33852176 CGATAGGGGTGAAGGAGAGTGGG - Intronic
904996609 1:34636376-34636398 GGCTAAGGGAGAAGGAGGAATGG + Intergenic
905470536 1:38188329-38188351 AGTTAAGGGAGAAGGACAAGGGG + Intergenic
905499570 1:38426076-38426098 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
906080706 1:43086470-43086492 CACTAAGGGTAAAGGAGAAGGGG - Intergenic
906416309 1:45623202-45623224 CGGCGAGGGTGAAGGAGATGGGG - Exonic
906744750 1:48213835-48213857 CTATAAGGGTGAAGGAGAAGGGG + Intergenic
907192839 1:52663135-52663157 AGCTAAGAGAGATGGAGAAGAGG - Intronic
907292427 1:53425312-53425334 TGCTAAGGATGAAGGAGAAGGGG - Intergenic
907390009 1:54151972-54151994 CCCTGAGGGTGAAGCAGAAGGGG + Intronic
907503783 1:54902623-54902645 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
908461909 1:64354686-64354708 CGCTAAGAGTGAAAGAGAAGGGG + Intergenic
908461925 1:64354750-64354772 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
908592188 1:65646711-65646733 CACTAAGAGTGAAGGAGAAGGGG + Intergenic
908592204 1:65646775-65646797 CGCTAAGGGTGAAAGAGAAGAGG + Intergenic
908592215 1:65646838-65646860 CGCTAAGAGTGAAGGAGAAAGGG + Intergenic
908592232 1:65646902-65646924 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
908852191 1:68387241-68387263 CGCTAAAGGTGAAGGAGAAGGGG - Intergenic
908852207 1:68387305-68387327 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
909035274 1:70589351-70589373 CACTAAGAGTGAAAGAGAAGGGG - Intergenic
909222853 1:72984524-72984546 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
909223851 1:72992507-72992529 TGCTAAGGGTGAAGGAGAAGGGG + Intergenic
909223870 1:72992571-72992593 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
909223889 1:72992635-72992657 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
909776839 1:79492998-79493020 GGCTAAGGGAGAAGGAGCAATGG + Intergenic
909788473 1:79643509-79643531 TGCTAAGGGTGAAGGAGAAGGGG + Intergenic
909793116 1:79700765-79700787 AGCTAAGGGAGAAGGAGGAATGG + Intergenic
909909730 1:81246285-81246307 CGCAAAGGGTGAAGGAGCAGGGG - Intergenic
909911664 1:81265903-81265925 ATCTAAGGCTGAAGGATAAGGGG + Intergenic
909978644 1:82072164-82072186 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
910049236 1:82956597-82956619 GGCTAAGGGAGAAGGAGGAATGG - Intergenic
911570170 1:99510504-99510526 CACGAAGGGTGAAGGAGAAGGGG - Intergenic
911570187 1:99510568-99510590 CACTAAGAGTGAAGGAGAAGGGG - Intergenic
911593204 1:99771311-99771333 AGCTAAGGGTGAGGACGAAGGGG - Intergenic
911759931 1:101602509-101602531 AGCTAAGGGAGAAGGAGAAATGG + Intergenic
911885897 1:103299258-103299280 AGGTAAGGATGAAGGAGCAGTGG - Intergenic
912296271 1:108473937-108473959 TGCTAAGAGTGAAGGAGAAGGGG - Intergenic
912764631 1:112396939-112396961 TACAAAGGGTGAAGGAGAGGAGG - Intronic
913213496 1:116600773-116600795 CGCTAAGGGACCAGGAAAAGTGG - Intronic
913291421 1:117275964-117275986 AGCTAAGGGAGAAGGCTAAGGGG - Intergenic
916015432 1:160745336-160745358 CCCTTAGGGGGATGGAGAAGGGG + Intronic
917974508 1:180230205-180230227 CGCGAAGGGTGGAGGGGGAGGGG + Intergenic
918210158 1:182343241-182343263 AGCCCAGGGTGAAGGAGAAAAGG - Intergenic
918346912 1:183614686-183614708 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
918567887 1:185953051-185953073 CACTAAGGGTGAAGGAGAAGGGG + Intronic
918567906 1:185953115-185953137 CACTAAGGGTGAAGGAGAAGGGG + Intronic
918714605 1:187770188-187770210 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
918714623 1:187770252-187770274 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
920829159 1:209449804-209449826 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
920829176 1:209449868-209449890 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
920829195 1:209449932-209449954 CGCTCAGGGTGAAGGAGAAGGGG - Intergenic
921161141 1:212472817-212472839 CAGTGAGGGTGATGGAGAAGTGG + Intergenic
921212213 1:212910508-212910530 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
921459999 1:215414722-215414744 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
921509059 1:216008973-216008995 TGCTAAGGGTGAAGGAGAAGAGG - Intronic
921519925 1:216146546-216146568 CGCTAAGGGTGAAGGAGAAGGGG - Intronic
921733181 1:218598501-218598523 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
921733198 1:218598565-218598587 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
921733217 1:218598629-218598651 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
922048204 1:221966911-221966933 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
922048221 1:221966975-221966997 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
922049756 1:221977877-221977899 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
922049773 1:221977941-221977963 CAGTAAGGGTGAAGGAGAATGGG + Intergenic
922154278 1:223029135-223029157 TGCTAAGGGTGAAGGAGAATGGG + Intergenic
922906178 1:229175324-229175346 TGCTAAGTGTGAAGGAGAAGGGG - Intergenic
922934604 1:229413354-229413376 CGCTAAGAGTGAAGCAGAAGGGG - Intergenic
922934633 1:229413479-229413501 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
923075000 1:230602200-230602222 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
923244536 1:232119110-232119132 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
923257490 1:232233982-232234004 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
923373903 1:233340614-233340636 TGCTAGGGGTGAAGGGGAACTGG + Intronic
923408822 1:233688187-233688209 TGCTAACGGTGAAGGAGAAAGGG + Intergenic
923408863 1:233688353-233688375 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
923408882 1:233688417-233688439 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
923408916 1:233688542-233688564 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
923770919 1:236936857-236936879 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
923962555 1:239102173-239102195 CGCTAAGAGTGAAGGAGAAGGGG - Intergenic
924180420 1:241434846-241434868 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
924640245 1:245826742-245826764 CGGCAAAGGTGAAGGCGAAGTGG + Intronic
1063362896 10:5471734-5471756 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1063509822 10:6634389-6634411 CACTAAGAGTGAAGGAGAAGGGG + Intergenic
1063509838 10:6634453-6634475 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1063527877 10:6801802-6801824 CACTAAGAGTGAAGGAGAAGGGG + Intergenic
1063740945 10:8818463-8818485 CTCTAAGGGTGAGGAGGAAGGGG + Intergenic
1064151054 10:12865368-12865390 CTCAAAGGGTCACGGAGAAGAGG + Intergenic
1064664007 10:17631477-17631499 CTCTAAGGGTGAAGGAGAAGGGG + Intergenic
1064887216 10:20123970-20123992 TGCTAAGGGTGAAGAAGAAGGGG + Intronic
1065443405 10:25773918-25773940 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1068058559 10:52038544-52038566 CGCTAAGAGTGAAGGAGAAGGGG + Intronic
1068179854 10:53503742-53503764 CGCTAAGCGTGAAGGAGAAGGGG + Intergenic
1068230746 10:54167668-54167690 TGCTAAGGGTGAAAGAGGAGGGG - Intronic
1068360635 10:55972454-55972476 GGCTAAGGGAGAAGGAGGAACGG - Intergenic
1068592548 10:58865733-58865755 CGCTAAGGGTGAAAGAGAAGGGG + Intergenic
1068592566 10:58865797-58865819 CACTAAGGATGAAGGAGAAGGGG + Intergenic
1070474615 10:76819203-76819225 CGCTGAGGGTGAAGGAGAAGGGG - Intergenic
1070474635 10:76819267-76819289 CGCTGAGGGTGAAGGAGAAGGGG - Intergenic
1070474654 10:76819331-76819353 CGCTGAGGGTGAAGGAGAAGGGG - Intergenic
1070474674 10:76819395-76819417 CGCTGAGGGTGAAGGAGAAGGGG - Intergenic
1070474693 10:76819459-76819481 CGCTGAGGGTGAAGGAGAAGGGG - Intergenic
1070474712 10:76819523-76819545 CGCTGAGGGTGAAGGAGAAGGGG - Intergenic
1070474731 10:76819587-76819609 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1070664984 10:78336503-78336525 CCCTAAGGCTGAAGGATCAGTGG + Intergenic
1071897936 10:90085777-90085799 CGCTAAGAGTGAAGGAGAAGGGG + Intergenic
1071916008 10:90296022-90296044 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1071960906 10:90808397-90808419 CGCTAAGGATGAAGGAGAAGGGG - Intronic
1072011526 10:91306410-91306432 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1074231878 10:111545657-111545679 CACTAAGGCTTAGGGAGAAGTGG + Intergenic
1074740564 10:116481636-116481658 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1075248503 10:120845890-120845912 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1076460358 10:130640036-130640058 GGCAGAGGGTGAAGGAGAAGAGG + Intergenic
1077611962 11:3648863-3648885 CGCTAAGGGTGAAGGAGAAGGGG - Intronic
1077851047 11:6074803-6074825 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
1078046348 11:7916961-7916983 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
1078392085 11:10944093-10944115 AGCTCAGGGAGTAGGAGAAGGGG - Intergenic
1079447266 11:20568808-20568830 CACTAAGGGTGAAGGAGAAAGGG - Intergenic
1079672756 11:23188590-23188612 TGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1079727297 11:23891951-23891973 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1080028127 11:27633851-27633873 CACTAAGAGTGAAGGAGAAGGGG + Intergenic
1080028145 11:27633915-27633937 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1080536349 11:33225502-33225524 AGCTAAGGTACAAGGAGAAGTGG + Intergenic
1081356612 11:42121592-42121614 TGCTGAGGTTGAAGGAGAAGGGG - Intergenic
1083145815 11:60757626-60757648 CTTTAAGGGTGGAGGAAAAGAGG - Intronic
1083534203 11:63453743-63453765 GGCTAAGGGAGAAGGAGGAATGG - Intergenic
