ID: 977217321

View in Genome Browser
Species Human (GRCh38)
Location 4:94297767-94297789
Sequence GTGAAGGAGAAGGGGTTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1235
Summary {0: 407, 1: 144, 2: 39, 3: 71, 4: 574}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977217311_977217321 5 Left 977217311 4:94297739-94297761 CCTAGAAAAGCAGGACTTGCCGC 0: 68
1: 346
2: 425
3: 284
4: 202
Right 977217321 4:94297767-94297789 GTGAAGGAGAAGGGGTTGAGGGG 0: 407
1: 144
2: 39
3: 71
4: 574
977217309_977217321 7 Left 977217309 4:94297737-94297759 CCCCTAGAAAAGCAGGACTTGCC 0: 31
1: 190
2: 354
3: 230
4: 230
Right 977217321 4:94297767-94297789 GTGAAGGAGAAGGGGTTGAGGGG 0: 407
1: 144
2: 39
3: 71
4: 574
977217308_977217321 8 Left 977217308 4:94297736-94297758 CCCCCTAGAAAAGCAGGACTTGC No data
Right 977217321 4:94297767-94297789 GTGAAGGAGAAGGGGTTGAGGGG 0: 407
1: 144
2: 39
3: 71
4: 574
977217310_977217321 6 Left 977217310 4:94297738-94297760 CCCTAGAAAAGCAGGACTTGCCG 0: 13
1: 152
2: 413
3: 413
4: 271
Right 977217321 4:94297767-94297789 GTGAAGGAGAAGGGGTTGAGGGG 0: 407
1: 144
2: 39
3: 71
4: 574

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977217321 Original CRISPR GTGAAGGAGAAGGGGTTGAG GGG Intergenic
900840578 1:5045847-5045869 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
901251556 1:7783833-7783855 GGGAAGGAGAGGGGAGTGAGAGG - Intergenic
901556182 1:10033014-10033036 GGGAAAGAGTAGGGGTGGAGGGG + Intronic
901689192 1:10961385-10961407 CTGAAGGAGCAGGGGCTGAGCGG - Intronic
902179047 1:14673763-14673785 GGGAAGGGGAAGGGGTTGACCGG - Intronic
902892553 1:19454951-19454973 GGGAAGGAAGAGGGGCTGAGTGG + Intronic
903004767 1:20291409-20291431 GAGCAGGAGAAGGGGTGGGGAGG - Intronic
903392044 1:22971507-22971529 GAGAAGGAGCAGGGGTTGGGGGG - Intergenic
903730860 1:25494297-25494319 GTGAAGGAGGGGGCATTGAGTGG + Intronic
903826832 1:26151929-26151951 GTGATGGAGAAGGGATGGAGAGG - Intergenic
903946737 1:26968791-26968813 GTGGCGGTGAAGGGGGTGAGGGG + Intergenic
904586233 1:31582413-31582435 TTGAAGGAGGAGGGGATCAGGGG + Intronic
905273928 1:36805147-36805169 ATGAAGGAGAAGTGGTGGCGGGG - Exonic
905295464 1:36951750-36951772 GAGAAGGAGAAGAGGATGAAAGG + Intronic
905448079 1:38040338-38040360 GTGATGGGGATGGGGATGAGTGG + Intergenic
905795866 1:40816334-40816356 GTGAAGGAGAGCGAGGTGAGAGG - Intronic
905877924 1:41445156-41445178 GTGAAGAAGAAGCTGTTGTGAGG + Intergenic
905884681 1:41485276-41485298 GTGACAGGGCAGGGGTTGAGGGG - Intergenic
906035622 1:42748693-42748715 CTGCAGGAGATGGGGCTGAGTGG + Intronic
906242315 1:44249554-44249576 GTCAAGGAGAATGGCTTTAGAGG - Intronic
906320424 1:44812298-44812320 GTGCAGGAGCAGGTGTTGAAGGG + Intronic
906744753 1:48213843-48213865 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
906849980 1:49237412-49237434 GGGAAGAAGAAGAGGTTTAGTGG - Intronic
907292424 1:53425304-53425326 ATGAAGGAGAAGGGGTTGAGGGG - Intergenic
907337409 1:53709455-53709477 GTGAAGGTGAATGGGTTGATGGG + Intronic
907441560 1:54481713-54481735 GGGAAGTAGAGGGGGTTGGGGGG + Intergenic
907487497 1:54787835-54787857 GAGAAGGAGATGTGGTTGGGTGG + Intronic
907509059 1:54944976-54944998 ATGAACGAGGAGGGGTGGAGTGG + Intergenic
907728147 1:57039614-57039636 GGGAAGGAGAAAGGGTGGGGTGG - Intronic
907812354 1:57883930-57883952 GTGGAGGAGAAGGTATTGGGAGG + Intronic
907924623 1:58944048-58944070 GTGGAGGAGAAGGCATTTAGGGG + Intergenic
908461912 1:64354694-64354716 GTGAAAGAGAAGGGGTTGAGGGG + Intergenic
908461928 1:64354758-64354780 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
908592191 1:65646719-65646741 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
908592218 1:65646846-65646868 GTGAAGGAGAAAGGGTTGAGGGG + Intergenic
908592235 1:65646910-65646932 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
908768016 1:67571551-67571573 CTGAAGGAGAAGGGGCTGGGAGG + Intergenic
908852171 1:68387169-68387191 GTGAAGGAGAAGGGTTTGAGGGG - Intergenic
908852188 1:68387233-68387255 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
908852204 1:68387297-68387319 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
909035271 1:70589343-70589365 GTGAAAGAGAAGGGGTTGAGGGG - Intergenic
909222856 1:72984532-72984554 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
909223854 1:72992515-72992537 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
909223873 1:72992579-72992601 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
909223892 1:72992643-72992665 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
909793188 1:79701063-79701085 GGGAAGGAGAAGGGGTTGAGGGG + Intergenic
909909727 1:81246277-81246299 GTGAAGGAGCAGGGGTTGAGGGG - Intergenic
909932035 1:81507263-81507285 GTGCAGGAGAAAGTGCTGAGGGG - Intronic
909978647 1:82072172-82072194 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
911570167 1:99510496-99510518 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
911570184 1:99510560-99510582 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
911852899 1:102841051-102841073 GTAAAGGAGAAGGGGAGAAGGGG - Intergenic
912500791 1:110120805-110120827 GTAAGTGAGCAGGGGTTGAGGGG - Intergenic
912504751 1:110148864-110148886 GGGAAGCAGATGGGGTGGAGTGG - Intergenic
912852747 1:113141147-113141169 GTGAAGGAGAAGAGAGGGAGTGG - Intergenic
913231895 1:116746869-116746891 GAGAGGGAGGAGGGGATGAGGGG - Intergenic
913576489 1:120180529-120180551 GTGAAAGTGAAGGGTTAGAGGGG + Intergenic
914558395 1:148791967-148791989 GTGAAAGTGAAGGGTTAGAGGGG + Intergenic
914614440 1:149338263-149338285 GTGAAAGTGAAGGGTTAGAGGGG - Intergenic
914747462 1:150510767-150510789 GTGGAGGAGAAAGGGTTGGGAGG - Intronic
914991461 1:152502702-152502724 GTAAAGGAGAAGTAGTTGGGAGG + Intergenic
915019797 1:152768523-152768545 GTGTGGAAGAAGGGGCTGAGAGG + Intronic
915247435 1:154566791-154566813 GTTAAGTAGAAGGTGATGAGGGG + Intergenic
915476860 1:156158143-156158165 GTGGGGGAGTAGGGGTAGAGTGG + Intronic
915524503 1:156467669-156467691 GAGATGGAGAAGGGGGTGTGAGG + Intronic
915530006 1:156497924-156497946 GTAGAGGAGAAGGGTCTGAGGGG + Intronic
916417603 1:164607177-164607199 GTGCAAGGGAAGGGGATGAGAGG + Intronic
916712872 1:167427490-167427512 GTGCAGGAGGAAGGGTGGAGTGG - Intergenic
916942877 1:169694698-169694720 GTGAAGGAGAAGTGGGGCAGGGG - Intronic
918100454 1:181368610-181368632 GAAAAGGAGATGGGGTTGGGGGG + Intergenic
918346909 1:183614678-183614700 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
918567890 1:185953059-185953081 GTGAAGGAGAAGGGGTTGAGGGG + Intronic
918567909 1:185953123-185953145 GTGAAGGAGAAGGGGTTGAGGGG + Intronic
918670120 1:187204367-187204389 GTGAAGGGGAAGGCTGTGAGTGG + Intergenic
918714608 1:187770196-187770218 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
919412442 1:197262671-197262693 GTTAAGAAGAAGGGGGTGAAGGG - Intergenic
919790771 1:201289470-201289492 ACGAAGGAGAAGGATTTGAGGGG + Intronic
919893888 1:201996384-201996406 GTGAAGGAGAGGAGGAAGAGAGG + Intronic
920441652 1:205984895-205984917 GGGAAGGAGAGGGGGCTGGGAGG - Intronic
920829156 1:209449796-209449818 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
920829192 1:209449924-209449946 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
921059481 1:211570955-211570977 GGAAAGGAGTAGGGTTTGAGAGG - Intergenic
921212210 1:212910500-212910522 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
921219252 1:212961585-212961607 GTGAAGGAGAACAGGAGGAGGGG - Intronic
921319683 1:213926617-213926639 GTGAGGGAGAAGTGCTTCAGAGG - Intergenic
921460002 1:215414730-215414752 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
921519922 1:216146538-216146560 GTGAAGGAGAAGGGGTTGAGGGG - Intronic
921733182 1:218598509-218598531 GTGAAGGAGAAGGGGTTGAGAGG + Intergenic
921733201 1:218598573-218598595 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
921733220 1:218598637-218598659 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
921925191 1:220705470-220705492 ATGTAGAAGCAGGGGTTGAGGGG + Intergenic
921954564 1:220968480-220968502 GTGAAGGAGGAGGGGTGGGCAGG + Intergenic
922048201 1:221966903-221966925 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
922048219 1:221966967-221966989 GTGAAGGAGAAGGGGTTGACGGG - Intergenic
922049759 1:221977885-221977907 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
922219830 1:223550151-223550173 GAGAAAGAGAAGGGGTTGCAGGG - Intronic
922698549 1:227744550-227744572 GGGAGGGAGAAGGGGAAGAGAGG - Intronic
922906175 1:229175316-229175338 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
922934631 1:229413471-229413493 GTGAAGGAGAAGGGGTTGAAGGG - Intergenic
923090327 1:230735690-230735712 GGGAAGGAGAAGCTGTGGAGTGG - Intergenic
923244533 1:232119102-232119124 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
923408866 1:233688361-233688383 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
923408885 1:233688425-233688447 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
923408919 1:233688550-233688572 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
923770922 1:236936865-236936887 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
923854258 1:237828924-237828946 GTGTGGGAGAAGGGGTTGGGAGG - Intronic
923962552 1:239102165-239102187 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
924180417 1:241434838-241434860 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
924543157 1:245000269-245000291 GTGATGAAGAAGGGATGGAGTGG + Intronic
924727412 1:246683325-246683347 GTGAAAAAGAAGGGGTTTAGTGG + Intergenic
1062931324 10:1354601-1354623 GCGAAGGAGAGGGGGCTCAGGGG + Intronic
1062971787 10:1654085-1654107 GGGAAGGAGCAGGCGTGGAGAGG - Intronic
1063160645 10:3415844-3415866 GAGAAGGAGAAGGGCTGTAGGGG - Intergenic
1063362893 10:5471726-5471748 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1063509823 10:6634397-6634419 GTGAAGGAGAAGGGGTTGAGTGG + Intergenic
1063509841 10:6634461-6634483 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1063929105 10:11011330-11011352 GTGAATGAGGAGGGGTCAAGTGG + Intronic
1063945360 10:11170674-11170696 GTGGAGGAGGAGGAGTTGAAGGG + Intronic
1064504700 10:16015817-16015839 GGGAAGGAGAAGGGAGAGAGAGG + Intergenic
1064664010 10:17631485-17631507 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1065204493 10:23344179-23344201 GGGAAGGAGATGGGGAGGAGGGG + Intronic
1065443408 10:25773926-25773948 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1065661672 10:28009997-28010019 GACCAGGAGAAGGGGTTGAGGGG - Intergenic
1067702517 10:48583979-48584001 GGGAAGGAGTAGGGGCAGAGGGG - Intronic
1067815918 10:49476820-49476842 GCGAAGGAGGGAGGGTTGAGAGG - Intronic
1067854470 10:49780327-49780349 GGGAAGGAGATGGGGATCAGAGG + Intergenic
