ID: 977217318

View in Genome Browser
Species Human (GRCh38)
Location 4:94297759-94297781
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977217310_977217318 -2 Left 977217310 4:94297738-94297760 CCCTAGAAAAGCAGGACTTGCCG No data
Right 977217318 4:94297759-94297781 CGCTAAGGGTGAAGGAGAAGGGG No data
977217311_977217318 -3 Left 977217311 4:94297739-94297761 CCTAGAAAAGCAGGACTTGCCGC No data
Right 977217318 4:94297759-94297781 CGCTAAGGGTGAAGGAGAAGGGG No data
977217308_977217318 0 Left 977217308 4:94297736-94297758 CCCCCTAGAAAAGCAGGACTTGC No data
Right 977217318 4:94297759-94297781 CGCTAAGGGTGAAGGAGAAGGGG No data
977217309_977217318 -1 Left 977217309 4:94297737-94297759 CCCCTAGAAAAGCAGGACTTGCC No data
Right 977217318 4:94297759-94297781 CGCTAAGGGTGAAGGAGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type