1084046957 11:66574584-66574606 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1084232088 11:67760637-67760659 CACTAAGGGTGAAGGAAAAGGGG - Intergenic
1084355343 11:68634686-68634708 CACTCAGGGTGAAGGAGAAGGGG - Intergenic
1084393222 11:68892049-68892071 CGTGGAGGGTGGAGGAGAAGGGG + Intronic
1084393244 11:68892126-68892148 CGCGGAGGGTGGAGGAGAAGGGG + Intronic
1084393255 11:68892166-68892188 CGCGGAGGGTGGAGGAGAAGGGG + Intronic
1084393266 11:68892205-68892227 CGCGGAGGGTGGAGGAGAAGGGG + Intronic
1084393278 11:68892245-68892267 CGCGGAGGGTGGAGGAGAAGGGG + Intronic
1084393290 11:68892285-68892307 CGCGGAGGGTGGAGGAGAAGGGG + Intronic
1084393302 11:68892325-68892347 CGCGGAGGGTGGAGGAGAAGGGG + Intronic
1084393314 11:68892365-68892387 CGCGGAGGGTGGAGGAGAAGGGG + Intronic
1084393326 11:68892405-68892427 CGCGGAGGGTGGAGGAGAAGGGG + Intronic
1084393338 11:68892445-68892467 CGCGGAGGGTGGAGGAGAAGGGG + Intronic
1084393350 11:68892485-68892507 CGCGGAGGGTGGAGGAGAAGGGG + Intronic
1084393362 11:68892525-68892547 CGCGGAGGGTGGAGGAGAAGGGG + Intronic
1084393374 11:68892565-68892587 CGCGGAGGGTGGAGGAGAAGGGG + Intronic
1084393386 11:68892605-68892627 CGCGGAGGGTGGAGGAGAAGGGG + Intronic
1084613483 11:70219060-70219082 TGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1084613510 11:70219181-70219203 TGCTAAGAGTGAAGAAGAAGGGG + Intergenic
1084826884 11:71738421-71738443 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1085040971 11:73326108-73326130 GCCGCAGGGTGAAGGAGAAGGGG + Intronic
1085297634 11:75439901-75439923 CGATGAGGGTGAAGGAGACCAGG + Exonic
1085549026 11:77349707-77349729 TGCCAAGGGTGATGGAGGAGAGG - Intronic
1085987798 11:81807118-81807140 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1086550058 11:88044424-88044446 GGCTAAGGGAGAAGGAGGAATGG - Intergenic
1087098895 11:94346682-94346704 CACTTAGGGTGAAGGAGAAGGGG - Intergenic
1087127597 11:94642547-94642569 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1087196696 11:95310506-95310528 CACTGAGGGTGAAGGAGAAGGGG - Intergenic
1087196715 11:95310570-95310592 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1087314409 11:96588631-96588653 CGCTAAGGGTGAAGGAGAAAGGG - Intergenic
1087314425 11:96588695-96588717 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1087314442 11:96588759-96588781 CACTAAGAGTGAAGGAGAAGGGG - Intergenic
1088819510 11:113445575-113445597 ATCCAAGGGTGAAGGAGAAGAGG - Intronic
1089348899 11:117810300-117810322 CACTAAGGGTGAAGGAGAAGGGG - Intronic
1089472290 11:118730876-118730898 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1089672974 11:120069264-120069286 TGGGAAGGGTGAAGGGGAAGAGG - Intergenic
1089867201 11:121642389-121642411 GGCTAAGGGAGAAGGAGGAATGG + Intergenic
1089987179 11:122825384-122825406 CACTAAGAGTGAAGGAGAAGGGG - Intergenic
1090527003 11:127547489-127547511 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
1090546711 11:127773921-127773943 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1090850794 11:130569014-130569036 CGCTGAGGGTGAAGGAGAAGGGG + Intergenic
1090872149 11:130758158-130758180 CGCTGAGGGTGAAGGAGAAGGGG + Intergenic
1090927178 11:131259294-131259316 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1091581364 12:1792432-1792454 GGCTGAGGGTGATGGAGGAGCGG + Exonic
1091675192 12:2484243-2484265 GGCTGAGAGTGAAGGATAAGTGG + Intronic
1091886309 12:4019537-4019559 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1092474256 12:8805823-8805845 CACTAAGAGTGAAGGAGAAGGGG - Intergenic
1092592921 12:9967651-9967673 CGCTAAGGGTGAAGGAGAAGGGG + Intronic
1092626948 12:10337625-10337647 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1092723936 12:11466992-11467014 CGCTAAGGGTGAAGGAGAAGGGG + Intronic
1092789502 12:12059330-12059352 CGCTAAGGGTGAAGGATAAGGGG - Intronic
1093268205 12:17026356-17026378 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
1093578525 12:20763915-20763937 CACTAAGAGTGAAGGAGAACGGG - Intergenic
1093578537 12:20763979-20764001 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1093584697 12:20821608-20821630 CACTAAGGGTGAAGGAGAAGGGG + Intronic
1093812991 12:23510480-23510502 GGCTAAGGGAGAAGGAGGAATGG + Intergenic
1093950887 12:25164228-25164250 TGCTAAGGGTGAAGGAGAAGGGG - Intronic
1094316264 12:29139726-29139748 TGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1094400462 12:30056982-30057004 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1094400478 12:30057042-30057064 TGCTAAGGGTGAGGGAGAAGGGG - Intergenic
1094400495 12:30057102-30057124 CTCCAAGGTTGAAGGAGAATGGG - Intergenic
1094825553 12:34266599-34266621 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1094825622 12:34266917-34266939 GGCTAAGGGAGAAGGAGGAATGG - Intergenic
1096491213 12:52014169-52014191 CCCTAATGGTGCAGGAGCAGCGG + Exonic
1096553901 12:52391481-52391503 AGCTAAGAATGAAGCAGAAGAGG - Intergenic
1097398378 12:59102815-59102837 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1097417251 12:59327923-59327945 CGCCAAGGGTGAAGGAGAAGGGG + Intergenic
1097417269 12:59327987-59328009 CGCTAAGAGTGAAGGGGAAGTGG + Intergenic
1098173831 12:67771327-67771349 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1098401989 12:70086223-70086245 CGCTGAGGGTGAAGGAGAAGGGG - Intergenic
1098402008 12:70086287-70086309 CGCTGAGGGTGAAGGAGAAGGGG - Intergenic
1098402027 12:70086351-70086373 CGCTGAGGGTGAAGGAGAAAGGG - Intergenic
1098402045 12:70086415-70086437 CGCTGAGGGTGAAGGAGAAGGGG - Intergenic
1098628852 12:72704279-72704301 TGCTAAGAGTGAAGGAGAAGGGG - Intergenic
1098654014 12:73006628-73006650 TGCTAAGGTTGAAGGAGAAGGGG + Intergenic
1099188502 12:79540844-79540866 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1099292316 12:80787923-80787945 CACTAAGAGTGAAGGAGAAGGGG + Intergenic
1099304537 12:80937530-80937552 CGCTCAGGCAGGAGGAGAAGGGG - Intronic
1099938895 12:89161336-89161358 CACTGTGGGTGATGGAGAAGAGG + Intergenic
1100169944 12:91963071-91963093 AGCTAAGGAAGAAGAAGAAGAGG - Intergenic
1100561089 12:95749892-95749914 CACTAAGGGTGAAGGAGAAGGGG - Intronic
1100561108 12:95749956-95749978 CACTAAGGGTGAAGGAGAAGGGG - Intronic
1100561127 12:95750020-95750042 CGCTAAGAGTGAAGGAGAAGGGG - Intronic
1101278631 12:103227538-103227560 CGCTAAGGGTGAAGGAGAAGCGG + Intergenic
1101464101 12:104929933-104929955 GGCAAAGGGAGAAAGAGAAGGGG + Intronic
1106449514 13:29867364-29867386 CTCTAAGGATTAAAGAGAAGGGG + Intergenic
1106943208 13:34799556-34799578 CGCTGAGGGTGAAGGAGAAGGGG - Intergenic
1106943226 13:34799620-34799642 CGCTGAGGGTGAAGGAGAAGGGG - Intergenic
1106943244 13:34799684-34799706 TGCTGAGGGTGAAGGAGAAGGGG - Intergenic
1107075353 13:36317324-36317346 TGCTAAGAGTGAAGGAGAAGGGG - Intronic
1107220506 13:37973916-37973938 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
1107220523 13:37973980-37974002 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1107420951 13:40245932-40245954 GGCTGAGGGTGAAGAAGCAGTGG + Intergenic
1107683344 13:42872124-42872146 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1107683362 13:42872188-42872210 TGCTAAGGGTGAAGGGGAAGGGG + Intergenic
1108474914 13:50805690-50805712 CGATAAAGCTGAATGAGAAGTGG - Intronic
1108512770 13:51170811-51170833 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1108870733 13:54982046-54982068 TTCTAAGTGTGAAAGAGAAGAGG - Intergenic
1108913626 13:55583006-55583028 CACTAAGAGTGAAGGAGAAGGGG + Intergenic
1108913644 13:55583070-55583092 CACTAAGGTTGAAGGAGAAGGGG + Intergenic
1108919768 13:55659776-55659798 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
1108947238 13:56041309-56041331 AGCTAAGAGTGAAGGAGAAGGGG - Intergenic
1108953169 13:56117241-56117263 CGCTAAGGGTGAAGGAGAAAGGG + Intergenic
1109499076 13:63214070-63214092 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1109709859 13:66146025-66146047 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1109716972 13:66231194-66231216 CACTAAGGGTGAATTAGAAGGGG + Intergenic
1109716990 13:66231258-66231280 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1109717007 13:66231322-66231344 TGATAAGGGTGAAGGAGAAGGGG + Intergenic
1110080521 13:71304228-71304250 TGTTAAGTGTGAAGAAGAAGTGG + Intergenic
1110159963 13:72363943-72363965 GGCTATGGGTAAGGGAGAAGAGG + Intergenic
1110650735 13:77938465-77938487 TGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1110765247 13:79275040-79275062 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1110785950 13:79526176-79526198 GGATAAGGATGAGGGAGAAGGGG + Intronic
1110978253 13:81867058-81867080 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1111301794 13:86359173-86359195 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1111362319 13:87191123-87191145 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1111459061 13:88517586-88517608 CACTAAGGGTGAAAGAGAGGGGG + Intergenic
1111459076 13:88517650-88517672 CGCTAAGGGTGAAGGAGAAGAGG + Intergenic
1111459094 13:88517714-88517736 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1111601324 13:90479158-90479180 AGCTAAGGGAGAAGGAGTTGTGG - Intergenic
1111630267 13:90840548-90840570 CGCTAACGGTGAAGGAGAAGGGG - Intergenic
1111631911 13:90853324-90853346 CGCTAAGGGTGAAAGAGAAGGGG + Intergenic
1112236623 13:97643270-97643292 CACTAACGGTGAAGGAGAAGGGG - Intergenic
1112584502 13:100706254-100706276 CGCTCCGGATGTAGGAGAAGTGG - Intergenic
1112889462 13:104212502-104212524 GGCTAAGGGAGAAGGAGGAATGG + Intergenic