1067943565 10:50676694-50676716 GGGAAGGAGCATGGGTTGACTGG + Intergenic
1068058562 10:52038552-52038574 GTGAAGGAGAAGGGGTTGAGGGG + Intronic
1068179857 10:53503750-53503772 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1068230743 10:54167660-54167682 GTGAAAGAGGAGGGGTTGAGGGG - Intronic
1068323042 10:55445022-55445044 GTGAAGGAAAAAGGATTGACTGG + Intronic
1068592551 10:58865741-58865763 GTGAAAGAGAAGGGGTTGAGGGG + Intergenic
1068592569 10:58865805-58865827 ATGAAGGAGAAGGGGTTGAGGGG + Intergenic
1069258048 10:66359322-66359344 TAGAAGGAGATGGGGGTGAGTGG + Intronic
1069308753 10:67006381-67006403 GAGAAAGAGAAGGGGTGGAGGGG - Intronic
1069436957 10:68393024-68393046 GTCTTTGAGAAGGGGTTGAGGGG - Intronic
1069779541 10:70946040-70946062 GTGGAGGGGATGGGGTTGCGGGG + Intergenic
1069915559 10:71784637-71784659 GTGATGGAGAAGGGAGTGATGGG - Intronic
1070081461 10:73192237-73192259 GTGAAGCAGTAGGAGTGGAGAGG + Intronic
1070474612 10:76819195-76819217 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1070474632 10:76819259-76819281 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1070474651 10:76819323-76819345 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1070474671 10:76819387-76819409 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1070474690 10:76819451-76819473 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1070474709 10:76819515-76819537 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1070474728 10:76819579-76819601 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1070699905 10:78594134-78594156 GTGAAGCAGAAGGAGTGGAGGGG - Intergenic
1070828914 10:79406891-79406913 GAGAAGGAGAAGGGGCTGGCTGG + Intronic
1070865045 10:79703561-79703583 GGGAAGGAGCATGGGTTGATTGG + Exonic
1070878834 10:79841692-79841714 GGGAAGGAGCATGGGTTGATTGG + Exonic
1071467633 10:85955908-85955930 GAGAAAGAGAAAGGGCTGAGGGG - Intronic
1071472292 10:85992163-85992185 GAGGAGGAGGAGGGGTTGAAAGG + Intronic
1071593603 10:86900836-86900858 GAGTAGGAGATGGGGTCGAGAGG + Intronic
1071631940 10:87225782-87225804 GGGAAGGAGCATGGGTTGATTGG + Exonic
1071645395 10:87358002-87358024 GGGAAGGAGCATGGGTTGATTGG + Exonic
1071731785 10:88255483-88255505 GAGGAGGAGTAGGGGTAGAGGGG + Intergenic
1071897939 10:90085785-90085807 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1072011529 10:91306418-91306440 GTGAAGGAGAAGGGGCTGGGAGG + Intergenic
1072233321 10:93431581-93431603 ATGAAGAGGTAGGGGTTGAGAGG - Intronic
1072272790 10:93793729-93793751 GTTAAGAAAAAGGGGTTGAGGGG - Intronic
1073043756 10:100624114-100624136 GTGATGGAGCAGGGATTGATGGG + Intergenic
1073397113 10:103227026-103227048 GTAAAGCAGTAGGGTTTGAGAGG + Intergenic
1073716115 10:106109255-106109277 GTGAGGGAGAAGGGGAAGTGAGG - Intergenic
1074317630 10:112373859-112373881 GGGAAGGAGAAGGGGTAGACAGG - Intergenic
1074324388 10:112434333-112434355 CTGAAGGAGATGGACTTGAGTGG - Exonic
1075062692 10:119267830-119267852 GTGGAGGAGCTGGGGTGGAGAGG - Intronic
1075095148 10:119466337-119466359 GTGAAGGAGAAAGCGTTAAGTGG + Intergenic
1075248500 10:120845882-120845904 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1075682559 10:124343050-124343072 GTGAGGCAGGAGGGGCTGAGGGG - Intergenic
1076033266 10:127177001-127177023 GTGAAGGAGAAGTCGTCGAGGGG + Exonic
1076512637 10:131023356-131023378 GTGAAGGAGATGGGGCTCAAGGG - Intergenic
1077369635 11:2175501-2175523 GGGAAGGAGAAGGGCTGGAGCGG + Intergenic
1077851050 11:6074811-6074833 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1077851066 11:6074874-6074896 GTGAAGGAGAAGGTGTTGAGGGG + Intergenic
1078046351 11:7916969-7916991 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1078158161 11:8816589-8816611 GTGTAGGAGAATTGGTGGAGAGG - Intronic
1079033204 11:17001032-17001054 GTGAAGGAGCTGGGGATTAGGGG - Intronic
1079290347 11:19182749-19182771 GTGAATGAGAAGAGGATGAAGGG + Intronic
1079383096 11:19956230-19956252 GTGTAGGAGAATTGGTTGTGTGG - Intronic
1079447263 11:20568800-20568822 GTGAAGGAGAAAGGGTTGAGGGG - Intergenic
1079672759 11:23188598-23188620 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1080028129 11:27633859-27633881 GTGAAGGAGAAGGGGTTGAAGGG + Intergenic
1080028148 11:27633923-27633945 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1080336867 11:31207699-31207721 GAGAAATAGAAGGGGCTGAGTGG - Intronic
1081356609 11:42121584-42121606 TTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1081713020 11:45230031-45230053 GTGAAGGGGAAGGGATTGGTAGG - Intronic
1081872155 11:46388103-46388125 GTGAAGGAGGCTGGGCTGAGCGG - Intergenic
1082097586 11:48143854-48143876 GGGAAGGAGAAGGGGAGAAGGGG - Intronic
1082736199 11:56858861-56858883 GTGATGGAGTTGGGGTTCAGGGG - Intergenic
1082956054 11:58871082-58871104 GTGAAGCAGGATGGGTGGAGAGG + Intronic
1084046954 11:66574576-66574598 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1084093087 11:66892101-66892123 AGGAAGGGGAAGGAGTTGAGAGG + Intronic
1084685600 11:70693111-70693133 GTGGAGGAGGTGGGGTAGAGAGG - Intronic
1084762213 11:71281139-71281161 GTGAAGGAATTGGGGATGAGGGG + Intergenic
1084826881 11:71738413-71738435 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1085304854 11:75479669-75479691 GTGCATGAGAAGGGGGTGGGGGG - Intronic
1085709033 11:78812547-78812569 ATGAAGGGGATGGGGTTAAGTGG - Intronic
1085987793 11:81807110-81807132 GTGAAGGAGAAGGGGTTGGGGGG - Intergenic
1086206460 11:84264024-84264046 TTGAAGAAAAATGGGTTGAGGGG - Intronic
1087058339 11:93955052-93955074 GTGAAGCATAAGGAGTTGTGAGG + Intergenic
1087089820 11:94257433-94257455 GTGAGGGATAAGGGGAAGAGAGG - Intergenic
1087196693 11:95310498-95310520 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1087196712 11:95310562-95310584 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1087314406 11:96588623-96588645 GTGAAGGAGAAAGGGTTGAGGGG - Intergenic
1087314422 11:96588687-96588709 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1087314439 11:96588751-96588773 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1087839766 11:102908933-102908955 GTGAAGGAGAAGGTGTTGAGGGG + Intergenic
1089035857 11:115390359-115390381 GAGAAGGGGAAAGGGTTGGGGGG + Intronic
1089135287 11:116244261-116244283 GAGAAGGAGAGGGGGTGGAGAGG - Intergenic
1089348896 11:117810292-117810314 GTGAAGGAGAAGGGGTTGAGGGG - Intronic
1089682184 11:120124839-120124861 GGGGAGGAGAAGGGGGTGAGGGG - Intronic
1090003329 11:122980174-122980196 GCGAAGCAGAAGGGTTTGAGGGG + Intronic
1090527005 11:127547497-127547519 GTGAAGGAGAAGGGGTTGAAGGG + Intergenic
1090546714 11:127773929-127773951 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1090700763 11:129293554-129293576 GTGTAGAGGAAGGGGTAGAGAGG - Intergenic
1090850797 11:130569022-130569044 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1090872152 11:130758166-130758188 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1090881917 11:130840610-130840632 GTGAAAGGAGAGGGGTTGAGGGG + Intergenic
1090927183 11:131259302-131259324 GTGAAGGAGAAGGGGTTGGGGGG + Intergenic
1091135536 11:133185507-133185529 GTGATGGAGATGGGGTTCGGAGG + Intronic
1091886306 12:4019529-4019551 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1091956564 12:4648956-4648978 GTGAAGGAGAGGGGGAAGAAAGG - Exonic
1092092165 12:5812230-5812252 GGGAAGGGGAAGGGGAAGAGAGG + Intronic
1092178769 12:6430177-6430199 CTGAAGCAGAAGGAGTTTAGGGG + Intergenic
1092592926 12:9967659-9967681 GTGAAGGAGAAGGGGTTGGGGGG + Intronic
1092626951 12:10337633-10337655 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1092723939 12:11467000-11467022 GTGAAGGAGAAGGGGTTGAGGGG + Intronic
1092921371 12:13234516-13234538 GAGAAGGAGAATGTGTGGAGGGG - Intergenic
1093268208 12:17026364-17026386 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1093578522 12:20763907-20763929 GTGAAGGAGAACGGGTTGAGGGG - Intergenic
1093578534 12:20763971-20763993 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1093584700 12:20821616-20821638 GTGAAGGAGAAGGGGTTGAGGGG + Intronic
1093626113 12:21349955-21349977 GGGAAGGGGAAGTGATTGAGAGG - Intronic
1093687196 12:22070491-22070513 GTGAGGGAGAAGGGGCTGGCAGG - Intronic
1093721840 12:22452427-22452449 GTGAAGGAGATTGTGTGGAGTGG - Intronic
1093824513 12:23667069-23667091 GAGAGGGAGAAGGGGAGGAGAGG + Intronic
1094155818 12:27335805-27335827 AGGAAGGAGAAGGGGAGGAGGGG + Intronic
1094316269 12:29139734-29139756 GTGAAGGAGAAGGGGCTGGGGGG + Intergenic
1094365215 12:29672642-29672664 GTGAATGAGGATGGGGTGAGAGG - Intronic
1094400459 12:30056974-30056996 GTGAAGGAGAAGGGGTTGGAGGG - Intergenic
1094400473 12:30057034-30057056 GTGAGGGAGAAGGGGTTGGGGGG - Intergenic
1094400489 12:30057094-30057116 TTGAAGGAGAATGGGTTGGGGGG - Intergenic
1094825551 12:34266591-34266613 GTGAAGGAGAAGGGGTTGAAGGG - Intergenic
1096472233 12:51886859-51886881 GTGGAGGAGAATGGGATGTGGGG + Intergenic
1096617922 12:52844748-52844770 GAGAAGGAGCTGGGGGTGAGTGG - Intronic
1096675774 12:53225006-53225028 GTAAAGGAGATGGAGTGGAGAGG - Intronic
1096804216 12:54130448-54130470 GTGAGGGTGTAGGGGTTGGGAGG + Intergenic
1097111147 12:56659183-56659205 GAGAAGGAACAGTGGTTGAGGGG + Intergenic
1097398375 12:59102807-59102829 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1097417255 12:59327931-59327953 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1097417272 12:59327995-59328017 GTGAAGGGGAAGTGGTTGAGGGG + Intergenic
1097445107 12:59661075-59661097 GTGGAGGAGAAGTGGTTGTGTGG + Intronic
1098052571 12:66470111-66470133 GGGAAGGTGAAGGGCATGAGAGG - Intronic
1098173834 12:67771335-67771357 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1098401986 12:70086215-70086237 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1098402005 12:70086279-70086301 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1098402024 12:70086343-70086365 GTGAAGGAGAAAGGGTTGAGGGG - Intergenic
1098402042 12:70086407-70086429 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1098628849 12:72704271-72704293 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1098654018 12:73006636-73006658 TTGAAGGAGAAGGGGTTAGGGGG + Intergenic
1099188499 12:79540836-79540858 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1100366326 12:93924076-93924098 GTGAAGGGTAAGGGGATTAGAGG - Intergenic
1100561071 12:95749820-95749842 GTGAAGGAGAAGGAGTTGAGGGG - Intronic
1100561086 12:95749884-95749906 GTGAAGGAGAAGGGGTTGAGGGG - Intronic
1100561105 12:95749948-95749970 GTGAAGGAGAAGGGGTTGAGGGG - Intronic
1100561124 12:95750012-95750034 GTGAAGGAGAAGGGGTTGAGGGG - Intronic
1101073021 12:101096468-101096490 GGGAAAGAGAGGGAGTTGAGAGG + Intronic
1101278634 12:103227546-103227568 GTGAAGGAGAAGCGGTTGAGGGG + Intergenic
