ID: 977217320

View in Genome Browser
Species Human (GRCh38)
Location 4:94297766-94297788
Sequence GGTGAAGGAGAAGGGGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977217309_977217320 6 Left 977217309 4:94297737-94297759 CCCCTAGAAAAGCAGGACTTGCC No data
Right 977217320 4:94297766-94297788 GGTGAAGGAGAAGGGGTTGAGGG No data
977217311_977217320 4 Left 977217311 4:94297739-94297761 CCTAGAAAAGCAGGACTTGCCGC No data
Right 977217320 4:94297766-94297788 GGTGAAGGAGAAGGGGTTGAGGG No data
977217310_977217320 5 Left 977217310 4:94297738-94297760 CCCTAGAAAAGCAGGACTTGCCG No data
Right 977217320 4:94297766-94297788 GGTGAAGGAGAAGGGGTTGAGGG No data
977217308_977217320 7 Left 977217308 4:94297736-94297758 CCCCCTAGAAAAGCAGGACTTGC No data
Right 977217320 4:94297766-94297788 GGTGAAGGAGAAGGGGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977217320 Original CRISPR GGTGAAGGAGAAGGGGTTGA GGG Intergenic