1113324088 13:109266198-109266220 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1113324107 13:109266262-109266284 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1113613302 13:111663349-111663371 AGCAAAGGAAGAAGGAGAAGAGG - Intronic
1114745830 14:25145921-25145943 CCCTCAGGGTGGAGGAAAAGGGG + Intergenic
1115240791 14:31249976-31249998 TGCTAAGGATGAAGGAGAAGGGG + Intergenic
1115240811 14:31250040-31250062 CGCTGAGGGTGAAGGGGAAGGGG + Intergenic
1115240828 14:31250096-31250118 CGCTGAGGGTGAAGGGGAAGGGG + Intergenic
1115240848 14:31250160-31250182 CGCTGAGGGTGAAGGGGAAGGGG + Intergenic
1115460595 14:33655909-33655931 TGCTCAGAGTGAAGGAAAAGAGG - Intronic
1115904574 14:38191640-38191662 CACTCAGGGTGAAAGAGAAGGGG - Intergenic
1116179454 14:41516868-41516890 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1116534987 14:46017125-46017147 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1116573273 14:46545030-46545052 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1116613311 14:47105176-47105198 CACTAAGGGTGAAGGAGAAGGGG - Intronic
1116703531 14:48267299-48267321 CGCTCAGGGTGAAGGAGAAGGGG + Intergenic
1116952705 14:50894167-50894189 CACTAAGGATGAAGGAGAAGGGG - Intronic
1116952723 14:50894231-50894253 CGCTAAGGGTGAAGGAGAAGGGG - Intronic
1117434371 14:55702088-55702110 GGGTAAGAGTGAAAGAGAAGAGG + Intergenic
1117958125 14:61138177-61138199 CGCTAAGGGTGAAGGAAAAGGGG + Intergenic
1118925651 14:70188339-70188361 CGCTAAGGGGGAAGGGCAGGAGG + Intronic
1118937524 14:70300967-70300989 TGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1118971816 14:70643258-70643280 TGCTAGGGGTGAAGGAAAAGGGG + Intronic
1119022186 14:71125168-71125190 CACTAAGAGTGAAGGAGAAGGGG - Intergenic
1119022217 14:71125286-71125308 TGCTAAGGGGGAAGGAGAAGGGG - Intergenic
1120438277 14:84505004-84505026 CGCTAAAGGTGAAGGAGAAGGGG + Intergenic
1120660182 14:87239812-87239834 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
1121087115 14:91155068-91155090 GACTCAGGGTGGAGGAGAAGGGG - Intronic
1121703417 14:95973838-95973860 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1122040785 14:98986180-98986202 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1123762121 15:23441239-23441261 GGCTACGGGAGAAGGAGGAGAGG - Exonic
1123882629 15:24689984-24690006 GGCTAAGGGAGAAGGAGGAATGG + Intergenic
1125045527 15:35239618-35239640 CGCTAAGGTTGAAGGAGAAGGGG - Intronic
1125045545 15:35239682-35239704 CACTAAGGGTGAAGGAGAAGGGG - Intronic
1125045563 15:35239746-35239768 TGCTAAGGGTGAAGGAGAAGGGG - Intronic
1125131755 15:36290549-36290571 TGCTAAGGGTGAAGTAGAAGGGG + Intergenic
1125716418 15:41822283-41822305 AGCTGAGGGTGATGAAGAAGAGG + Exonic
1126530346 15:49703776-49703798 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
1126843535 15:52739539-52739561 CGCTAAAGGTGAAGGAGAAGGGG - Intergenic
1126912587 15:53431485-53431507 CACTAAGGGTGAAGGAGAGGGGG + Intergenic
1128380083 15:67105993-67106015 TGGTGAGGGAGAAGGAGAAGAGG - Intronic
1130142245 15:81237229-81237251 AACTAAGGGTGCAGGATAAGAGG - Intronic
1130854880 15:87832162-87832184 CGCTAAGAGTGAGGGAGAAGGGG - Intergenic
1130947691 15:88561233-88561255 CGCTAGGGGTGAAGGAGAAGGGG + Intergenic
1131186186 15:90276108-90276130 TGTTAAGGGCTAAGGAGAAGAGG + Exonic
1131447485 15:92512320-92512342 CGCTAAGGGTGAAGGAGAAAGGG - Intergenic
1131882735 15:96876646-96876668 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1131882754 15:96876710-96876732 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1132340204 15:101073491-101073513 CGCTCAGGGTGAAGGAGAAGGGG - Intronic
1133766912 16:8844458-8844480 CGCTAAGGGTGAAGGAGAAGGGG + Intronic
1133869748 16:9675927-9675949 GGCTAAAGGAGAAGGAGAAATGG + Intronic
1133869826 16:9676243-9676265 TGCTAAGGGTGAAGGAGAAGGGG + Intronic
1133938027 16:10284404-10284426 GGCTAAGGGAGAAGGAGGAATGG - Intergenic
1137293161 16:47065966-47065988 CGCAAAGGCTGGAGGAGGAGAGG + Intergenic
1138804720 16:60079725-60079747 TGCTAAGAGTGAAGGAGAAGGGG - Intergenic
1139039421 16:62983783-62983805 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1139039458 16:62983906-62983928 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1139039495 16:62984031-62984053 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1139039531 16:62984156-62984178 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1139039631 16:62984525-62984547 CACTAAGGGTGAAGGAAAAGGGG + Intergenic
1139226114 16:65234527-65234549 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
1139359872 16:66390882-66390904 AGCTGAGGGTGAAGGAGCTGGGG + Intronic
1139943231 16:70621108-70621130 CGCTAAGGGTGAAGGAGAAGGGG + Intronic
1139943854 16:70625204-70625226 GGCTAAGGGAGAAGGAGGAATGG + Intronic
1139943916 16:70625438-70625460 CGCTAAGGGCGAAGGAGAAGGGG + Intronic
1140040783 16:71406240-71406262 CCCTAAGTGGGAAGAAGAAGAGG - Intergenic
1141796497 16:86278777-86278799 CGCTGAGGGTGAAGGAGAAGGGG - Intergenic
1141796517 16:86278841-86278863 CGCTGAGGGTGAAGGAGAAGGGG - Intergenic
1141796537 16:86278905-86278927 CGCTGAGGGTGAAGGAGAAGGGG - Intergenic
1141796557 16:86278969-86278991 CGCTGAGGGTGAAGGAGAAGGGG - Intergenic
1141796577 16:86279033-86279055 CGCTGAGGGTGAAGGAGAAAGGG - Intergenic
1141865411 16:86746688-86746710 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1143523946 17:7461978-7462000 CCCTAAGGGAGAAGGGGAAAGGG - Exonic
1144104418 17:11972741-11972763 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1146461971 17:33053440-33053462 GGCTAAGGGAGAAGGAAAAGGGG - Intronic
1146597663 17:34184167-34184189 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1146597682 17:34184231-34184253 CACTAAGGGTGAAAGAGAAGGGG - Intergenic
1147542778 17:41374824-41374846 CGGTAAGGGAGAAGCAGGAGAGG + Intronic
1149413962 17:56438901-56438923 ATCAAAGGGAGAAGGAGAAGGGG + Intronic
1151319861 17:73346545-73346567 GGCCCAGGGTGCAGGAGAAGGGG - Intronic
1151622283 17:75253597-75253619 CGCTAAGGGTGAAGGAGAAGGGG - Intronic
1151622339 17:75253830-75253852 GGCTAAGGGAGAAGGAGGAATGG - Intronic
1151707339 17:75776518-75776540 CGGTAAGGGTAAAGGAGCAGAGG - Exonic
1151839946 17:76610567-76610589 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1152242878 17:79169392-79169414 CGCAGTGGGTGAAGGAGCAGGGG - Intronic
1155375675 18:25154459-25154481 AGGTAGGGGTGAAGGAAAAGAGG + Intronic
1155697155 18:28697519-28697541 GGCTAAGGGAGAAGGAGGAATGG + Intergenic
1155697251 18:28697933-28697955 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1155941332 18:31804724-31804746 CACTAAGAGTGATGGAGAAGGGG - Intergenic
1156302107 18:35845137-35845159 GGCTAAGGGAGAAGGAGGAATGG - Intergenic
1156501143 18:37559193-37559215 GGAGAAGGGTGAAGGAGAAAAGG - Intronic
1156512816 18:37655370-37655392 AGCTCTGGGGGAAGGAGAAGAGG + Intergenic
1157167670 18:45373222-45373244 TACTAAGAGAGAAGGAGAAGGGG - Intronic
1157894696 18:51454533-51454555 CGCTAAGGAGGAAGAAGGAGGGG + Intergenic
1158336156 18:56416502-56416524 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1158336173 18:56416566-56416588 CGCTAAGGGTGAAGGAGAAAGGG - Intergenic
1158394873 18:57071474-57071496 CACTAAGAGTGAAGGAGAAGGGG + Intergenic
1159834826 18:73325589-73325611 GGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1159834844 18:73325653-73325675 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1160523997 18:79524836-79524858 CGCTGAGGGTGAAAGGGAAGCGG - Intronic
1161196030 19:2987247-2987269 CCCTGAGGGTGAGGGGGAAGGGG + Intronic
1161661517 19:5549510-5549532 CACTGAGGGTGAAGGAGAAGGGG - Intergenic
1162120876 19:8467083-8467105 AGCCTAGGGTCAAGGAGAAGTGG - Intronic
1162185742 19:8903555-8903577 GGGTAAGGGTTAAGGAGATGTGG + Intronic
1162186118 19:8906367-8906389 GGGTAAGGGTTAAGGAGATGTGG + Intronic
1163487138 19:17594671-17594693 GGCTAAGGGAGATGGAGGAGTGG - Intergenic
1163900500 19:20095756-20095778 CGCTAAGGGTGAAGGAGAAGGGG + Intronic
1163906822 19:20155520-20155542 CGCTAAGGGTGAAGGAGAAAGGG - Intergenic
1163906840 19:20155584-20155606 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1164152768 19:22569247-22569269 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1164152830 19:22569516-22569538 GGCTAAGGGAGAAGGAGGAATGG - Intergenic
1164459430 19:28434582-28434604 CTCTAAGGGTGAAGGAGAAGGGG + Intergenic
1164459472 19:28434774-28434796 CATTAAGGGTGAAGGAGAAGGGG + Intergenic
1164753297 19:30671534-30671556 AACTGAGGGAGAAGGAGAAGGGG + Intronic
1164873925 19:31669884-31669906 CCCTTAGGGTGAGGGAGAAAAGG - Intergenic
1165408099 19:35642824-35642846 CCCTGAGGGTGAAGGAAAAGGGG + Intronic
1165510496 19:36264097-36264119 TGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1165510528 19:36264218-36264240 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
1165835126 19:38750486-38750508 CACTAACGGTGAAGGAGAAGGGG - Intronic
1165835155 19:38750607-38750629 TACTAAGGGTGAAGGAGAAGGGG - Intronic
1165835217 19:38750880-38750902 GGCTAAGGGAGAAGGAGGAATGG - Intronic
1166499153 19:43328264-43328286 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1166936045 19:46333578-46333600 GGCGAAGGAAGAAGGAGAAGGGG + Intronic
1167046738 19:47054169-47054191 GGCTAAGGGAGAAGGAGGAATGG + Intergenic
1167046794 19:47054402-47054424 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
1167901941 19:52628744-52628766 TGCTAAGGGTGAAGGAGAAGGGG - Intronic
1168051445 19:53832555-53832577 GGCTAAGGGAGAAGGAGGAATGG - Intergenic
1168212324 19:54899626-54899648 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
1168228180 19:55011454-55011476 CGCTAAGAGTGAAGGAGAAGGGG + Intergenic