1101406531 12:104433814-104433836 GGGAAGGAGGAGGGGGTTAGAGG - Intergenic
1102150262 12:110684814-110684836 GGGAAGGATAATGGGTAGAGGGG - Intronic
1102223925 12:111214733-111214755 GTGAACGTAAAGGGGGTGAGAGG - Intronic
1103363615 12:120368164-120368186 GAGCAGGAGGAGGGGGTGAGGGG + Intronic
1103560029 12:121788787-121788809 GTGCAGGGGCAGGGGTGGAGTGG + Intronic
1105709994 13:22998272-22998294 GGGAAGGAGAAGGGGAAGGGAGG + Intergenic
1106121513 13:26863464-26863486 GTGGATGAGAAAGGGTTTAGAGG + Intergenic
1106562883 13:30862089-30862111 GGGAAGGGGGAGGGGTTGGGGGG - Intergenic
1106943223 13:34799612-34799634 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1106943241 13:34799676-34799698 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1107075350 13:36317316-36317338 GTGAAGGAGAAGGGGTTGAGGGG - Intronic
1107220509 13:37973924-37973946 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1107220526 13:37973988-37974010 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1107435185 13:40375451-40375473 GTGAAAGAAAAGTGGTTGGGAGG + Intergenic
1107683347 13:42872132-42872154 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1107683365 13:42872196-42872218 GTGAAGGGGAAGGGGTTGAGGGG + Intergenic
1108479152 13:50849562-50849584 GGCAAGGAGAGGGGGTTGAGGGG + Intergenic
1108512784 13:51170867-51170889 GTGAAGGAGAAGGGATTGAGGGG - Intergenic
1108913629 13:55583014-55583036 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1108913647 13:55583078-55583100 TTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1108919771 13:55659784-55659806 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1108953172 13:56117249-56117271 GTGAAGGAGAAAGGGTTGAGGGG + Intergenic
1109709862 13:66146033-66146055 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1109716975 13:66231202-66231224 GTGAATTAGAAGGGGTTGAGGGG + Intergenic
1109716993 13:66231266-66231288 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1109717010 13:66231330-66231352 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1110650740 13:77938473-77938495 GTGAAGGAGAAGGGGTTGGGGGG + Intergenic
1110845113 13:80184504-80184526 GTCAAGGAGAAGGGCTTGAGGGG - Intergenic
1110976852 13:81848511-81848533 ATGGAGGAAAATGGGTTGAGAGG + Intergenic
1110978248 13:81867050-81867072 GTGAAGGAGAAGGGGTTGGGGGG - Intergenic
1111301791 13:86359165-86359187 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1111362322 13:87191131-87191153 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1111459064 13:88517594-88517616 GTGAAAGAGAGGGGGTTGAGGGG + Intergenic
1111459079 13:88517658-88517680 GTGAAGGAGAAGAGGTTGAGGGG + Intergenic
1111459097 13:88517722-88517744 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1111630264 13:90840540-90840562 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1111631914 13:90853332-90853354 GTGAAAGAGAAGGGGTTGAGGGG + Intergenic
1111772050 13:92609291-92609313 GTGAATGAGAGGGGGTTGGTTGG + Intronic
1111780976 13:92723520-92723542 GTGGATGAGAAGGGGTGTAGTGG - Intronic
1112236620 13:97643262-97643284 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1112889547 13:104212866-104212888 GTGAAGGAGAAGGGTTGGGGGGG + Intergenic
1113324085 13:109266190-109266212 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1113324104 13:109266254-109266276 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1114046777 14:18882295-18882317 GTAAAGGAGAGGGGGATGGGAGG - Intergenic
1114117436 14:19637151-19637173 GTAAAGGAGAGGGGGATGGGAGG + Intergenic
1114260112 14:21030514-21030536 GTGAAGGAGAAGGGGGAGGGAGG - Exonic
1115240794 14:31249984-31250006 ATGAAGGAGAAGGGGTTGAGGGG + Intergenic
1115240831 14:31250104-31250126 GTGAAGGGGAAGGGGTTGAGGGG + Intergenic
1115240851 14:31250168-31250190 GTGAAGGGGAAGGGGTTGAGGGG + Intergenic
1115904571 14:38191632-38191654 GTGAAAGAGAAGGGGTTGAGGGG - Intergenic
1116179451 14:41516860-41516882 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1116256995 14:42570112-42570134 GGGATGGAGAAGGGGTGGTGTGG - Intergenic
1116573272 14:46545022-46545044 GTGAAGGAGAAGGGGTTGTGAGG - Intergenic
1116613308 14:47105168-47105190 GTGAAGGAGAAGGGGCTGAGGGG - Intronic
1116952702 14:50894159-50894181 ATGAAGGAGAAGGGGTTGAGGGG - Intronic
1116952720 14:50894223-50894245 GTGAAGGAGAAGGGGTTGAGGGG - Intronic
1117693821 14:58338570-58338592 ATGAAGGAGAGGGGATGGAGGGG + Intronic
1117958128 14:61138185-61138207 GTGAAGGAAAAGGGGTTGAGGGG + Intergenic
1118329655 14:64805480-64805502 GTGAAGGAGGTGGGGTAGAGTGG - Intronic
1118754543 14:68830376-68830398 GGGAAGGAGAGGGGAGTGAGGGG - Intergenic
1118764536 14:68900954-68900976 GAGAAGGAGAAGAGGTTGAGAGG + Intronic
1119022214 14:71125278-71125300 GGGAAGGAGAAGGGGTTGTGGGG - Intergenic
1120319617 14:82942574-82942596 GTGAAGGTAAAGGGCTTAAGGGG - Intergenic
1120352725 14:83383608-83383630 GTGAAGGAGGAGAGGTAGTGGGG - Intergenic
1120537111 14:85710620-85710642 GTGAAGGTGTAGGGATTGTGTGG - Intergenic
1120757761 14:88259852-88259874 GTGTAGGAGAAGGGGTATGGTGG + Intronic
1121332826 14:93059293-93059315 GTGACGAAGCAGGGGTGGAGGGG + Intronic
1121417907 14:93791554-93791576 GTGAAGGACAAGAGGTGGAAGGG + Intergenic
1121537247 14:94699331-94699353 GGGAAGGGGTAGGGATTGAGGGG + Intergenic
1121567752 14:94923499-94923521 GTGAAGGTGGAGGGGGGGAGGGG - Intergenic
1121572981 14:94961625-94961647 GGGCAGGAGAAGGGATGGAGAGG - Intergenic
1121581048 14:95030936-95030958 GGGAAGGACAAGGGGAAGAGAGG + Intergenic
1121703414 14:95973830-95973852 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1121703431 14:95973894-95973916 GTGCAGGAGAAGGGCTTGAGGGG - Intergenic
1121703449 14:95973958-95973980 TTGAAGGAGGAGGAGTTGAGGGG - Intergenic
1121769889 14:96524512-96524534 GAGAAGGGGAAGGGGAAGAGGGG - Intronic
1121884945 14:97534503-97534525 GAGAAGGTGAAGGACTTGAGTGG + Intergenic
1122040782 14:98986172-98986194 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1122463734 14:101916706-101916728 GTGAGGGGGCAGGGGGTGAGAGG + Intronic
1122693792 14:103543286-103543308 GTGAGGGAGCAGTGGGTGAGGGG + Intergenic
1123103203 14:105819511-105819533 GAGCATGAGCAGGGGTTGAGGGG + Intergenic
1124042398 15:26117557-26117579 GTGCAGGAGAAGGGGAAGAAGGG + Intergenic
1124610006 15:31201695-31201717 GTGTAGGAGGAGTGGCTGAGGGG - Intergenic
1125045524 15:35239610-35239632 TTGAAGGAGAAGGGGTTGAGGGG - Intronic
1125045542 15:35239674-35239696 GTGAAGGAGAAGGGGTTGAGGGG - Intronic
1125045560 15:35239738-35239760 GTGAAGGAGAAGGGGTTGAGGGG - Intronic
1125131758 15:36290557-36290579 GTGAAGTAGAAGGGGTTGAGGGG + Intergenic
1125483355 15:40095446-40095468 GTGGAGGAGAAGGGGAAGAGAGG + Intronic
1125489581 15:40136683-40136705 AGGAAGGAGCAGGAGTTGAGAGG - Intergenic
1125721896 15:41849212-41849234 GGGAAGGAGATGTGGGTGAGGGG + Intronic
1125759720 15:42088353-42088375 GTGAGGGAGAAGCAGCTGAGTGG + Intronic
1125916521 15:43492910-43492932 GTGACGGGGAAGGGGTTGGAGGG - Intronic
1126357420 15:47811338-47811360 GAGAAGGGGAAGGTGCTGAGAGG - Intergenic
1126362809 15:47863613-47863635 GAGAAGGAGAAGGGGGAGAAGGG + Intergenic
1126681839 15:51209805-51209827 GAGAAGGATAAGGGGATGAGAGG + Exonic
1126737499 15:51746737-51746759 GTGTGGGAGACGGGGTAGAGTGG - Intronic
1126912590 15:53431493-53431515 GTGAAGGAGAGGGGGTTGAGGGG + Intergenic
1127316561 15:57800365-57800387 GTCAAGGAGTAGGGGTTGTGAGG - Intergenic
1127375082 15:58376864-58376886 GGGAGGGAGAGGGGGATGAGAGG + Intronic
1127597271 15:60498302-60498324 GTGATGGAGAAGCGGGTGAGGGG + Intronic
1127695921 15:61447678-61447700 GGGAGGGAGAAGGGTTTCAGGGG - Intergenic
1128687708 15:69699183-69699205 GTGCAGGAGCTGGGGTTAAGGGG - Intergenic
1128943664 15:71807776-71807798 GGGAAGGAGACGGGGCTGAGGGG - Intronic
1129355265 15:74986597-74986619 TTGAAGGAGAATGGCTTCAGTGG + Intronic
1130023767 15:80252461-80252483 CTGCAGGAGAAGGCTTTGAGAGG - Intergenic
1130108850 15:80948904-80948926 GTGAAGAAGAAGAAGTTGTGAGG + Exonic
1130643831 15:85706126-85706148 GTGAAGAGAAAGGGTTTGAGTGG + Intronic
1130808676 15:87353823-87353845 GAGGAGGAGAAGGAGTTGTGGGG + Intergenic
1130854877 15:87832154-87832176 GTGAGGGAGAAGGGGTTGAGGGG - Intergenic
1130947694 15:88561241-88561263 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1130968382 15:88714097-88714119 CTGGAGCTGAAGGGGTTGAGGGG - Intergenic
1131229143 15:90647406-90647428 GTGGAGGAGAAGGGGTGAGGGGG - Intergenic
1131434487 15:92412177-92412199 AGGAAGGAGAAGTGGGTGAGGGG + Intronic
1131447480 15:92512312-92512334 GTGAAGGAGAAAGGGTTGGGGGG - Intergenic
1131683974 15:94751709-94751731 GTGAAGGAGAAGGAGTTGAGGGG - Intergenic
1131754555 15:95545617-95545639 GAGAAGGAAAAGTGGATGAGTGG - Intergenic
1131882738 15:96876654-96876676 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1131882757 15:96876718-96876740 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1131887812 15:96937441-96937463 GTGGTGGTGAAGGGGATGAGGGG - Intergenic
1132062247 15:98701946-98701968 GTGAGGAAGATGGGGTTTAGAGG + Intronic
1132426967 15:101725585-101725607 GTGCAGGAGAAGGAGCGGAGGGG + Intergenic
1132549237 16:547529-547551 GTGGACGAGAAGGGGCTGAAGGG - Exonic
1132870159 16:2112317-2112339 GTGAGGGATGAGGGGGTGAGGGG - Intronic
1132915764 16:2342180-2342202 CTGATGGAGTAGGGTTTGAGCGG + Intergenic
1133193021 16:4148151-4148173 GTGAAGGTGAAATGGTTGATGGG - Intergenic
1133424983 16:5680633-5680655 GTGAAGGAGAAATAGTTGAGAGG + Intergenic
1133766917 16:8844466-8844488 GTGAAGGAGAAGGGGTTGGGGGG + Intronic
1133788247 16:8989484-8989506 ATGAAAGAGAAGGGGCCGAGGGG - Intergenic
1133869829 16:9676251-9676273 GTGAAGGAGAAGGGGTTGAGGGG + Intronic
1134522386 16:14924639-14924661 GTGAGGGATGAGGGGGTGAGGGG + Intronic
1134600321 16:15528697-15528719 GGGAAGGAGAGGGGGGTGGGAGG - Intronic
1134710056 16:16323290-16323312 GTGAGGGATGAGGGGGTGAGGGG + Intergenic
1134717269 16:16363290-16363312 GTGAGGGATGAGGGGGTGAGGGG + Intergenic
1134949547 16:18345355-18345377 GTGAGGGATGAGGGGGTGAGGGG - Intergenic
1134957483 16:18388869-18388891 GTGAGGGATGAGGGGGTGAGGGG - Intergenic
1135066542 16:19314914-19314936 AGGAAGGAGGAGGGGATGAGTGG + Intronic
1136615807 16:31397742-31397764 GTGAAGGAGGAGGGGCTGCTAGG + Intronic
1136628506 16:31476282-31476304 GGGAAGGGGTAGGGGTGGAGTGG - Intronic
1137477013 16:48817824-48817846 GTGAAGGAGGAAAGGTCGAGAGG + Intergenic
1137977247 16:53042256-53042278 GTGAGGGAAAAGGGGTAGGGAGG - Intergenic
1138360524 16:56424731-56424753 GGGCAGGGGAAGGGGTTAAGGGG - Intronic
1138492433 16:57384254-57384276 GTGAAGGAGAAGGTCTTGGAGGG - Exonic
1138727780 16:59159626-59159648 GTGAGGGTGACGGGGTAGAGTGG + Intergenic
