ID: 977217319

View in Genome Browser
Species Human (GRCh38)
Location 4:94297765-94297787
Sequence GGGTGAAGGAGAAGGGGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2254
Summary {0: 458, 1: 207, 2: 56, 3: 137, 4: 1396}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977217309_977217319 5 Left 977217309 4:94297737-94297759 CCCCTAGAAAAGCAGGACTTGCC 0: 31
1: 190
2: 354
3: 230
4: 230
Right 977217319 4:94297765-94297787 GGGTGAAGGAGAAGGGGTTGAGG 0: 458
1: 207
2: 56
3: 137
4: 1396
977217311_977217319 3 Left 977217311 4:94297739-94297761 CCTAGAAAAGCAGGACTTGCCGC 0: 68
1: 346
2: 425
3: 284
4: 202
Right 977217319 4:94297765-94297787 GGGTGAAGGAGAAGGGGTTGAGG 0: 458
1: 207
2: 56
3: 137
4: 1396
977217310_977217319 4 Left 977217310 4:94297738-94297760 CCCTAGAAAAGCAGGACTTGCCG 0: 13
1: 152
2: 413
3: 413
4: 271
Right 977217319 4:94297765-94297787 GGGTGAAGGAGAAGGGGTTGAGG 0: 458
1: 207
2: 56
3: 137
4: 1396
977217308_977217319 6 Left 977217308 4:94297736-94297758 CCCCCTAGAAAAGCAGGACTTGC No data
Right 977217319 4:94297765-94297787 GGGTGAAGGAGAAGGGGTTGAGG 0: 458
1: 207
2: 56
3: 137
4: 1396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977217319 Original CRISPR GGGTGAAGGAGAAGGGGTTG AGG Intergenic
Too many off-targets to display for this crispr