1168501028 19:56893443-56893465 GGCTATGGGTAAAGGAGAATGGG + Intergenic
925544298 2:5001762-5001784 TGTTAAGAGTGAAGGAGAAGGGG - Intergenic
925829036 2:7877417-7877439 TACTAAGGGTGAAGGAGAAGGGG + Intergenic
925829053 2:7877481-7877503 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
925829070 2:7877545-7877567 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
925829088 2:7877609-7877631 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
925829105 2:7877673-7877695 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
925829123 2:7877737-7877759 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
925829139 2:7877801-7877823 CACTAAGGGTGAAGGAGAAGCGG + Intergenic
925829156 2:7877865-7877887 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
925837767 2:7962647-7962669 AGCCAAGGTTCAAGGAGAAGAGG - Intergenic
926407536 2:12570664-12570686 CACTAAGGGTGAAGGAGAAGCGG - Intergenic
926407553 2:12570728-12570750 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
926413371 2:12627387-12627409 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
926413389 2:12627452-12627474 CACTAAGAGTGAAGGAGAAGGGG - Intergenic
926464288 2:13168685-13168707 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
926815753 2:16796646-16796668 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
928424716 2:31168523-31168545 TACTAAGGGTGAAGGAGTGGAGG + Intergenic
928778109 2:34790778-34790800 TGCTAAGGGTGAAGGAGAAGAGG - Intergenic
928779908 2:34805742-34805764 CGCTAAGGATGAAGGAGAAGGGG + Intergenic
928857024 2:35814344-35814366 GGCTAAGGGAGAAGGAGGAATGG - Intergenic
928928358 2:36600082-36600104 CGCTAAGGGTGAAGGAGAAGGGG - Intronic
929076901 2:38085553-38085575 CGCTCAGGGTGAAGGAGAAGGGG + Intronic
929451664 2:42042206-42042228 GGCTAAGGTTGATGGAGCAGAGG - Intergenic
929787932 2:45005372-45005394 CGCCAAGAGAGAAGGAGGAGGGG + Exonic
929793289 2:45039184-45039206 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
930059036 2:47273240-47273262 CTCTAAGGGAAAAGGAGAAGGGG + Intergenic
930895263 2:56439120-56439142 GGCTGAAGGTGAAGGAGAATTGG + Intergenic
930954891 2:57193990-57194012 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
930954910 2:57194054-57194076 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
930954959 2:57194260-57194282 GGCTAAGGGAGAAGGAGGAATGG - Intergenic
930958208 2:57230011-57230033 CACTAAGGATGAAGGAGAAGGGG - Intergenic
931026583 2:58118057-58118079 TGCTAAGGGTGAAGGAGAAGGGG + Intronic
931026602 2:58118121-58118143 CACTAAGGGTGAAGGAGAAGGGG + Intronic
931042485 2:58315110-58315132 CACTCAGGGTGAAGGAGAAGGGG - Intergenic
931236655 2:60418327-60418349 TGCTGAGGTTGAAGGAGAAGGGG - Intergenic
931236672 2:60418391-60418413 TGCTGAGGGTGAAGGAGAAGGGG - Intergenic
931236690 2:60418455-60418477 CACTGAGCGTGAAGGAGAAGGGG - Intergenic
931236705 2:60418519-60418541 CGCTGAGGGTGAAGGAGAAGGGG - Intergenic
931236724 2:60418583-60418605 CGCTGAGGGTGAAGGAGAAGGGG - Intergenic
931236740 2:60418647-60418669 CGCTGAGGGTGAAGGAGAAGGGG - Intergenic
931322159 2:61181803-61181825 CGGCAAAGGTGCAGGAGAAGAGG - Intronic
931625549 2:64253446-64253468 CGCTGAGGGTGAAGGAGAAGGGG - Intergenic
931625567 2:64253510-64253532 CACTGAGCGTGAAGGAGAAGGGG - Intergenic
931681044 2:64750448-64750470 CGAAAAGGGAGAAGGAGAAACGG + Intronic
931850205 2:66244891-66244913 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
931850223 2:66244955-66244977 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
931948031 2:67332472-67332494 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
932295612 2:70621450-70621472 CACTAAGAGTGAAGGAGAAGGGG - Intronic
932295644 2:70621572-70621594 TGCTAAGAGTGAAGGAGAAGGGG - Intronic
932359026 2:71089789-71089811 CGCTAAGGGCGAAGGAGAAGAGG + Intergenic
932359045 2:71089853-71089875 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
932359062 2:71089917-71089939 CGCTAAGGGCGAAGGAGAAGAGG + Intergenic
932367876 2:71164519-71164541 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
932541872 2:72663936-72663958 GCCTCAGGGTGAAGGTGAAGGGG + Intronic
932741305 2:74293055-74293077 AGCTGAGGGTGAAGCAGAGGGGG + Intronic
932854408 2:75218491-75218513 CGCAAAGGGTGAAGGAGAAGGGG + Intergenic
932974175 2:76578665-76578687 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
933012872 2:77089291-77089313 TGGTAAGAGTGAAGGAGAAGGGG - Intronic
933079052 2:77966064-77966086 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
933079071 2:77966128-77966150 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
933163532 2:79052340-79052362 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
933180000 2:79216679-79216701 GGCTAAGGGTGAAGGAGAAGGGG + Intronic
933329717 2:80879155-80879177 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
933552538 2:83793346-83793368 GGCTAAGGGAGAAGGAGGAATGG + Intergenic
933775993 2:85771592-85771614 TGCTAAGGGTGCAGGACCAGGGG - Intronic
936175767 2:110218888-110218910 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
936175780 2:110218952-110218974 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
936311771 2:111392123-111392145 TGCCAGGGGTTAAGGAGAAGAGG + Intergenic
936883141 2:117279762-117279784 CGCTAAGGGTGAAGGAGAGGGGG - Intergenic
937851183 2:126637904-126637926 CGCTAACGGGCAAGGAGGAGCGG + Intergenic
939083350 2:137687679-137687701 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
940529980 2:154868278-154868300 CACTCAGGGTGAAGGAGAAGGGG - Intergenic
940676025 2:156724866-156724888 CACTCAGGGTGAAGGAGAAGGGG + Intergenic
941340207 2:164296873-164296895 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
941353188 2:164460137-164460159 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
941456397 2:165715200-165715222 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
941936108 2:170982408-170982430 TGCTAAGGGTGAGGGAGAAGGGG + Intergenic
942096885 2:172542752-172542774 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
942096899 2:172542812-172542834 CACTAAGAGTGAAGGAGAAGGGG - Intergenic
943421798 2:187675245-187675267 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
943806427 2:192131377-192131399 CGCTAAAGGTGAAGGAGAAGGGG - Intronic
943806444 2:192131441-192131463 CACTAAGGGTGAAGGAGAAGGGG - Intronic
943834945 2:192507032-192507054 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
944387238 2:199180367-199180389 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
944393924 2:199247904-199247926 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
944772716 2:202930839-202930861 GGCTAAGGGAGAGGAAGAAGAGG - Intronic
944876340 2:203966707-203966729 CGCTAAGGGTGAAGGAGAAGTGG + Intergenic
945153322 2:206811616-206811638 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
945173237 2:207018173-207018195 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
945301690 2:208220966-208220988 TGCTAAGGGTGAAGGAGAAGGGG + Intergenic
945375888 2:209079024-209079046 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
945394115 2:209300286-209300308 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
945938090 2:215923307-215923329 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
946191036 2:218008133-218008155 CGCCCAGGGTGATGGGGAAGGGG - Intergenic
946215215 2:218178629-218178651 CACTAACGGTGAAGGAGAAGGGG + Intergenic
946215245 2:218178754-218178776 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
946215276 2:218178879-218178901 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
946396908 2:219447911-219447933 AGCTAAGGGTCTAGGAGAGGAGG + Intronic
946499711 2:220234626-220234648 AGGTAAGGAAGAAGGAGAAGAGG + Intergenic
946781239 2:223194539-223194561 CGCTAAGGGTGAAGGAGAAGGGG + Intronic
946886293 2:224226282-224226304 CCCTAAGGGTGAAGGAGAAGGGG - Intergenic
946893052 2:224297595-224297617 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
948158296 2:235802174-235802196 GATTTAGGGTGAAGGAGAAGGGG + Intronic
948189748 2:236048664-236048686 TGCTGAGAGGGAAGGAGAAGTGG - Intronic
948390431 2:237607738-237607760 CACTAAGGGGGAAGGAGAAGGGG - Intergenic
1170069073 20:12344995-12345017 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
1170106021 20:12754862-12754884 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1170165695 20:13359005-13359027 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1170325627 20:15152279-15152301 GGCTAAGGGAGAAGGAGGAATGG + Intronic
1170325695 20:15152574-15152596 CACTAAGGGTGAAGGTGAAGGGG + Intronic
1170820896 20:19755775-19755797 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1170979415 20:21196892-21196914 TGATAAGGATGAAGGAGATGTGG - Intronic
1171266059 20:23773155-23773177 CCCTAAGGGTGCAGGACAGGGGG + Intergenic
1172543736 20:35742728-35742750 CGCTGAGGGTGGAGAGGAAGTGG + Intergenic
1173101665 20:40094087-40094109 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1173118665 20:40270057-40270079 CATTAAGGGTGAAGGAGAAGGGG - Intergenic
1173118684 20:40270121-40270143 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1173755706 20:45514027-45514049 CGCTAAGGGTGCAGGAGAATGGG + Intronic
1173781430 20:45760304-45760326 CGCTAAGGGTGAAGGAGAAGGGG - Intronic
1173928203 20:46796740-46796762 GGGAAAGGGAGAAGGAGAAGGGG - Intergenic
1174656644 20:52177364-52177386 TGCCAAGGGACAAGGAGAAGGGG - Intronic
1174964253 20:55193523-55193545 AGGTAAGAGTGAAGGAGAAGAGG - Intergenic
1175302461 20:57952575-57952597 CACCAGGGGTGAAGGAGAGGGGG + Intergenic