1138804717 16:60079717-60079739 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1139039424 16:62983791-62983813 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1139039461 16:62983914-62983936 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1139039497 16:62984039-62984061 GTGAAGGAGAAGGGGTTGAAGGG + Intergenic
1139039534 16:62984164-62984186 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1139039634 16:62984533-62984555 GTGAAGGAAAAGGGGTTGAGGGG + Intergenic
1139226117 16:65234535-65234557 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1139546795 16:67653334-67653356 GTCAAGGAGAGGGGGTGGTGGGG + Intronic
1139924456 16:70478519-70478541 GGGCAGGAGAAGGGGTGGTGAGG - Intronic
1139943234 16:70621116-70621138 GTGAAGGAGAAGGGGTTGAGGGG + Intronic
1139943919 16:70625446-70625468 GCGAAGGAGAAGGGGTTGAGGGG + Intronic
1140195422 16:72850921-72850943 GGGAAGCAGATGGGGTTGGGGGG + Intronic
1140228895 16:73101032-73101054 GAGAATGAACAGGGGTTGAGGGG - Intergenic
1140249792 16:73286188-73286210 GTGCAGGAGGAGGGGGAGAGGGG - Intergenic
1140799906 16:78476903-78476925 GGAAAGGAGAAGGGGGAGAGGGG - Intronic
1140903175 16:79389179-79389201 GTGGTGGGGAAGGAGTTGAGTGG - Intergenic
1141460409 16:84175613-84175635 GTGAAGGAAACGGGGTTCAGGGG + Intronic
1141796494 16:86278769-86278791 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1141796514 16:86278833-86278855 GTGAAGGAGAAGGGGTCGAGGGG - Intergenic
1141796534 16:86278897-86278919 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1141796554 16:86278961-86278983 GTGAAGGAGAAGGGGTCGAGGGG - Intergenic
1141796574 16:86279025-86279047 GTGAAGGAGAAAGGGTCGAGGGG - Intergenic
1141865414 16:86746696-86746718 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1142050665 16:87956020-87956042 GTGAGGGAGTAGGGGTTTGGGGG + Intronic
1142493000 17:290570-290592 GGGAAGGAGAAGGGGTGGGACGG - Intronic
1142605539 17:1079042-1079064 GGGAAGGGGAAGGGGAGGAGGGG + Intronic
1142643058 17:1295721-1295743 GGGAAGGAGAAGGGCTGGTGGGG + Intronic
1142764173 17:2056461-2056483 GAGAAGGAGCAGGAGGTGAGCGG - Intronic
1144104415 17:11972733-11972755 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1144154118 17:12481921-12481943 GAGAAGGAACAGGGGTTGGGAGG + Intergenic
1144517066 17:15925990-15926012 GTTAAGGCGAATGGGATGAGAGG + Intergenic
1144572326 17:16407708-16407730 GGGAGGGAGATGGGGGTGAGGGG + Intergenic
1144630515 17:16869818-16869840 GTAAAGGAGAAAGGGGCGAGGGG - Intergenic
1144650806 17:17005637-17005659 GTAAAGGAGAAAGGGGCGAGGGG + Intergenic
1144696616 17:17308097-17308119 CTGAAGGAAAAGAGGTTCAGCGG + Intronic
1144732289 17:17535697-17535719 GTGAAGGGGAAGAGGCGGAGAGG + Intronic
1144750824 17:17647064-17647086 GTGAGGGGGAAGGGGATGTGAGG + Intergenic
1144807173 17:17975786-17975808 GAGAAGGGGTAGGGGTTGAAGGG + Intronic
1146057845 17:29589872-29589894 GTGAAGGGGAGGGGGCTGTGAGG - Intronic
1146573902 17:33975383-33975405 GTCTAGGACAAGGGGTTGAAAGG - Intronic
1146597660 17:34184159-34184181 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1146597679 17:34184223-34184245 GTGAAAGAGAAGGGGTTGAGGGG - Intergenic
1146657624 17:34644282-34644304 GTGAAGGAGAAAGGGAGGATGGG + Intergenic
1146908638 17:36633653-36633675 GAGAAGGAGGAGGGGAGGAGAGG + Intergenic
1146938543 17:36827345-36827367 GAGCAGGGGAAGGGGTGGAGAGG - Intergenic
1147392863 17:40121416-40121438 GGGGAGGAGAGGGGGTGGAGGGG + Intergenic
1147862794 17:43533357-43533379 GAGAAGGAGACAGGGGTGAGGGG + Intronic
1148081446 17:44969316-44969338 GTGAGGGAGGAGGAGCTGAGGGG - Intergenic
1148374606 17:47131539-47131561 GAGAAGGGGAAAGGGATGAGAGG + Intronic
1148457056 17:47816702-47816724 GTGAAGGGGAAGGGCTGAAGGGG + Intronic
1148492002 17:48029225-48029247 GGCAAGGAGAAGGGGCGGAGGGG - Intronic
1149203424 17:54215042-54215064 GTGAAGGAGGAGGAGTTCAGAGG + Intergenic
1149500542 17:57149179-57149201 GTGGAGGAGATGGGGTACAGAGG - Intergenic
1149576930 17:57720645-57720667 GTGGAGGATATGGGGTGGAGAGG + Intergenic
1149746735 17:59106424-59106446 GTGGAGGTGAGGGGGTTGTGAGG - Exonic
1150439108 17:65177248-65177270 GGGAAGGAGAGGGGGATGGGTGG - Intronic
1150455467 17:65303685-65303707 GAGAAGGAGTAGGGGGTGGGAGG + Intergenic
1151005503 17:70431510-70431532 GTGAAGAAGAATGGGTTTATAGG + Intergenic
1151278053 17:73050805-73050827 GTGAAAGGGAAGGGATGGAGTGG + Intronic
1151526925 17:74676504-74676526 GTGCAGGAGATGGGGGAGAGTGG - Intronic
1151572295 17:74932879-74932901 GAAAGGGAGAAGGGGATGAGGGG + Intronic
1151622280 17:75253589-75253611 GTGAAGGAGAAGGGGTTGAGGGG - Intronic
1151839949 17:76610575-76610597 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1155332068 18:24728622-24728644 GGGAAGGGGAAGGGATTGGGGGG - Intergenic
1155661917 18:28259442-28259464 GGGAAGCAGCAGGGGTTGACAGG - Intergenic
1155697222 18:28697816-28697838 GGGAAGGAGAAGGGGTTGAGGGG + Intergenic
1155697254 18:28697941-28697963 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1155855028 18:30822603-30822625 GAGACAGAAAAGGGGTTGAGTGG + Intergenic
1156026643 18:32662396-32662418 GTGAAGGAGAAAGGGAAGAAAGG - Intergenic
1156539428 18:37894838-37894860 CTGGAGGAGGAGGGGCTGAGTGG + Intergenic
1157152152 18:45228884-45228906 TTAAAGGAGAGGGGCTTGAGAGG - Intronic
1157301265 18:46481538-46481560 GTGAAGCACAAGGAGTTGATGGG + Intronic
1157470147 18:47982580-47982602 GAGAAGGAGAAGGGGGAGAAGGG + Intergenic
1157475522 18:48021154-48021176 GAGGAGGAGAAGGGGTAGAAGGG - Intergenic
1157476616 18:48028025-48028047 GGGAGGAGGAAGGGGTTGAGGGG + Exonic
1158209055 18:55025789-55025811 ATGAAGGAGAAGGGTTTTACTGG - Intergenic
1158336153 18:56416494-56416516 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1158336170 18:56416558-56416580 GTGAAGGAGAAAGGGTTGAGGGG - Intergenic
1158336188 18:56416622-56416644 GTGAAGGAGAAGGGATTGAGGGG - Intergenic
1158948464 18:62468632-62468654 GTGAGGGAGTGGGGGTTGGGGGG - Intergenic
1159002249 18:62984764-62984786 GTGAAGCAGGAGGGTGTGAGCGG - Intergenic
1159166628 18:64710563-64710585 GTGTTGGAGAAGGAGGTGAGTGG - Intergenic
1159782387 18:72675261-72675283 GTGAAGATGAAGGTGTTAAGAGG + Intergenic
1159834841 18:73325645-73325667 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1160063422 18:75552067-75552089 GTGGAGGAGAAGGGGGTGGGAGG + Intergenic
1160386720 18:78501423-78501445 GTGAAGAAGCAGGGGCTGTGGGG - Intergenic
1161661514 19:5549502-5549524 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1162059144 19:8084265-8084287 GTGAAGTAGAAGGCAGTGAGAGG - Intronic
1162294240 19:9802197-9802219 GCGAAGTCGGAGGGGTTGAGGGG - Intergenic
1163900503 19:20095764-20095786 GTGAAGGAGAAGGGGTTGAGGGG + Intronic
1163906819 19:20155512-20155534 GTGAAGGAGAAAGGGTTGAGGGG - Intergenic
1163906837 19:20155576-20155598 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1164123196 19:22286581-22286603 GAGAAGGGGAAGGGGCTGATTGG + Intronic
1164152765 19:22569239-22569261 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1164176987 19:22783966-22783988 GAGAAGGGGAAGGGGCTGACTGG - Intronic
1164459431 19:28434590-28434612 GTGAAGGAGAAGGGGTTGAGAGG + Intergenic
1164459445 19:28434654-28434676 GTGAAGGACAAGGGTTTGAGGGG + Intergenic
1164459456 19:28434718-28434740 GTGAAGGACAAGATGTTGAGGGG + Intergenic
1164459475 19:28434782-28434804 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1164540384 19:29117620-29117642 GGGAAGGAGAGGAGGTGGAGAGG - Intergenic
1164591961 19:29512265-29512287 AAGAAGGAGATGGGGATGAGGGG + Intergenic
1164676276 19:30103886-30103908 GGGAAGGAGAGGGGCTGGAGCGG - Intergenic
1164725096 19:30460907-30460929 GTGAAGGAGAAGGAGGTGCAAGG - Intronic
1164753300 19:30671542-30671564 GAGAAGGAGAAGGGGAAGCGGGG + Intronic
1165329802 19:35135220-35135242 GGGAAGGAGGAGGGGGTCAGAGG + Intronic
1165333529 19:35154434-35154456 AGGAAGGAGAAGGGATTGAAGGG - Intergenic
1165408104 19:35642832-35642854 GTGAAGGAAAAGGGGGCGCGGGG + Intronic
1165510499 19:36264105-36264127 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1165510531 19:36264226-36264248 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1165564158 19:36709482-36709504 GGGAAGGGGAAGGGGTGGTGGGG - Intronic
1165811190 19:38612805-38612827 GAGAAGGAGAAGGAGTTGAGGGG + Intronic
1165816388 19:38645022-38645044 GGGAAAGAGAAGGGGGTGGGAGG + Intergenic
1165835123 19:38750478-38750500 GTGAAGGAGAAGGGGTTGAGGGG - Intronic
1165835152 19:38750599-38750621 GTGAAGGAGAAGGGGTTGAGGGG - Intronic
1166117369 19:40663995-40664017 GTGAGGGAGAAGGGGGTCTGGGG - Intergenic
1166499154 19:43328272-43328294 GTGAAGGAGAAGGGGTTGAGTGG + Intergenic
1166502693 19:43353449-43353471 CTGAAGGAGGAGGGGCTGAGGGG + Intergenic
1166590239 19:43991460-43991482 GAGCAGGGGAAGGGGATGAGTGG - Intronic
1167029093 19:46945155-46945177 GGGAAGGAGGCGGGGTTGAGGGG + Intronic
1167046796 19:47054410-47054432 GTGAAGGAGAAGGGGTTGATGGG + Intergenic
1167055699 19:47110959-47110981 GTGAAGGAGAAAGGGGAAAGGGG + Intronic
1167170585 19:47828688-47828710 GTGGAGGAGAAGGGGTTAGCTGG + Intronic
1167622190 19:50566564-50566586 GAGGAGGCGAAGGGGTGGAGGGG + Intronic
1167669189 19:50839615-50839637 CTGAAGGAGGAGGGGCTGGGGGG + Intergenic
1167693597 19:51001716-51001738 GTGAGTGAGAAGGGGCGGAGGGG + Intronic
1168212329 19:54899634-54899656 GTGAAGGAGAAGGGGTTGGGGGG + Intergenic
1168286935 19:55339943-55339965 GAGGAGGAGAAGCGGGTGAGGGG + Exonic
925096556 2:1208843-1208865 GGGAAGGAGAAGGAGAAGAGGGG - Intronic
925166125 2:1716740-1716762 CTGATGGAGAAGGGGCTGGGAGG - Intronic
925295742 2:2775574-2775596 GTGTAGGTGAAGTGGTGGAGGGG + Intergenic
925544295 2:5001754-5001776 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
925829039 2:7877425-7877447 GTGAAGGAGAAGGGGCTGAGGGG + Intergenic
925829056 2:7877489-7877511 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
925829073 2:7877553-7877575 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
925829091 2:7877617-7877639 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
925829108 2:7877681-7877703 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
925829126 2:7877745-7877767 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
925829142 2:7877809-7877831 GTGAAGGAGAAGCGGTTGAGGGG + Intergenic
925829159 2:7877873-7877895 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
925929239 2:8694056-8694078 GTGACGGGGAGGGGGTGGAGGGG + Intergenic
925995422 2:9288803-9288825 GGGAAGGAGAAGGGGGTTGGAGG - Intronic
926407533 2:12570656-12570678 GTGAAGGAGAAGCGGTTGAGGGG - Intergenic
926407550 2:12570720-12570742 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
926413368 2:12627379-12627401 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
926413386 2:12627444-12627466 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
926464291 2:13168693-13168715 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
926657194 2:15420816-15420838 GTAGAGGAGAAGGGGAAGAGGGG + Intronic
926815756 2:16796654-16796676 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
927285726 2:21354970-21354992 GAAAAGCAGAAGGGGCTGAGGGG - Intergenic
927718932 2:25370870-25370892 GGGAGGGGGAAGGGGTGGAGGGG - Intergenic
928284763 2:29980189-29980211 CTGCAGAAGAAAGGGTTGAGAGG - Intergenic
928778104 2:34790770-34790792 GTGAAGGAGAAGAGGTTGGGGGG - Intergenic
928779913 2:34805750-34805772 ATGAAGGAGAAGGGGTTGGGGGG + Intergenic
928928355 2:36600074-36600096 GTGAAGGAGAAGGGGTTGAGGGG - Intronic
928947047 2:36780997-36781019 ATGAAGTAGAAGGGGTGGAGGGG - Intronic
929279858 2:40066043-40066065 GTGAGGGAGAAGGGAGGGAGGGG - Intergenic
929793292 2:45039192-45039214 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
929811394 2:45191975-45191997 GGGATGGAGAATGGGTGGAGAGG - Intergenic
929826307 2:45311479-45311501 TTGAGGGAGAATGGGCTGAGGGG - Intergenic
930089946 2:47524830-47524852 GTGAGGGAGTAGGGGCTGAGGGG + Intronic
930172419 2:48265262-48265284 GAGAAGGAGAAGGGGGTCTGTGG + Intergenic
930547184 2:52783189-52783211 GTGAAGCAGAAGTGGTTCAGAGG - Intergenic
930617072 2:53604651-53604673 GAGAAGGAGAAGTGGTTGACGGG + Intronic
930631041 2:53755732-53755754 GTGAAGAGGAAGAGGTTGAAAGG + Intronic
930752188 2:54945019-54945041 GTGAAGGAGGAGGGAAGGAGGGG - Intronic
930954888 2:57193982-57194004 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
930954907 2:57194046-57194068 GTGAAGGAGAAGGGGTTAAGGGG - Intergenic
930958206 2:57230003-57230025 ATGAAGGAGAAGGGGTTAGGAGG - Intergenic
931026586 2:58118065-58118087 GTGAAGGAGAAGGGGTTGAGGGG + Intronic
931026605 2:58118129-58118151 GTGAAGGAGAAGGGGTTGAGGGG + Intronic
931098460 2:58968734-58968756 ATGAATGAGAAGTGGTTGATTGG + Intergenic
931236669 2:60418383-60418405 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
931236687 2:60418447-60418469 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
931236702 2:60418511-60418533 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
931236721 2:60418575-60418597 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
931236737 2:60418639-60418661 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
931625546 2:64253438-64253460 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
931625564 2:64253502-64253524 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
931808747 2:65833865-65833887 GTAAAGTAGATGGTGTTGAGTGG - Intergenic
931850202 2:66244883-66244905 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
931850220 2:66244947-66244969 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
931948028 2:67332464-67332486 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
932359029 2:71089797-71089819 GCGAAGGAGAAGAGGTTGAGGGG + Intergenic
932359048 2:71089861-71089883 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
932359065 2:71089925-71089947 GCGAAGGAGAAGAGGTTGAGGGG + Intergenic
932367847 2:71164402-71164424 GTGAAGGAGAAGGAGTTGAGGGG + Intergenic
932367879 2:71164527-71164549 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
932367927 2:71164713-71164735 GTGAAGGAGAAGGGATTGAGGGG + Intergenic
932929348 2:76015468-76015490 GTCAAGGGGGAGGTGTTGAGAGG - Intergenic
932974178 2:76578673-76578695 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
933012869 2:77089283-77089305 GTGAAGGAGAAGGGGTTGAGGGG - Intronic
933079068 2:77966120-77966142 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
933180005 2:79216687-79216709 GTGAAGGAGAAGGGGTTGGGGGG + Intronic
933329720 2:80879163-80879185 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
933905950 2:86892564-86892586 GAGAAGGAGAGGGGGTAGATAGG + Intergenic
935570025 2:104649794-104649816 GTGAAAGTGGAGGGTTTGAGAGG + Intergenic
935760728 2:106318265-106318287 GGGAAGCAGCAGGGTTTGAGGGG - Intergenic
935766793 2:106375731-106375753 GAGAAGGAGAGGGGGTAGAGAGG + Intergenic
936175764 2:110218880-110218902 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
936175777 2:110218944-110218966 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
936266876 2:111017620-111017642 GAGAAGGTGAAGGCGTTGACGGG - Intronic
936366212 2:111859101-111859123 GAGAAGGAGAGGGGGTAGATAGG - Intronic
936883138 2:117279754-117279776 GTGAAGGAGAGGGGGTTGAGGGG - Intergenic
937127900 2:119485814-119485836 GGGGAGGAGAAAGGGATGAGTGG - Intronic
937818486 2:126280425-126280447 GTGAAGGAGAAGAGGATGTATGG - Intergenic
937981748 2:127619877-127619899 GGTCAGGAGATGGGGTTGAGTGG + Intronic
939083353 2:137687687-137687709 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
939960125 2:148558947-148558969 GTAAATGAGAAGGGGTTGGGTGG - Intergenic
940025916 2:149208001-149208023 GGGAATAAGTAGGGGTTGAGGGG - Intronic
941340189 2:164296801-164296823 GTGAAGGAGAAGGAGTTGAGGGG - Intergenic
941340204 2:164296865-164296887 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
941353185 2:164460129-164460151 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
941456400 2:165715208-165715230 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
941936111 2:170982416-170982438 GTGAGGGAGAAGGGGTTGAGGGG + Intergenic
942096880 2:172542744-172542766 GTGAAGGAGAAGGGGTTGGGGGG - Intergenic
942096896 2:172542804-172542826 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
942169065 2:173271822-173271844 GTGACGCAGAAGAGGTTCAGAGG - Intergenic
942183233 2:173400815-173400837 GGGAAGGAGAAAGGGAGGAGAGG - Intergenic
942390939 2:175492413-175492435 GTGAAAGAGAGGGAGGTGAGGGG + Intergenic
943806424 2:192131369-192131391 GTGAAGGAGAAGGGGTTGAGGGG - Intronic
943806441 2:192131433-192131455 GTGAAGGAGAAGGGGTTGAGGGG - Intronic
944323198 2:198372970-198372992 ATGAAGGGGAAGGGGAGGAGAGG - Intronic
944393921 2:199247896-199247918 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
944782988 2:203039344-203039366 GGGAAGGAGAAGGGGAGGGGAGG - Intronic
945153325 2:206811624-206811646 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
945173234 2:207018165-207018187 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
945394112 2:209300278-209300300 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
945844742 2:214930726-214930748 GAGAAAGAGAAGTGGTTGAATGG - Intergenic
945938087 2:215923299-215923321 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
946215218 2:218178637-218178659 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
946215248 2:218178762-218178784 GTGAAGGAGAAGGGGTTCAGGGG + Intergenic
946215279 2:218178887-218178909 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
946254517 2:218433010-218433032 GAGATGGAGAAGGGGATGGGTGG + Intronic
946609211 2:221439918-221439940 GTGAGGGTGAAAGGGTAGAGTGG - Intronic
946740832 2:222799605-222799627 GTGATGGAAAAGGAGTAGAGGGG + Intergenic
946781242 2:223194547-223194569 GTGAAGGAGAAGGGGTTGAGGGG + Intronic
946830770 2:223726241-223726263 TTGACAGAGAAGGGGTTGGGAGG + Intergenic
946924843 2:224616362-224616384 GTAAAGGGGAAAGGGTTGAAAGG + Intergenic
947379677 2:229532950-229532972 ATGGAAGAGAAGGGGTTGAGGGG + Intronic
947866242 2:233399775-233399797 GTGGATGAGAAGGGGTGCAGAGG + Intronic
947903907 2:233745743-233745765 GGCAAGCAGAAGGGGTGGAGAGG + Intronic
948018933 2:234714488-234714510 GTCAAGAAGAAGGGGTGGAATGG - Intergenic
948670349 2:239564471-239564493 GGGAAGGAGAAGGGAGTCAGAGG - Intergenic
948735057 2:239998220-239998242 GTGAAGGAGGGAGGGGTGAGGGG - Intronic
1170069076 20:12345003-12345025 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1170165692 20:13358997-13359019 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1170193388 20:13665933-13665955 GGGAAGGGGAAGGGTCTGAGAGG + Intergenic
1170325698 20:15152582-15152604 GTGAAGGTGAAGGGGTTGAGGGG + Intronic
1170820899 20:19755783-19755805 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1171361003 20:24586340-24586362 CTGATGGAGAAGGGGTTCTGTGG - Intronic
1171399391 20:24862258-24862280 CTGAGGCAGAAGGGGTTGTGGGG + Intergenic
1172119230 20:32588035-32588057 GTGAGGGAGGAGGGGTTGGAGGG + Intronic
1172847413 20:37938179-37938201 GAGAAGGGGAAGGGGTCCAGTGG + Intronic
1173101662 20:40094079-40094101 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1173118662 20:40270049-40270071 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1173118681 20:40270113-40270135 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1173183405 20:40821169-40821191 GTGATGGAGAAGAGGGTGTGGGG - Intergenic
1173273598 20:41558707-41558729 GTGACTGAGAAGGGGGAGAGAGG - Intronic
1173406258 20:42768312-42768334 GGGGAGGAGAAGGGGGAGAGAGG - Intronic
1173462772 20:43257187-43257209 TGGAAGGAGAAAAGGTTGAGGGG + Intergenic
1174553543 20:51378421-51378443 GAGCAGGAGCAGGGGATGAGAGG + Intergenic
1174709517 20:52690236-52690258 GGGAAGGAGAAGGAGAGGAGAGG - Intergenic
1174830792 20:53810547-53810569 GTGAAGGAGATGAGGGTGGGAGG + Intergenic
1174911746 20:54615507-54615529 GAGATAGAGAAGGGGTGGAGAGG + Intronic
1174913356 20:54630391-54630413 CGGAAGGGGAAGAGGTTGAGGGG + Intronic
1175043254 20:56076247-56076269 ATGAAGGAGATGGGGAAGAGAGG + Intergenic
1175232392 20:57482099-57482121 AGGAAGGAGAAGGGGAGGAGAGG + Intergenic
1175934543 20:62509045-62509067 GTGAGGGTGGAGGGGTGGAGAGG - Intergenic
1175934666 20:62509390-62509412 GTGAGGGTGGAGGGGTGGAGAGG - Intergenic
1176670966 21:9735344-9735366 GTGAGGGAGAAGGTAGTGAGAGG + Intergenic
1177100419 21:16893161-16893183 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1179387309 21:40955755-40955777 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1179455032 21:41493353-41493375 GTGAAGGGTGAGGGGGTGAGAGG + Intronic
1179523707 21:41961881-41961903 CTGAAAGAGAAGGGCTTGTGAGG - Intergenic
1179945663 21:44672728-44672750 ATGCTGGAGAAGGGGCTGAGGGG + Intronic
1180560683 22:16612262-16612284 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1180560701 22:16612326-16612348 GTGAAGGGGAAGGGGTTGAGGGG - Intergenic
1180560720 22:16612390-16612412 GTGAAGGAGAAGGCGTTGAGGGG - Intergenic
1181368553 22:22398603-22398625 GTGAATGAGAAGGGGGAGAAAGG - Intergenic
1181539626 22:23566372-23566394 GTGAGGGAGGAGGGGAGGAGGGG + Intergenic
1182113721 22:27742920-27742942 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1182113741 22:27742986-27743008 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1182415175 22:30216800-30216822 GTGAAGGAGGAGGGTGTGAGGGG + Intergenic
1183267725 22:36839604-36839626 GTGAAGGAGGAAGGGCTGGGTGG - Intergenic
1183664622 22:39240130-39240152 GTGAAGGAGCAGAGGCTGAGCGG - Intronic
1183747294 22:39699001-39699023 GTGAAGGAGGAGGAGGTGATGGG - Intergenic
1183959354 22:41402033-41402055 TTGAAGGAGCTGGGGTGGAGGGG - Intergenic