1177031326 21:15984260-15984282 GGCTAAGGGAGAAGGAGGAATGG + Intergenic
1177100422 21:16893169-16893191 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1177723914 21:24943064-24943086 CTATAAGGGTGAAGTAGATGAGG - Intergenic
1179387312 21:40955763-40955785 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1180560686 22:16612270-16612292 CGCTGAGGGTGAAGGAGAAGGGG - Intergenic
1180560704 22:16612334-16612356 CACTAAGTGTGAAGGGGAAGGGG - Intergenic
1182113724 22:27742928-27742950 CGCTGAGGGTGAAGGAGAAGGGG - Intergenic
1182113744 22:27742994-27743016 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1182497379 22:30719199-30719221 AACTAAGGCTGAAAGAGAAGGGG - Intronic
1184294999 22:43517520-43517542 CGCGAAGGGCGAGAGAGAAGTGG - Intergenic
949162309 3:895431-895453 CGCTAAGAGTGAAGGAGAAGGGG + Intergenic
949190569 3:1244347-1244369 CGCTGAGGGTGAAGGAGAAGGGG + Intronic
949190588 3:1244411-1244433 CGCTGAGGGTGAAGGAGAAGGGG + Intronic
949190607 3:1244475-1244497 CGCTGAGGGTGAAGGAGAAGGGG + Intronic
949670939 3:6398591-6398613 CGCTAAGAGTGAATTAGAAGGGG - Intergenic
949827227 3:8177970-8177992 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
950926276 3:16745233-16745255 CACTAAGGGTGATGGAGAAGGGG - Intergenic
951019833 3:17770549-17770571 CGCTAGAGGAGAAGGACAAGTGG + Intronic
951299019 3:20972248-20972270 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
951695471 3:25441560-25441582 AGCTCTGGGCGAAGGAGAAGGGG - Intronic
952663663 3:35879088-35879110 CAATAAGGGTGAAGGAGAAGGGG + Intergenic
952895487 3:38075793-38075815 CACTAAGGGTGAAGGAGAAGGGG + Intronic
952896732 3:38082623-38082645 CGCTAAGGGTGAAGGAGAAGGGG + Intronic
953077361 3:39582644-39582666 TGCTAAGAGTGAGGGAGAAGGGG + Intergenic
953176962 3:40561848-40561870 TGCTAAGGGTGAAGGAGAAGGGG - Intronic
953385979 3:42505840-42505862 CGCCCAGTGTGCAGGAGAAGTGG + Intronic
953825918 3:46251029-46251051 CACTAAGAGTGAAGGAGAAGGGG + Intronic
954366634 3:50149987-50150009 TGGTAAGGGTGAAGGGGGAGGGG - Intergenic
954969466 3:54639186-54639208 TGCTAAGGGTGAAGGAGAAGGGG + Intronic
954969484 3:54639250-54639272 CGCTAAGGGTGAAGGAGAAGGGG + Intronic
956233682 3:67043299-67043321 CACTAAGGGTGAAGGATCAAGGG + Intergenic
956549160 3:70439486-70439508 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
957060108 3:75474815-75474837 TGCTAAGGGTGAAGGAGAAGGGG + Intergenic
957294994 3:78324650-78324672 AGCTAAGAGTGAAGGAGAAGGGG - Intergenic
957317528 3:78587902-78587924 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
959288574 3:104444777-104444799 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
959485970 3:106927404-106927426 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
959588722 3:108052357-108052379 AGCTAAGGGAGATGGAGTAGTGG - Intronic
959762188 3:109978253-109978275 TGCTAAGGGTGAGGGAGGGGTGG + Intergenic
959972477 3:112422335-112422357 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
960283071 3:115798138-115798160 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
960310344 3:116110100-116110122 TGCTAAGGGTGAAGGAGAAGGGG + Intronic
961164970 3:124757240-124757262 CGCTAAGGATGAAGGGGAAGGGG + Intergenic
961293277 3:125864591-125864613 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
961711806 3:128833808-128833830 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
961730366 3:128960741-128960763 CGCTGAGGGTGAAGGAGAAGGGG - Intronic
961730385 3:128960805-128960827 CGCTGAGGGTGAAGGAGAAGGGG - Intronic
961730404 3:128960869-128960891 CGCTAAGGGTGAAGGAGAAGGGG - Intronic
961816909 3:129555807-129555829 CTCTACGGGTGAGGGGGAAGTGG + Exonic
961880808 3:130060103-130060125 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
961880842 3:130060224-130060246 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
963068970 3:141286859-141286881 CTGTGAGGATGAAGGAGAAGGGG + Intronic
963425024 3:145114031-145114053 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
963456886 3:145555937-145555959 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
963468417 3:145711400-145711422 CGCTGAGGGTGAAGGAGAAGGGG - Intergenic
963521418 3:146363052-146363074 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
963521479 3:146363320-146363342 GGCTAAGGGAGAAGGAGGAATGG - Intergenic
963663097 3:148152499-148152521 CACTCAGGGTGAAGGAGAAAGGG - Intergenic
963684097 3:148415240-148415262 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
963684116 3:148415304-148415326 TGCTAAGAGTGAAGGAGAAGGGG - Intergenic
963850288 3:150204164-150204186 TGCTAAGGATGATGGAGCAGAGG + Intergenic
964067602 3:152597970-152597992 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
964471336 3:157059900-157059922 AACTAAGGTGGAAGGAGAAGTGG + Intergenic
964906738 3:161726675-161726697 TGCTAAGGGTGAAGGAGAAGGGG + Intergenic
964906772 3:161726796-161726818 CACTAAGATTGAAGGAGAAGGGG + Intergenic
964983455 3:162713457-162713479 AACTAAGGGTGAAGGAGAAGGGG - Intergenic
965105433 3:164346863-164346885 CGCTAAGGATGAAGGAGAAGGGG + Intergenic
965286922 3:166828719-166828741 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
965336124 3:167432182-167432204 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
965625098 3:170677287-170677309 CACTAAGGGTGAAGGAGAAGGGG + Intronic
965626527 3:170688112-170688134 CACTAAGGGTGAAGGAGAAGGGG + Intronic
965626560 3:170688231-170688253 CACTAAGAGTGAAGGAGAAGGGG + Intronic
965713173 3:171577332-171577354 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
965713192 3:171577396-171577418 CACTAAGGGTGAAAGAGAAGGGG - Intergenic
966066589 3:175828487-175828509 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
966085229 3:176062305-176062327 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
966105275 3:176326271-176326293 TGCTAAGGGTGAAGGAGAAGGGG + Intergenic
966105293 3:176326335-176326357 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
966233029 3:177670459-177670481 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
966278979 3:178208139-178208161 CTCTAAGGGTGAAGGAGAAGGGG - Intergenic
966279012 3:178208259-178208281 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
966279043 3:178208372-178208394 CACTAAGGGTGAAGGGGAAGGGG - Intergenic
966279079 3:178208491-178208513 CTATAAGGGTGAAGGAGAAGGGG - Intergenic
966279111 3:178208609-178208631 TGCTATGGGTGAAGGAGAAGGGG - Intergenic
967212375 3:187180245-187180267 TGCTAATGGTGAAGGAGAAGGGG + Intronic
967244377 3:187471029-187471051 CACTAAAAGTGAAGGAGAAGGGG + Intergenic
967496024 3:190145540-190145562 TGCTAAGAGTGAAGAAGAAGGGG - Intergenic
967561195 3:190921166-190921188 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
967624871 3:191671285-191671307 CACTAAGAGTGAAGGAGAAGGGG + Intergenic
967624890 3:191671349-191671371 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
967644037 3:191900127-191900149 TGCTAAGGGTGAAGGAGAAGGGG + Intergenic
967658332 3:192075882-192075904 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
967740274 3:192996613-192996635 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
969654348 4:8487682-8487704 CACTAAGCGTGAAGGAGAAGGGG + Intronic
969809906 4:9639825-9639847 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
970041901 4:11807301-11807323 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
970087360 4:12364758-12364780 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
970256635 4:14175274-14175296 CTCTAAGGGTGAAGAAGAAGGGG + Intergenic
970332781 4:15002862-15002884 CGCCGAGGGGGACGGAGAAGGGG - Exonic
971123390 4:23726726-23726748 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
971123423 4:23726851-23726873 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
971180357 4:24324273-24324295 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
971199964 4:24502166-24502188 CATTAAGGGTGAAGGAGAAGGGG - Intergenic
971636648 4:29068722-29068744 GGCTAAGGGAGAAGGGGAAAGGG - Intergenic
971757539 4:30721868-30721890 CGCTCACGGTGGAGGAGAATCGG + Exonic
972435233 4:39027422-39027444 CACAAAGCGTGAAAGAGAAGGGG + Intronic
974112516 4:57542188-57542210 TGCAAAGGGTGCAGGAGTAGAGG + Intergenic
974428608 4:61769025-61769047 CGCTAAGGGTGAAGGAGAAGGGG + Intronic
975865323 4:78718704-78718726 CGCTAAGAATGAAGGAGAAGGGG + Intergenic
975934114 4:79558755-79558777 TGCTAAGGGTGAAGGAGAAGGGG + Intergenic
976558427 4:86475846-86475868 GGCTAAGGGAGAAGGAGGAATGG - Intronic
976696320 4:87922796-87922818 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
976884779 4:89969504-89969526 CACTCAGGGTGAAGGAGAAGAGG + Intergenic
977010091 4:91624989-91625011 CGCTAAGGGTGAAAGAGAAGGGG - Intergenic
977010105 4:91625053-91625075 CGCTAAGAATGAAGGAGAAGGGG - Intergenic
977013160 4:91659486-91659508 TGCTAACAGTGAAGGAGAAGGGG + Intergenic
977013176 4:91659550-91659572 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
977041828 4:92026919-92026941 CGCTAAGGATGAAGGAGAAGGGG - Intergenic
977041846 4:92026983-92027005 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
977062805 4:92276630-92276652 CGCTAAGGGTGCAGGAGAAGGGG + Intergenic
977075403 4:92443637-92443659 CGCTAAGAGTGAAGGAGAAGGGG + Intronic
977198632 4:94089318-94089340 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
977217318 4:94297759-94297781 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
977217334 4:94297823-94297845 CGCTAAGCGTGAAGGAGAAGGGG + Intergenic
977217353 4:94297887-94297909 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
978001323 4:103558464-103558486 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
979054814 4:115980308-115980330 GGCTCAGGGTGAAGGAGAAGGGG + Intergenic
979146412 4:117253059-117253081 TGCTAAGAGTGAAGGAGAAGGGG - Intergenic
979379680 4:119994728-119994750 CACTAAGAGTGAAGGAGAAGGGG - Intergenic
979850531 4:125566440-125566462 CGCCAAGAGTGAAGGAGAAGGGG + Intergenic
979895363 4:126149830-126149852 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
979895381 4:126149894-126149916 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
980003554 4:127516182-127516204 TCCTAAGGGTGAAGGAGAAGGGG + Intergenic
980112153 4:128645627-128645649 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
980284753 4:130768368-130768390 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
980388702 4:132119131-132119153 CGCTCAGGGTGAAGGAGAAGGGG - Intergenic
980527676 4:134013177-134013199 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
980575838 4:134682583-134682605 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
980611965 4:135171985-135172007 AGCTAAGGGTGAAGGAGAAGGGG + Intergenic
980611983 4:135172049-135172071 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
980903704 4:138928779-138928801 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
981040067 4:140214646-140214668 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
981206631 4:142048612-142048634 AACTAAGGGTGAACGATAAGTGG + Intronic
981524938 4:145699889-145699911 CGCTAAGGGTGAAGGAGAAGGGG - Intronic
981539481 4:145833566-145833588 CGCTAAGGGTGAAGGAGAAGGGG - Intronic
982084153 4:151817256-151817278 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
982180669 4:152746002-152746024 TGCTAAGGGTGAAGGAGAAGGGG + Intronic
982180688 4:152746066-152746088 CACTGAGGGTGAAGGAGAAGGGG + Intronic
982180705 4:152746130-152746152 CACTGAGGGTGAAGGAGAAGGGG + Intronic
982535211 4:156601188-156601210 CGCTAAGGGTGAAAGAGAAGGGG - Intergenic
982535228 4:156601252-156601274 CGCTAAGGGTGAAAGAGAAGGGG - Intergenic
983023669 4:162710137-162710159 CGCTCAGGGTTAAGGAGAAGGGG - Intergenic
983055293 4:163094178-163094200 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
983055311 4:163094242-163094264 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
983330788 4:166325561-166325583 CACTAACAGTGAAGGAGAATAGG + Intergenic
983360171 4:166717127-166717149 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
983414915 4:167440513-167440535 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
983447845 4:167877204-167877226 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
983452125 4:167923855-167923877 TGTTAAGGGTGAAGGAGAAGGGG - Intergenic
983581746 4:169316368-169316390 AGCTGAGGGGGAAGGAGAGGTGG - Intergenic
983707492 4:170678541-170678563 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
984099238 4:175466086-175466108 TGCTAAGGGTGAAGGAGAAGGGG + Intergenic
984165498 4:176299296-176299318 GGCTAAGGGAGAAGGAGGAATGG + Intergenic
984393804 4:179169541-179169563 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
984700450 4:182815481-182815503 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
985328704 4:188802422-188802444 GGCTAAGTGTGACAGAGAAGAGG - Intergenic
985390106 4:189484327-189484349 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
985435531 4:189926850-189926872 CATTAAGGGTGAAGGAGAAGGGG - Intergenic
985435588 4:189927102-189927124 GGCTAAGGGAGAAGGAGGAATGG - Intergenic
985582069 5:703517-703539 CGCTGAGGGTGAAGGAGAAGGGG - Intergenic
985582132 5:703764-703786 CGCTGAGGGTGAAGGAGAAGGGG - Intergenic
985582151 5:703828-703850 CGCTAAGCGTGAAGGAGAAGGGG - Intergenic
986193324 5:5516529-5516551 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
986193341 5:5516593-5516615 CACTAAGCGTGAAGGAGAAGGGG - Intergenic
986388672 5:7264574-7264596 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
986555781 5:9008694-9008716 TGCTAAGGGTGAAGGAGGAGGGG + Intergenic
986555906 5:9009391-9009413 CACTAAGGATGAAGGAGAAGGGG + Intergenic
986555940 5:9009516-9009538 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
986905562 5:12490810-12490832 CGCTGAGGGTGAAGGAGAAGGGG - Intergenic
986905581 5:12490874-12490896 TGCTAAGGATGAAGGAGAAGGGG - Intergenic
986919807 5:12667320-12667342 CGCTAAGAGTGAAGGAGAAGGGG + Intergenic
987281821 5:16420931-16420953 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
987498322 5:18673510-18673532 CACTAAGGGTGAAGGAGAAGAGG + Intergenic
988629796 5:32916754-32916776 CTCTAAGGGATAAGGAGATGAGG - Intergenic
988930008 5:36028321-36028343 AGGAAAGGGTGAAAGAGAAGGGG - Intergenic
990282213 5:54263450-54263472 AGATAAGGGTGAAGGGGAAAGGG + Intronic
990737125 5:58876783-58876805 TATTAGGGGTGAAGGAGAAGTGG - Intergenic
990955079 5:61332517-61332539 CGCGCAGGGTGGCGGAGAAGTGG + Exonic
992394433 5:76358247-76358269 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
992452197 5:76885193-76885215 GGCTAAGGGAGAAGGAGGAATGG + Intronic
992752602 5:79874925-79874947 CGCTCAGGGAGGATGAGAAGCGG + Intergenic
992960614 5:81954184-81954206 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
993192481 5:84699357-84699379 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
993192499 5:84699421-84699443 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
993192516 5:84699485-84699507 CACTAAGGGTGAAAGAGAAGGGG - Intergenic
993217293 5:85042435-85042457 CGGAGAGGGTGAAGGGGAAGTGG - Intergenic
993836446 5:92824730-92824752 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
993836474 5:92824855-92824877 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
994294963 5:98080140-98080162 CGCTAAAGGTGAAGGAGAAGGGG - Intergenic
994532745 5:100988969-100988991 CGCAAAGGGTGAAGGAGAAGGGG + Intergenic
994532809 5:100989216-100989238 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
994775492 5:104032660-104032682 CGCTAAAGGTGAAGGAGAAGGGG - Intergenic
994779249 5:104069399-104069421 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
994779265 5:104069463-104069485 CACTAACGGTGAAGGAGAAGGGG + Intergenic
995806089 5:116053654-116053676 GGGTAAGGATGAAGGAGTAGAGG - Intronic
995899616 5:117051261-117051283 CACTAAGAGTGAAGGAGAAGGGG + Intergenic
996203483 5:120702393-120702415 CGCTAAGAGTGAAGGAGAAGGGG + Intergenic
996382927 5:122880358-122880380 GGCTGAGGGTGGAGGAGAGGAGG + Intronic
996527847 5:124498001-124498023 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
996575158 5:124971068-124971090 GGCTAAGGGAGAAGGAGGAATGG + Intergenic
996745742 5:126844681-126844703 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
997769887 5:136544384-136544406 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
997769905 5:136544448-136544470 TGCTAAGGGTGAAGGAGAAGGGG + Intergenic
997772886 5:136570229-136570251 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
997943377 5:138178502-138178524 CGCTTAGGGAGTGGGAGAAGTGG - Intronic
998996590 5:147873560-147873582 CGCTAAGGGTGAAGGAGAAGGGG + Intronic
999268112 5:150280170-150280192 GGCTTGGGGTGAAGGTGAAGAGG - Intronic
999619070 5:153454403-153454425 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
999696305 5:154190865-154190887 CGATGAGGCGGAAGGAGAAGCGG + Exonic
1000519633 5:162280175-162280197 CACTAAGGGTGAAGGAGAAGTGG + Intergenic
1000935871 5:167302695-167302717 CACTAAGGGTGAAGGAGAAGGGG + Intronic
1001331698 5:170766894-170766916 CACTAAGAGTGAAGGAGAAGGGG + Intronic
1001572614 5:172740399-172740421 CGCTGGTGGTGAAGGGGAAGAGG + Intergenic
1002611172 5:180419436-180419458 CGCTAAGGGCGAAGGAGAAGGGG + Intergenic
1003430367 6:6032491-6032513 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
1003430385 6:6032555-6032577 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1003430404 6:6032619-6032641 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1003985581 6:11431498-11431520 GGCTAGGGGTGAGGGAGAGGAGG - Intergenic
1004105994 6:12668133-12668155 TGCTAAGAGTGAAGGAGAAGGGG - Intergenic
1004106027 6:12668254-12668276 TGCTAAGAGTGAAGGAGAAGGGG - Intergenic
1004106059 6:12668375-12668397 TGCTAAGGGTGAAGAAGAAGGGG - Intergenic
1004283772 6:14301816-14301838 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1004508241 6:16263917-16263939 CGCTAAGTGTGAAGGAGAAGGGG + Intronic
1004575016 6:16886931-16886953 CGCTCAGGGTGAAGGAGAAGGGG - Intergenic
1004743944 6:18491445-18491467 CGCAGAGGGAGAAGGAGAATTGG + Intergenic
1004768811 6:18758915-18758937 CACTAAGAGTGAAGGAGAAGGGG + Intergenic
1005014882 6:21366249-21366271 CTCTAAGGGTGAAGGAGAAGGGG + Intergenic
1008476336 6:51939229-51939251 CACTAAGGGTGAAGGAGAAGGGG - Intronic
1008850403 6:56015455-56015477 CACTAGGGGTGAAGGAGAAGGGG + Intergenic
1008850435 6:56015574-56015596 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
1008850466 6:56015695-56015717 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
1008850497 6:56015814-56015836 TGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1009343404 6:62586933-62586955 TGCTAAGGGTGAAGTAGAAGGGG - Intergenic
1009359173 6:62792573-62792595 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1009647182 6:66420520-66420542 AGAGAAGGGTGAAGGCGAAGGGG + Intergenic
1010586918 6:77665308-77665330 CACTAAGGGTGAAAGATAAGGGG + Intergenic