1184217462 22:43077213-43077235 GTAAAGGAGAAGGTGGTGTGAGG - Intronic
1184858495 22:47160132-47160154 GTGAAGGAGAAGGAGCGGCGGGG - Intronic
949190572 3:1244355-1244377 GTGAAGGAGAAGGGGTTGAGGGG + Intronic
949190591 3:1244419-1244441 GTGAAGGAGAAGGGGTTGAGGGG + Intronic
949190610 3:1244483-1244505 GTGAAGGAGAAGGGGTTGAGGGG + Intronic
949493498 3:4610893-4610915 GAGAAGGAGAAGGGGGGGAAGGG - Intronic
949684884 3:6557506-6557528 GTGAAAGAAAATGGGTTGAGAGG + Intergenic
949802198 3:7916023-7916045 TTGAAGGAGATGGATTTGAGGGG - Intergenic
950148687 3:10669476-10669498 GTGAAAGAGATGAGGTTGAGAGG - Intronic
950713186 3:14828474-14828496 ATGGAGGAGATGGGGTTGAAAGG + Intronic
951910505 3:27745581-27745603 TTGAAGGGAATGGGGTTGAGAGG - Intergenic
952334968 3:32396125-32396147 GTCAGGGAGCAGGGGTTGAAAGG + Intronic
952663666 3:35879096-35879118 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
952686043 3:36149398-36149420 GTGCAGGATAAGAGGTGGAGTGG + Intergenic
952895490 3:38075801-38075823 GTGAAGGAGAAGGGGTTGAGGGG + Intronic
952896735 3:38082631-38082653 GTGAAGGAGAAGGGGTTGAGGGG + Intronic
953215651 3:40915274-40915296 ATGAAGGGGAAGGGTGTGAGGGG - Intergenic
953365407 3:42340426-42340448 GAGAAGGAGGAGGGGGGGAGGGG + Intergenic
953825921 3:46251037-46251059 GTGAAGGAGAAGGGGTTGAGGGG + Intronic
953863236 3:46563233-46563255 GAGTAGAAGATGGGGTTGAGTGG - Intronic
953963326 3:47283120-47283142 CTGAGGGAAAAGGGGTCGAGCGG + Intronic
954134354 3:48575291-48575313 GTGAGGGAAGAGGGGTTGGGAGG - Intronic
954338890 3:49937731-49937753 CAGAAGGAAAAGGGGCTGAGTGG + Intergenic
954374599 3:50187675-50187697 GGCAAGGAGAGGGGGTTCAGAGG - Intronic
954619677 3:51988411-51988433 GTGAAGGAGTGGGGGTGGGGAGG + Intronic
954969469 3:54639194-54639216 GTGAAGGAGAAGGGGTTGAGGGG + Intronic
954969487 3:54639258-54639280 GTGAAGGAGAAGGGGTTGAGGGG + Intronic
955640980 3:61083639-61083661 GTGAGGGTGAAGGTGTTGGGAGG - Intronic
956885224 3:73552342-73552364 ATGAAGGAGAAAGTTTTGAGTGG - Intronic
957060111 3:75474823-75474845 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
957294991 3:78324642-78324664 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
957317531 3:78587910-78587932 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
957408937 3:79811564-79811586 GATAAGGAGAAGGTATTGAGTGG - Intergenic
958261798 3:91390693-91390715 TGGCAGGGGAAGGGGTTGAGTGG - Intergenic
958508316 3:95011651-95011673 GTGAGAGATAAGGAGTTGAGGGG + Intergenic
959139544 3:102469482-102469504 ATGAAGCAGGAGAGGTTGAGAGG + Intronic
959288577 3:104444785-104444807 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
959485973 3:106927412-106927434 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
959772077 3:110110115-110110137 GTGAAGGAGAAAGGGAAGAAAGG + Intergenic
959972480 3:112422343-112422365 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
960283074 3:115798146-115798168 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
960310347 3:116110108-116110130 GTGAAGGAGAAGGGGTTGAGGGG + Intronic
960372316 3:116855424-116855446 TGGCAGGAGAAGGGGTTGTGTGG + Intronic
960438016 3:117651189-117651211 GTGTAGGAGAAGGAGTTGGCAGG - Intergenic
960472294 3:118081705-118081727 GTCAAGGAGGAGGGCATGAGTGG - Intergenic
961164973 3:124757248-124757270 ATGAAGGGGAAGGGGTTGAGGGG + Intergenic
961293274 3:125864583-125864605 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
961711809 3:128833816-128833838 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
961730364 3:128960733-128960755 GTGAAGGAGAAGGGGTTCACGGG - Intronic
961730382 3:128960797-128960819 GTGAAGGAGAAGGGGTTGAGGGG - Intronic
961730401 3:128960861-128960883 GTGAAGGAGAAGGGGTTGAGGGG - Intronic
961880805 3:130060095-130060117 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
962599307 3:136979118-136979140 GGAAAGGAAAAGGGGTAGAGTGG - Intronic
962835546 3:139185535-139185557 GTGGGGGAGATGGGGTGGAGTGG + Intronic
962904185 3:139787182-139787204 GTGAATGAGAAGGGATTGCCTGG - Intergenic
963425021 3:145114023-145114045 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
963446108 3:145410233-145410255 GTGTAGGAGTAGGGGTGGTGTGG - Intergenic
963468414 3:145711392-145711414 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
963521415 3:146363044-146363066 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
963600124 3:147371698-147371720 AGGAAGGAGAAGAGGTTGGGTGG + Intergenic
963684094 3:148415232-148415254 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
963684113 3:148415296-148415318 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
964406873 3:156358363-156358385 GGGAAGGAGAAGGGGAAGGGAGG + Intronic
964423628 3:156530419-156530441 GTGAGGGGGCAGGGGTTGATGGG + Intronic
964436262 3:156657202-156657224 GTTATGGATAATGGGTTGAGAGG + Intergenic
964983450 3:162713449-162713471 GTGAAGGAGAAGGGGTCGGGGGG - Intergenic
965105435 3:164346871-164346893 ATGAAGGAGAAGGGGTTGATGGG + Intergenic
965262856 3:166505509-166505531 GTGAAAGAGAAGGTGTTGAAGGG + Intergenic
965286925 3:166828727-166828749 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
965336123 3:167432174-167432196 GTGAAGGAGAAGGGGTTGAGAGG - Intergenic
965672263 3:171158983-171159005 GAGAGGGAGAAGGGTATGAGAGG + Intronic
965713170 3:171577324-171577346 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
965713189 3:171577388-171577410 GTGAAAGAGAAGGGGTTGAGGGG - Intergenic
966085226 3:176062297-176062319 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
966105278 3:176326279-176326301 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
966105296 3:176326343-176326365 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
966182516 3:177199628-177199650 GGGAAGGAGAAGGGGTGGGGTGG - Intergenic
966233032 3:177670467-177670489 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
966278974 3:178208131-178208153 GTGAAGGAGAAGGGGTTGGGGGG - Intergenic
966279007 3:178208251-178208273 GTGAAGGAGAAGGGGTTGGGGGG - Intergenic
966279038 3:178208364-178208386 GTGAAGGGGAAGGGGTTGGGGGG - Intergenic
966279074 3:178208483-178208505 GTGAAGGAGAAGGGGTTGGGGGG - Intergenic
966279106 3:178208601-178208623 GTGAAGGAGAAGGGGTTGGGGGG - Intergenic
966996730 3:185289191-185289213 GTGAAGCAGACTGTGTTGAGAGG + Intronic
967212378 3:187180253-187180275 GTGAAGGAGAAGGGGTTGAGGGG + Intronic
967561192 3:190921158-190921180 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
967624874 3:191671293-191671315 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
967624893 3:191671357-191671379 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
967740271 3:192996605-192996627 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
967817086 3:193808753-193808775 GTGGAAGAGAAGGGGCTGAAAGG - Intergenic
968947862 4:3675019-3675041 GGGAAGGAGAAAGGGAGGAGGGG - Intergenic
969090684 4:4691890-4691912 GGGAAGGAAAAAGTGTTGAGCGG - Intergenic
969364411 4:6685862-6685884 CTGGAGGAGGAGGAGTTGAGAGG - Intergenic
969649074 4:8452889-8452911 GGGAAGAAGAAAGGGCTGAGAGG + Exonic
969654351 4:8487690-8487712 GTGAAGGAGAAGGGGTTGAGGGG + Intronic
969694758 4:8728304-8728326 TTGAGGGAGAAGGAGTTGCGGGG + Intergenic
969809903 4:9639817-9639839 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
970041898 4:11807293-11807315 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
970087357 4:12364750-12364772 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
970256640 4:14175282-14175304 GTGAAGAAGAAGGGGTTGGGGGG + Intergenic
971123393 4:23726734-23726756 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
971123426 4:23726859-23726881 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
971180354 4:24324265-24324287 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
971199961 4:24502158-24502180 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
971570915 4:28209947-28209969 GAGGGGGAGAAGGGGTGGAGGGG - Intergenic
971601705 4:28599949-28599971 GAGTAGGAGAAACGGTTGAGAGG - Intergenic
972366066 4:38375882-38375904 CTGAAGGGTGAGGGGTTGAGGGG - Intergenic
972825041 4:42748480-42748502 GTGAAGGAGAAGCAGTAGATGGG - Intergenic
974027499 4:56746619-56746641 GTGATGTTGAGGGGGTTGAGGGG - Intergenic
974428611 4:61769033-61769055 GTGAAGGAGAAGGGGTTGAGGGG + Intronic
974626067 4:64430179-64430201 GAGAAGCAGAAGAGGGTGAGGGG - Intergenic
975411548 4:74057808-74057830 GGGAGGGTGAAGGAGTTGAGGGG + Intergenic
975425082 4:74215746-74215768 GTGAAGAAAAAGGGGAGGAGAGG + Intronic
975865326 4:78718712-78718734 ATGAAGGAGAAGGGGTTGAGGGG + Intergenic
976579190 4:86715024-86715046 GTAAAGAAGAAGGGGAAGAGCGG + Intronic
976696317 4:87922788-87922810 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
976750149 4:88445069-88445091 GGGAAGTAGCAGGAGTTGAGGGG + Intergenic
977013163 4:91659494-91659516 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
977041825 4:92026911-92026933 ATGAAGGAGAAGGGGTTGAGGGG - Intergenic
977041843 4:92026975-92026997 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
977079454 4:92505611-92505633 GTGGAGGAGAGGGAGTTGTGAGG + Intronic
977137205 4:93320203-93320225 GTGGAGGATAAGGGGTGGACAGG + Intronic
977198635 4:94089326-94089348 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
977217321 4:94297767-94297789 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
977217337 4:94297831-94297853 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
977217356 4:94297895-94297917 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
978001326 4:103558472-103558494 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
978276382 4:106955858-106955880 GTGCAGGAGGAGGGCGTGAGAGG - Intronic
979379677 4:119994720-119994742 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
979850535 4:125566448-125566470 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
979895384 4:126149902-126149924 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
980112158 4:128645635-128645657 GTGAAGGAGAAGGGGTTGGGGGG + Intergenic
980284750 4:130768360-130768382 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
980611968 4:135171993-135172015 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
980611986 4:135172057-135172079 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
980762925 4:137260552-137260574 CTGTAGGAGACGGGCTTGAGTGG - Intergenic
981246512 4:142546787-142546809 ATGTAGTAGAAGTGGTTGAGAGG + Intronic
981524935 4:145699881-145699903 GTGAAGGAGAAGGGGTTGAGGGG - Intronic
981524954 4:145699945-145699967 GTGAAGGAGAAGGTGTTGAGGGG - Intronic
981539480 4:145833558-145833580 GTGAAGGAGAAGGGGTTGAGTGG - Intronic
981540725 4:145843881-145843903 GAGAAGGAGAAGGAGCTGAGAGG - Intronic