1010586937 6:77665372-77665394 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1010586956 6:77665436-77665458 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1010827121 6:80487129-80487151 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1010894813 6:81350161-81350183 CGCTAAGGGTGAAGGAGAGGGGG + Intergenic
1010941626 6:81925869-81925891 TGCCAGGGGTTAAGGAGAAGAGG + Intergenic
1011368091 6:86602982-86603004 CACTAAGGGTGAAGTAGAAGGGG + Intergenic
1011771145 6:90674885-90674907 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
1012014595 6:93834794-93834816 TGCTAGGAGTGAAGGAGAAGGGG + Intergenic
1012315593 6:97780504-97780526 CGCTAAGAGTGAAGGAGAAGGGG - Intergenic
1012689309 6:102293656-102293678 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1012689327 6:102293720-102293742 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1012689344 6:102293784-102293806 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1013408112 6:109860593-109860615 CGCTAAGAGTGAAGGAGAAGGGG + Intergenic
1013843957 6:114427357-114427379 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1013891468 6:115032788-115032810 CGCTAAGGGTGAAGGAGAAAAGG - Intergenic
1013891484 6:115032852-115032874 CACTAAGGGTGAAAGAGAAGGGG - Intergenic
1014360396 6:120467115-120467137 TGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1014455082 6:121625157-121625179 CGCTAAGGGTGAAAGAGAAGGGG + Intergenic
1014455101 6:121625221-121625243 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
1014455117 6:121625285-121625307 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
1014555632 6:122840812-122840834 CGCTAAGAGTGAAGGAGAAGGGG - Intergenic
1014614882 6:123587042-123587064 TGCTCAGGGTGAAGGAAAAGGGG + Intronic
1014718398 6:124891395-124891417 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1014718417 6:124891459-124891481 CACTAAGTGTGAAGGAGAAGGGG - Intergenic
1014794210 6:125706622-125706644 CACTAAGAGTGAAGGAGAAGGGG + Intergenic
1014794225 6:125706686-125706708 CGCTAACAGTGAAGGAGAAGGGG + Intergenic
1014891343 6:126849769-126849791 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1015164999 6:130193263-130193285 TGCTAAGTGTGAAGGAGAAGGGG - Intronic
1015266535 6:131296473-131296495 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1015269435 6:131324303-131324325 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1015271162 6:131339870-131339892 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1015271180 6:131339934-131339956 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1015277965 6:131403913-131403935 CACTAGGGGTGAAGGAGAAGGGG - Intergenic
1015323614 6:131902611-131902633 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1015903461 6:138091634-138091656 TGTTAAGGGCTAAGGAGAAGAGG - Exonic
1016204329 6:141453779-141453801 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1016248614 6:142016663-142016685 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1016518597 6:144924163-144924185 CACTAAGGCTGAAGGAGAAGGGG - Intergenic
1016518630 6:144924288-144924310 CACTAACGGTGAAGGAGAAGGGG - Intergenic
1016518668 6:144924465-144924487 GGCTAAGGGAGAAGGAGGAATGG - Intergenic
1016535958 6:145107895-145107917 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
1016650498 6:146455151-146455173 TGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1016650579 6:146455459-146455481 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1017779535 6:157705391-157705413 TGCTAAGGGTGAAGGAGAAGGGG + Intronic
1017779566 6:157705512-157705534 CACTAAGAGTGAAGGAGAAGGGG + Intronic
1018084720 6:160291337-160291359 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1018495680 6:164343797-164343819 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1018521700 6:164656958-164656980 CACTAAGGATGAAGGAGAAGGGG + Intergenic
1018521733 6:164657079-164657101 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1019667020 7:2257116-2257138 GGTGAAGGCTGAAGGAGAAGGGG - Intronic
1020315826 7:6904740-6904762 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1020532948 7:9358250-9358272 CGCTAAGAGTGAAGGAGAAGGGG + Intergenic
1021452667 7:20797554-20797576 CACTGGGGGTGAAGGTGAAGGGG - Intergenic
1021637103 7:22704275-22704297 CACTCAGGGTGAAGGAGAAGGGG - Intergenic
1021810450 7:24397253-24397275 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1021978057 7:26028730-26028752 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1021978076 7:26028794-26028816 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1022372685 7:29785946-29785968 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1022710220 7:32842461-32842483 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
1022854857 7:34304314-34304336 GGCTAAGGGAGAAGGAGGAATGG + Intergenic
1022854915 7:34304548-34304570 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
1023699102 7:42875342-42875364 CGCTAAGGCTGAAGGAGAAGGGG + Intergenic
1023699118 7:42875406-42875428 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1024697366 7:51870826-51870848 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1024697385 7:51870890-51870912 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1024697404 7:51870954-51870976 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1024697422 7:51871018-51871040 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1028490471 7:91405862-91405884 GGACAAGGGAGAAGGAGAAGGGG - Intergenic
1028689976 7:93640896-93640918 TGCTAAGGGTGAAGGAGAAGGGG - Intronic
1030445960 7:109646710-109646732 CACTAAGGGTGAAGGATCAAGGG + Intergenic
1030751677 7:113238136-113238158 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
1030751696 7:113238200-113238222 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1031004472 7:116456558-116456580 CGCTAAGGGTGAAGGAGAAGGGG - Intronic
1031355422 7:120781915-120781937 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1031364954 7:120890408-120890430 CACTAAGGGTGAAAGAGAAGGGG + Intergenic
1031399816 7:121316723-121316745 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1031525338 7:122817725-122817747 CGCTAAGAGTGAAGGAGAAGGGG - Intronic
1031633647 7:124075195-124075217 AGCAAAGGGAGAAGGAGAAGGGG - Intergenic
1031728137 7:125263612-125263634 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1031776105 7:125910894-125910916 CACTAAGAGTGAAGGAGAAGGGG - Intergenic
1031777117 7:125918527-125918549 TGCTAAGGGTGAAGGGGCAGGGG - Intergenic
1032610531 7:133408008-133408030 TGGTAATGATGAAGGAGAAGGGG + Intronic
1033414039 7:141146811-141146833 GGCTTAGGGAGCAGGAGAAGGGG - Intronic
1033676168 7:143541940-143541962 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1033695665 7:143787499-143787521 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1033909699 7:146248248-146248270 CGCTCAGGGTGAAGGAGAAGGGG + Intronic
1035190048 7:157159095-157159117 CTTTCAGGATGAAGGAGAAGTGG - Intronic
1036071123 8:5441325-5441347 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1036281250 8:7403285-7403307 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1036340216 8:7908287-7908309 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1036371924 8:8169571-8169593 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1036472562 8:9064216-9064238 CGCTAAGGGTGAAGGAGAAGGGG + Intronic
1036878980 8:12496072-12496094 TGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1037577105 8:20217385-20217407 TGGTAAGGGTGAAAGACAAGAGG - Intronic
1037682962 8:21113385-21113407 CGCTCATGGAGAAGGGGAAGAGG + Intergenic
1038516161 8:28189288-28189310 TGCTACAGGTGAAGGAGAAGAGG - Intronic
1039041619 8:33414029-33414051 CACTGAGGGTGGAGGTGAAGGGG - Intronic
1039407859 8:37328278-37328300 AGCTAAGGGGGCAGGAGGAGAGG - Intergenic
1041950167 8:63492227-63492249 CACTAAGAGAGAAGGAGAAACGG - Intergenic
1042453307 8:68973975-68973997 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1043718124 8:83509957-83509979 TGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1043794428 8:84518333-84518355 AGCTAAGGGGAAGGGAGAAGTGG + Intronic
1043837491 8:85063796-85063818 TGCTAAGGGTGAAGGAGAAGCGG - Intergenic
1043837506 8:85063860-85063882 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1044148698 8:88746845-88746867 TGTTAAGGGTGAAGGAGAAGGGG + Intergenic
1044416849 8:91948915-91948937 CGCTAAGGGTAAAGGAGAAGGGG - Intergenic
1044416886 8:91949040-91949062 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1044921748 8:97176008-97176030 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1044921782 8:97176132-97176154 CACTAAAGGTGAAGGAGAAGGGG - Intergenic
1044924929 8:97201829-97201851 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1045060695 8:98408214-98408236 CACTGAGGGCCAAGGAGAAGGGG - Intronic
1045197264 8:99944669-99944691 TGTTAAGGGTGAAGGAGAAGGGG - Intergenic
1045282383 8:100760339-100760361 TGGTGAGGGAGAAGGAGAAGTGG + Intergenic
1045644583 8:104286958-104286980 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1045955514 8:107901159-107901181 CACCAAAGGCGAAGGAGAAGAGG - Exonic
1046293913 8:112196833-112196855 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1046386580 8:113514360-113514382 TGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1046439847 8:114242600-114242622 TGCTAGGAGTGAAGGAGAAGGGG - Intergenic
1046442981 8:114282692-114282714 CGCTAAGGGTGAAGGCGAAGGGG - Intergenic
1046442998 8:114282756-114282778 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1046511881 8:115213248-115213270 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1046559133 8:115815878-115815900 GGCTAAGGGAGAAGGAGGAATGG - Intergenic
1047699134 8:127432680-127432702 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1047829680 8:128616331-128616353 GGCTAAGGGAGAAGGAGGAATGG + Intergenic
1047829735 8:128616600-128616622 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1048168634 8:132084910-132084932 CGCTAAGGGTGAAGGAGAAGGGG + Intronic
1048168653 8:132084974-132084996 CGCTAAGGGTGAAGGAGAAGGGG + Intronic
1048585630 8:135771882-135771904 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1048764445 8:137829587-137829609 CACTAAGGGTGAAGGAGACAGGG + Intergenic
1048818189 8:138353941-138353963 CAATAAAGCTGAAGGAGAAGAGG - Intronic
1048892814 8:138963114-138963136 GGCTAGGGGTAAAGGGGAAGTGG - Intergenic
1048938710 8:139378063-139378085 CCCTAAAGGTGAAGGAGCAATGG + Intergenic
1048991692 8:139764215-139764237 AGCTAGGGGAGAAGGAGAGGAGG + Intronic
1050117449 9:2276839-2276861 GGCTAAGGGAGAAGGAGGAATGG - Intergenic
1050531318 9:6592054-6592076 CCCTGAGTGTGAGGGAGAAGGGG - Intronic
1051052416 9:12949321-12949343 CTCTAAGGGTGAAGAAGAAGGGG - Intergenic
1051804476 9:20976715-20976737 CCCTGAGGGTGAGGAAGAAGAGG + Intronic
1051849497 9:21490416-21490438 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1052191611 9:25669873-25669895 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1052653098 9:31327303-31327325 CTCTAAGGGTGAAGGAGAAGGGG - Intergenic
1052653182 9:31327652-31327674 GGCTAAGGGAGAAGGAGGAATGG - Intergenic
1053057760 9:35004253-35004275 AGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1055232826 9:74086577-74086599 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1055232845 9:74086641-74086663 CGCTAAGGGTGAAAGAGAAGGGG - Intergenic
1055626481 9:78181652-78181674 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1055809823 9:80138286-80138308 CGCTAAGAGTGAAGGAGAAGAGG - Intergenic
1055881543 9:81009974-81009996 CGCTAAGGCTGAAGGAGAAGGGG - Intergenic
1056044916 9:82705267-82705289 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1056044938 9:82705331-82705353 CGCTAAGGGTGAAGGGGAAGGGG + Intergenic
1056060966 9:82884801-82884823 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1056323619 9:85459391-85459413 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1056437453 9:86588046-86588068 CGCTAAGGGTGAACGAGAAGGGG + Intergenic
1056437471 9:86588110-86588132 CGCTGAGGATGAAGGAGAAGGGG + Intergenic
1056437490 9:86588174-86588196 CGCTGAGGGTGAAGGAGAAGGGG + Intergenic
1056437509 9:86588238-86588260 CGCTGAGGGTGAAGGAGAAGGGG + Intergenic
1056437528 9:86588302-86588324 CACTGAGGGTGAAGGAGAAGGGG + Intergenic
1056437546 9:86588366-86588388 CGCTGAGGGTGAAGGAGAAGGGG + Intergenic
1056522229 9:87411886-87411908 TGCTAAGAGTGAAGGAGAAGGGG - Intergenic
1057234618 9:93348534-93348556 CGCTAAGAGTGAAGGAGAAGGGG - Intergenic
1057377774 9:94540802-94540824 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1057683707 9:97215441-97215463 CGCTGAGGGTGAAGGGGAAGGGG - Intergenic
1057683728 9:97215505-97215527 CGCTGAGGGTGAAGGGGAAGGGG - Intergenic
1057683749 9:97215567-97215589 CGCTGAGGGTGAAGGGGAAGGGG - Intergenic
1057683771 9:97215630-97215652 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1057981775 9:99670716-99670738 CACTAAGCTTGAAGGAGAAGGGG - Intergenic
1057981791 9:99670780-99670802 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1057981809 9:99670843-99670865 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1058026447 9:100145543-100145565 CACTAAGGGTGAAGGAGAAGGGG + Intronic
1058057086 9:100459417-100459439 AGATAAGGGTGTTGGAGAAGAGG + Intronic
1058612209 9:106789238-106789260 TGCTAAGGGTGATGGAGAAGGGG - Intergenic
1059546363 9:115179351-115179373 CGCTAAGGGTGAAAGAGAAGGGG + Intronic
1059574385 9:115474250-115474272 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1059574403 9:115474314-115474336 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1059574420 9:115474378-115474400 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1059606913 9:115843911-115843933 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1059738957 9:117130874-117130896 TGCTCAGGGAGAAGGGGAAGGGG - Intronic
1059863694 9:118490380-118490402 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1060421552 9:123472898-123472920 CTCCAAGGGTGAAGGGCAAGGGG - Intronic
1060738109 9:126079438-126079460 CGCTAAGGTTAAAGGAGAAGAGG + Intergenic
1060855424 9:126911246-126911268 GTCTAAGGCTGAAGGAGAGGAGG - Intergenic
1061099893 9:128484615-128484637 AGCAGAGGGTGAAGGAGAAAGGG - Intronic
1185858698 X:3558737-3558759 GGCTAAGGGAGAAGGAGGAATGG + Intergenic
1185858798 X:3559151-3559173 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
1185960834 X:4544909-4544931 GGCTAAGGGAGAAGGAGGAATGG + Intergenic
1185960863 X:4545042-4545064 TGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1185960881 X:4545106-4545128 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
1185960902 X:4545172-4545194 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1185990856 X:4892606-4892628 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1186113100 X:6276954-6276976 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1186638147 X:11427797-11427819 CGCGAAGGGGGAGGGGGAAGAGG + Intronic
1186783863 X:12940833-12940855 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1187086742 X:16049451-16049473 CACTCAGGGTGAAGGAGAAGGGG + Intergenic
1187100080 X:16183335-16183357 CGCTAAGGGTAAAGGAGAAGGGG + Intergenic
1187100108 X:16183452-16183474 CGCTAAGAGTGAAGGAGAAGGGG + Intergenic
1187260776 X:17683403-17683425 AGCTAAGGGTGATGGGGTAGGGG - Intronic
1187513981 X:19948864-19948886 GACTAAGGGGGAAGGAGAAATGG + Intronic
1188461619 X:30433446-30433468 CGTTAAGTGTGAAGTAGAAGTGG + Intergenic
1188463592 X:30453835-30453857 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
1190000824 X:46684976-46684998 CAACCAGGGTGAAGGAGAAGAGG - Intronic
1190888054 X:54546546-54546568 TGCCAAGGGTGTAGGAAAAGAGG - Intronic
1192243048 X:69349863-69349885 AGGTCAGGGTGCAGGAGAAGGGG - Intergenic
1192941196 X:75913215-75913237 CACTACTGGTGAAGGAGAGGTGG + Intergenic
1193941274 X:87682807-87682829 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1194186441 X:90778012-90778034 TGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1194293820 X:92104923-92104945 CACTAAGGGTGAAGGAGAAGGGG + Intronic
1194308750 X:92277787-92277809 CACTAACAGTGAAGGAGATGGGG + Intronic
1194351067 X:92825439-92825461 CGCTAAGGGTGAAGGAGAGGGGG - Intergenic
1194351087 X:92825503-92825525 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1194366895 X:93023922-93023944 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1194503200 X:94703601-94703623 CACTCAGGGTGAAGGAGAAAGGG + Intergenic
1194822972 X:98528991-98529013 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
1194822991 X:98529055-98529077 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1195406721 X:104522615-104522637 AGCGAAGGGAGAAGGGGAAGTGG + Intergenic
1195841257 X:109179331-109179353 CCCTAAGGGTGAAGGAGAAGGGG - Intergenic
1195908880 X:109869908-109869930 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1196072851 X:111544804-111544826 TGCTCAGAGTGAAGGAGAAGGGG - Intergenic
1196165290 X:112531399-112531421 CGCTAAGAGTGAAGGAGAAGGGG - Intergenic
1196165321 X:112531524-112531546 TGCTAAGAGTGAAGGAGAAGGGG - Intergenic
1196299808 X:114040985-114041007 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1196330584 X:114467606-114467628 CGCTAAGAGTGAAGGAGAAGGGG - Intergenic
1196341957 X:114606164-114606186 CACTAAGGGTGAAGGAGAAGGGG + Intronic
1196525689 X:116725666-116725688 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
1196533742 X:116817194-116817216 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1196533761 X:116817258-116817280 CACTAAGGGTGAAGGAGAAGGGG + Intergenic
1196572316 X:117280256-117280278 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1196572334 X:117280320-117280342 TGCTAAGGGTGAAGGAGAGGGGG - Intergenic
1196774062 X:119322463-119322485 TGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1196795668 X:119500378-119500400 CGAAAAGGGTGTAGGGGAAGGGG + Intergenic
1197064699 X:122223012-122223034 CGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1197352261 X:125393546-125393568 TGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1197932865 X:131713000-131713022 TGCTAAGAGTGAAGGAGAAGGGG - Intergenic
1198149176 X:133891272-133891294 GGCTAGGGGTGAAGGAGATGGGG + Intronic
1198598216 X:138259616-138259638 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1198599607 X:138269057-138269079 TGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1198983895 X:142427996-142428018 GGCTAAGGGAGAAGGAGGAATGG + Intergenic
1199576247 X:149316589-149316611 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1199576279 X:149316714-149316736 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1200533041 Y:4360088-4360110 CGCTAAGGGTGAAGGAGAAGGGG + Intergenic
1200611337 Y:5329464-5329486 CACTAAGGGTGAAGGAGAAGGGG + Intronic
1200659396 Y:5942119-5942141 CGCTAAGGGTGAAGGAGAGGGGG - Intergenic
1200659416 Y:5942183-5942205 TGCTAAGGGTGAAGGAGAAGGGG - Intergenic
1200675117 Y:6140178-6140200 CACTAAGGGTGAAGGAGAAGGGG - Intergenic
1201936863 Y:19419438-19419460 CGCTAAGGGTGAAGAAGAAGGGG - Intergenic
1202076758 Y:21044167-21044189 TGCTAAAGGTGAAAGAGAAGGGG + Intergenic