981951826 4:150418984-150419006 GGAAAGGAGAAGGGATTAAGAGG + Intronic
982180672 4:152746010-152746032 GTGAAGGAGAAGGGGTTGAGGGG + Intronic
982180691 4:152746074-152746096 GTGAAGGAGAAGGGGTTGAGGGG + Intronic
982434465 4:155367795-155367817 GTGAGGCAGAAGGTGCTGAGAGG - Intronic
982512067 4:156295276-156295298 GTGAAGGAGAATGGTTAGATTGG - Intergenic
982535208 4:156601180-156601202 GTGAAAGAGAAGGGGTTGAGGGG - Intergenic
982535225 4:156601244-156601266 GTGAAAGAGAAGGGGTTGAGGGG - Intergenic
983055308 4:163094234-163094256 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
983231556 4:165134265-165134287 GTGAAGGAGGAAGGTTTGAAAGG + Intronic
983360169 4:166717119-166717141 GTGAAGGAGAAGGGGTTGATGGG - Intergenic
983414916 4:167440521-167440543 GTGAAGGAGAAGGGGTTGAGAGG + Intergenic
983707489 4:170678533-170678555 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
984004556 4:174293417-174293439 GTGAAGGACAAGGGCTGGGGAGG + Intronic
984393807 4:179169549-179169571 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
984630405 4:182054669-182054691 ATGAAGGATAAGTGCTTGAGTGG + Intergenic
984700447 4:182815473-182815495 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
985390109 4:189484335-189484357 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
985435528 4:189926842-189926864 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
985582066 5:703509-703531 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
985582129 5:703756-703778 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
985582148 5:703820-703842 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
986193321 5:5516521-5516543 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
986193338 5:5516585-5516607 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
986221778 5:5774964-5774986 GAGAAGGAGAAGGGGAGGAAGGG - Intergenic
986388669 5:7264566-7264588 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
986555784 5:9008702-9008724 GTGAAGGAGGAGGGGCTGAGGGG + Intergenic
986555907 5:9009399-9009421 ATGAAGGAGAAGGGGTTGAGAGG + Intergenic
986555941 5:9009524-9009546 GTGAAGGAGAAGGGGTTGAGTGG + Intergenic
986708659 5:10471636-10471658 GTGCAGGAGAAGCTGTTGCGGGG + Intronic
986905559 5:12490802-12490824 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
986905578 5:12490866-12490888 ATGAAGGAGAAGGGGTTGAGGGG - Intergenic
986919810 5:12667328-12667350 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
987004176 5:13692444-13692466 GTGAAGGAGAACAGGTGGAGGGG - Intronic
987498325 5:18673518-18673540 GTGAAGGAGAAGAGGTTGAGGGG + Intergenic
987498342 5:18673582-18673604 GTGAAGGAGAAGGCGTTGAGGGG + Intergenic
987755568 5:22095601-22095623 GTGAAGGAGAAGGGATTGGGGGG - Intronic
987863004 5:23508924-23508946 TGGAAGGAGAAGGTGCTGAGAGG - Intronic
990204834 5:53417334-53417356 GTGGAGTGGCAGGGGTTGAGGGG + Intergenic
990737122 5:58876775-58876797 GTGAAGGAGAAGTGGGTGTTGGG - Intergenic
991220445 5:64208867-64208889 ATGAAGGAGGTTGGGTTGAGGGG + Intronic
992290626 5:75275889-75275911 GTAAATGTGGAGGGGTTGAGGGG - Intergenic
992394430 5:76358239-76358261 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
992524006 5:77587900-77587922 GTCAAGGAGAAAGGCTTCAGAGG + Intronic
993148328 5:84125909-84125931 GTGATGGGGAAGGGGATGTGGGG + Intronic
993192478 5:84699349-84699371 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
993192497 5:84699413-84699435 GTGAAGGAGAAGGGGTTGAAGGG - Intergenic
993192513 5:84699477-84699499 GTGAAAGAGAAGGGGTTGAGGGG - Intergenic
993836443 5:92824722-92824744 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
993836471 5:92824847-92824869 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
993836502 5:92824972-92824994 GGGTAGGAGAAAGGGTTGAGGGG - Intergenic
993969232 5:94396860-94396882 GAGGAGGAGAAGGGCTTAAGGGG - Intronic
994294960 5:98080132-98080154 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
994532729 5:100988913-100988935 GTGAAGGAGAAGGAGTTGAGGGG + Intergenic
994532748 5:100988977-100988999 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
994532812 5:100989224-100989246 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
994779252 5:104069407-104069429 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
994779268 5:104069471-104069493 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
995246111 5:109937358-109937380 GGGAAGGGAAAGGGGGTGAGGGG + Intergenic
996203486 5:120702401-120702423 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
996527844 5:124497993-124498015 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
996745743 5:126844689-126844711 GTGAAGGAGAAGGGGTTGAGTGG + Intergenic
997202889 5:132023446-132023468 CTGAAGGGGAATGGGGTGAGGGG - Intergenic
997486582 5:134236014-134236036 ATGAAGGAGAGGTGGTAGAGAGG + Intergenic
997769890 5:136544392-136544414 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
997769908 5:136544456-136544478 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
997772889 5:136570237-136570259 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
998367563 5:141640836-141640858 GGGAAGGAGAAGAGACTGAGGGG - Exonic
998458725 5:142293799-142293821 GTGGGGGAGAGGGGGTTGAGCGG + Intergenic
998996593 5:147873568-147873590 GTGAAGGAGAAGGGGTTGAGGGG + Intronic
999007206 5:147996273-147996295 ATGGAGGAGGAGTGGTTGAGTGG + Intergenic
999216498 5:149940044-149940066 GTGAAGCAGTAGGAGTGGAGGGG + Intronic
999368510 5:151038579-151038601 GTGGAGGAGCACGGGCTGAGGGG - Intronic
999398848 5:151249125-151249147 GGGAAGTAGCAGGAGTTGAGGGG - Intronic
999619072 5:153454411-153454433 GTGAAGGAGAAGGGGTTGAAGGG + Intergenic
1000376742 5:160589632-160589654 GTGAGGGAGATGGTGTTGATTGG + Exonic
1000813759 5:165894204-165894226 GGGATGGGGATGGGGTTGAGGGG - Intergenic
1000935876 5:167302703-167302725 GTGAAGGAGAAGGGGTTGGGGGG + Intronic
1000981463 5:167821026-167821048 GTGAAGGAAAAGGTGGGGAGTGG + Intronic
1001332606 5:170772790-170772812 GTGGAGGGGAAGGGGTTTATGGG + Intronic
1001396284 5:171421230-171421252 ATGAAGGAAAAAGGGTTGGGGGG + Intronic
1001686801 5:173599450-173599472 GTAAAGCAGAAGGGGTGGCGGGG + Intergenic
1001897185 5:175392645-175392667 GTGATGGAGGTGGGGTTGGGGGG - Intergenic
1002423604 5:179163275-179163297 TTGAAGGAGAAAGGGTACAGAGG + Intronic
1002611175 5:180419444-180419466 GCGAAGGAGAAGGGGTTGAGGGG + Intergenic
1003067531 6:2916384-2916406 GGGAAGGAAAAGGAGCTGAGTGG + Intergenic
1003367432 6:5488612-5488634 GTGAAAGAGAATGGGTTTAATGG + Intronic
1003430370 6:6032499-6032521 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1003430388 6:6032563-6032585 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1003430407 6:6032627-6032649 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1003773637 6:9335732-9335754 GGGAAGCAGGAGGGGTTGAGAGG - Intergenic
1004283775 6:14301824-14301846 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1004511962 6:16290516-16290538 GTGCTGGAGAAGTGTTTGAGAGG + Exonic
1005014885 6:21366257-21366279 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1005029427 6:21494903-21494925 TAGAAGGAGAAGGGGAAGAGGGG - Intergenic
1005136129 6:22570709-22570731 GGGAAGCAGGAGGGGTGGAGAGG - Exonic
1005736122 6:28748264-28748286 ATGAGGGAGCAGGGGTTGGGGGG - Intergenic
1006368093 6:33627849-33627871 GTGATGGAGAAGGGATGAAGTGG + Intronic
1007130261 6:39465865-39465887 GTGAAGGAGAAGAGGATTTGAGG - Intronic
1007425738 6:41744749-41744771 ATGAAGGAGAAGGGCTTGCTGGG - Exonic
1007530421 6:42536915-42536937 GTCCAGGAGAAGATGTTGAGAGG + Intergenic
1007756483 6:44102854-44102876 GTGAAGGAGAATGGGGTAGGGGG - Intergenic
1008476331 6:51939221-51939243 GTGAAGGAGAAGGGGTTGGGGGG - Intronic
1008850438 6:56015582-56015604 GTGAAGGAGAAGGGGTTGGAGGG + Intergenic
1008850471 6:56015703-56015725 GTGAAGGAGAAGGGGTTGGGGGG + Intergenic
1008850502 6:56015822-56015844 GTGAAGGAGAAGGGGTTGGGGGG + Intergenic
1008964857 6:57304616-57304638 GAGGAGGAGGAGGTGTTGAGTGG + Intergenic
1008966675 6:57319701-57319723 GTGAGGGAGCAGGTGTGGAGTGG + Intronic
1008993362 6:57629451-57629473 TGGCAGGGGAAGGGGTTGAGTGG + Intronic
1009181967 6:60528540-60528562 TGGCAGGGGAAGGGGTTGAGTGG + Intergenic
1009359168 6:62792565-62792587 GTGAAGGAGAAGGGGTTGGGGGG - Intergenic
1009751815 6:67885622-67885644 GTGAAGGAAGAAGGGTTGAGAGG + Intergenic
1010586921 6:77665316-77665338 GTGAAAGATAAGGGGTTGAGGGG + Intergenic
1010586940 6:77665380-77665402 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1010586959 6:77665444-77665466 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1010827124 6:80487137-80487159 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1010894816 6:81350169-81350191 GTGAAGGAGAGGGGGTTGAGGGG + Intergenic
1011771148 6:90674893-90674915 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1012014598 6:93834802-93834824 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1012315590 6:97780496-97780518 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1012553414 6:100484798-100484820 GGGGTGGAGAAGGGGTTGATAGG - Intergenic
1012671594 6:102055398-102055420 ATGAAGGAGAAATGGTGGAGGGG + Exonic
1012689306 6:102293648-102293670 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1012689324 6:102293712-102293734 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1012689341 6:102293776-102293798 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1013747490 6:113362988-113363010 GTGTGGGAGAGGGAGTTGAGGGG - Intergenic
1013747813 6:113366604-113366626 GAGAAGAAGAAGGAGCTGAGTGG + Intergenic
1013843960 6:114427365-114427387 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1013891481 6:115032844-115032866 GTGAAAGAGAAGGGGTTGAGGGG - Intergenic
1014360399 6:120467123-120467145 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1014455085 6:121625165-121625187 GTGAAAGAGAAGGGGTTGAGGGG + Intergenic
1014455104 6:121625229-121625251 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1014455120 6:121625293-121625315 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1014555629 6:122840804-122840826 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1014718395 6:124891387-124891409 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1014718414 6:124891451-124891473 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1014794213 6:125706630-125706652 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1014794228 6:125706694-125706716 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1015266532 6:131296465-131296487 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1015269432 6:131324295-131324317 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1015271159 6:131339862-131339884 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1015271177 6:131339926-131339948 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1015323611 6:131902603-131902625 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1015462870 6:133512946-133512968 GTGTAAGAGGAGGGGTTGACTGG + Exonic
1015619709 6:135118377-135118399 TTGAAGGTGAAGAGGTTAAGTGG - Intergenic
1015866033 6:137727675-137727697 GAGAAGTAGAAGGGGTTTGGAGG + Intergenic
1016204327 6:141453771-141453793 GTGAAGGAGAAGGGGTTTGAGGG - Intergenic
1016248611 6:142016655-142016677 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1016437823 6:144056063-144056085 GGGATGGAGAAAGGGATGAGGGG - Intronic
1016518594 6:144924155-144924177 CTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1016518627 6:144924280-144924302 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1016560688 6:145392544-145392566 GGCAAGGAGAAGGGTTGGAGGGG - Intergenic
1016650501 6:146455159-146455181 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1016650582 6:146455467-146455489 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1017919448 6:158858430-158858452 TTGAAGGAGAACGTGTTCAGTGG - Intergenic
1018152620 6:160954598-160954620 GAGGAGGAGAAGGGGGTGAGCGG - Intergenic
1018597297 6:165495329-165495351 GAGAAGGAGAGGGGGTGGAGGGG + Intronic
1020315825 7:6904732-6904754 GTGAAGGAGAAGGGGTTGAGCGG - Intergenic
1020343439 7:7137518-7137540 GGGAAGGAGAAGAATTTGAGTGG + Intergenic
1020532949 7:9358258-9358280 GTGAAGGAGAAGGGGTTGAGTGG + Intergenic
1020611132 7:10400145-10400167 GTGAAGCAGTATGTGTTGAGTGG + Intergenic
1020672213 7:11130576-11130598 GGGAAGGAGGAAGGGATGAGGGG - Intronic
1021637098 7:22704267-22704289 GTGAAGGAGAAGGGGTTGGGGGG - Intergenic
1021658496 7:22895273-22895295 GAGAAGCAGATGGGGTTGGGAGG - Intergenic
1021732288 7:23607795-23607817 TTGAAGGGGAAGGGGTGAAGGGG - Intronic
1021810447 7:24397245-24397267 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1021978060 7:26028738-26028760 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1021978079 7:26028802-26028824 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1022098031 7:27152929-27152951 GTGAAGGTCCAGGGGTTGTGCGG - Intergenic
1022263787 7:28733371-28733393 GTGGAGGAGAAGGGGCTGGTAGG - Intronic
1022372680 7:29785938-29785960 GTGAAGGAGAAGGGGTTGGGGGG - Intergenic
1022710223 7:32842469-32842491 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1022735433 7:33071338-33071360 GAGAAGGAGCAGGGGTGGTGTGG - Intergenic
1022854114 7:34298703-34298725 GATAAGGGGAAGGGGTGGAGGGG + Intergenic
1022854918 7:34304556-34304578 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1023028705 7:36074612-36074634 GGGATTGAGAAGGGGTCGAGGGG + Intergenic
1023562568 7:41491184-41491206 GGGAAGGAGAAGGGGCTGTGAGG - Intergenic
1023699103 7:42875350-42875372 CTGAAGGAGAAGGGGTTGAGAGG + Intergenic
1023699121 7:42875414-42875436 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1024216417 7:47252963-47252985 GGGAAGAAGAAGAGGTTTAGTGG - Intergenic
1024697363 7:51870818-51870840 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1024697382 7:51870882-51870904 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1024697401 7:51870946-51870968 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1024697419 7:51871010-51871032 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1025950104 7:66138474-66138496 GTGAAGCAGTAGGAGTAGAGGGG - Intronic
1026011505 7:66639744-66639766 TTGGAGGAGAAGGGGTGCAGTGG - Exonic
1026976050 7:74499122-74499144 GTGAATGAGTAGGGGTGGTGAGG + Intronic
1027825565 7:83110815-83110837 GTGGAGGAGATGGGTTTGACAGG - Intronic
1028433544 7:90775725-90775747 GAGAAGGAGAAGAGGAGGAGAGG - Intronic
1028465360 7:91145506-91145528 TTGAGGGAGAAGGGGTGGAGGGG - Intronic
1029540428 7:101179472-101179494 GTGGAGGGGAAGGGGTCAAGGGG + Intronic
1029951992 7:104595994-104596016 GGGAAGCACAAGGGGTTGGGGGG - Intronic
1030464139 7:109878349-109878371 AGGAGAGAGAAGGGGTTGAGGGG - Intergenic
1030751680 7:113238144-113238166 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1030751699 7:113238208-113238230 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1030951514 7:115795950-115795972 GTGAAGGAGAAGAGGAAGCGGGG - Intergenic
1031004469 7:116456550-116456572 GTGAAGGAGAAGGGGTTGAGGGG - Intronic
1031058493 7:117021511-117021533 GCTAGGGAGAAGGGGTTTAGGGG + Intronic
1031355427 7:120781923-120781945 GTGAAGGAGAAGGGGTTGGGGGG + Intergenic
1031399813 7:121316715-121316737 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1031500362 7:122507157-122507179 GTGACAGAGAATGAGTTGAGGGG + Intronic
1031525335 7:122817717-122817739 GTGAAGGAGAAGGGGTTGAGGGG - Intronic
1031728140 7:125263620-125263642 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1031777114 7:125918519-125918541 GTGAAGGGGCAGGGGTTGAGGGG - Intergenic
1031866028 7:127039749-127039771 GGGAAGGAGAAGGGTAAGAGAGG + Intronic
1032142487 7:129345299-129345321 CTGAAGGTGAAGAAGTTGAGGGG + Intronic
1033027659 7:137791816-137791838 GTGAGGGGGAAAGGATTGAGTGG - Intronic
1033676171 7:143541948-143541970 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1033695662 7:143787491-143787513 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1033843635 7:145404621-145404643 GAGAAAGAGAGGGTGTTGAGTGG - Intergenic
1034085012 7:148314641-148314663 GTGAAGGAGAAGGAGTTGGGGGG + Intronic
1034422169 7:150995891-150995913 GAGAGGGAGGAGGGGTTTAGGGG - Intronic
1034422234 7:150996056-150996078 GAGAAGGAGGAGGGGTGCAGAGG - Intronic
1034422260 7:150996122-150996144 GAGAAGGAGGAGGGGTGCAGGGG - Intronic
1034857235 7:154563279-154563301 GTGAAGCAGATGGGACTGAGGGG + Intronic
1035081948 7:156223611-156223633 GAGAAGGAGATGGGGAGGAGAGG - Intergenic
1035240008 7:157523397-157523419 GTGAAGGTGAGGGCGTGGAGCGG + Intergenic
1035571755 8:676944-676966 GTGAAGGGAAAGCGCTTGAGTGG - Intronic
1036167177 8:6446909-6446931 GGTAAGTAGAAGGGGGTGAGGGG + Intronic
1036184898 8:6614384-6614406 CTGGAGGAGATGGGGGTGAGGGG - Intronic
1036281248 8:7403277-7403299 GTGAAGGAGAAGGGGTTGAAGGG - Intergenic
1036340218 8:7908295-7908317 GTGAAGGAGAAGGGGTTGAAGGG + Intergenic
1036371921 8:8169563-8169585 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1036472567 8:9064224-9064246 GTGAAGGAGAAGGGGGGTTGGGG + Intronic
1036639245 8:10572061-10572083 GAGAAGGAGAAGGGGTTGAGGGG - Intergenic
1036878983 8:12496080-12496102 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1038042632 8:23737982-23738004 GGGAAGGGGAAGGGGTGGGGAGG - Intergenic
1038669280 8:29569417-29569439 GTGAGGGGGAAAGGGCTGAGAGG - Intergenic
1038729287 8:30112939-30112961 GTGCAGGAGTAGGGGTAGGGAGG - Intronic
1039410215 8:37348807-37348829 GTGATGGAGGAGAGGTAGAGAGG - Intergenic
1039845134 8:41320646-41320668 GAGAAGGAGATGGGGGAGAGAGG - Intergenic
1042181411 8:66091388-66091410 AAGAAGGAGGAGGAGTTGAGGGG + Intronic
1042453304 8:68973967-68973989 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1043314497 8:78903326-78903348 GAGAAAGAGCAGAGGTTGAGGGG - Intergenic
1043837488 8:85063788-85063810 GTGAAGGAGAAGCGGTTGAGGGG - Intergenic
1043990400 8:86746071-86746093 GAGAAGGAGGAGTGGCTGAGGGG - Intergenic
1044148700 8:88746853-88746875 GTGAAGGAGAAGGGGTTGAAGGG + Intergenic
1044258813 8:90094866-90094888 GTGAAGGAGAAGCAGTTGAGGGG + Intronic
1044416846 8:91948907-91948929 GTAAAGGAGAAGGGGTTGAGGGG - Intergenic
1044416883 8:91949032-91949054 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1044872113 8:96629542-96629564 TAGAAGAAGAAGGGGTTGGGGGG + Intergenic
1044921745 8:97176000-97176022 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1044921779 8:97176124-97176146 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1044924926 8:97201821-97201843 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1044924944 8:97201885-97201907 GTGAAAGAGAAGGGTTTGAGGGG - Intergenic
1045197261 8:99944661-99944683 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1045407701 8:101883393-101883415 CTGATGGAGAAGGAGCTGAGCGG - Intronic
1045644580 8:104286950-104286972 GTGAAGGAGAAGGGGGTTGAGGG - Intergenic
1046038225 8:108870870-108870892 GGGAAGGAGAAGAGATGGAGGGG - Intergenic
1046239565 8:111473190-111473212 GTGAAGAAGCACGGGTTGAGTGG + Intergenic
1046293910 8:112196825-112196847 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1046386582 8:113514368-113514390 GTGAAGGAGAAGGGGTTGATGGG + Intergenic
1046439844 8:114242592-114242614 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1046442978 8:114282684-114282706 GTGAAGGCGAAGGGGTTGAGGGG - Intergenic
1046442995 8:114282748-114282770 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1046511878 8:115213240-115213262 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1046559067 8:115815602-115815624 GTGAAGGAGAAGGGATTGAGGGG - Intergenic
1046656554 8:116900903-116900925 GGGAGGGAGAAGGGTTTGAAGGG + Intergenic
1047699131 8:127432672-127432694 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1047829738 8:128616608-128616630 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1048165901 8:132061302-132061324 GGGGAGGAGAAGGGGGAGAGAGG - Intronic
1048168637 8:132084918-132084940 GTGAAGGAGAAGGGGTTGAGGGG + Intronic
1048168656 8:132084982-132085004 GTGAAGGAGAAGGGGTTGAGGGG + Intronic
1048250967 8:132866614-132866636 GAGAAGGAGAAAGGGTAGGGTGG + Intergenic
1048417617 8:134243908-134243930 GGGAAGGAGAAGGGGAGGAGAGG + Intergenic
1048585633 8:135771890-135771912 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1048764430 8:137829531-137829553 GTGAAGGAGAAGGAGTTGAGGGG + Intergenic
1048764448 8:137829595-137829617 GTGAAGGAGACAGGGTTGAGGGG + Intergenic
1049038135 8:140092626-140092648 GGGAAAGAGAAGTGCTTGAGGGG - Intronic
1049293564 8:141817498-141817520 ATGAAGGAGAAAGGGTGGGGAGG - Intergenic
1049474448 8:142790304-142790326 GTGCAGGTGAGGGGGCTGAGAGG - Intergenic
1050935890 9:11393889-11393911 GTAAATGAGGAGGGGTAGAGTGG + Intergenic
1051052413 9:12949313-12949335 GTGAAGAAGAAGGGGTTGAGGGG - Intergenic
1051193566 9:14538921-14538943 GTGAAAGAGGTGGGGTTGGGAGG - Intergenic
1051336469 9:16070528-16070550 AGGCTGGAGAAGGGGTTGAGGGG + Intergenic
1051849500 9:21490424-21490446 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1052364592 9:27597636-27597658 GTGATAGAGAAGGGGCTCAGGGG - Intergenic
1052444107 9:28537341-28537363 ATGAAGGGGAAAGGGATGAGAGG - Intronic
1052653093 9:31327295-31327317 GTGAAGGAGAAGGGGTTGGGGGG - Intergenic
1052813423 9:33081522-33081544 GTTAAGGAAAAGAGGTGGAGGGG + Intergenic
1052918106 9:33939738-33939760 GGGAGGGAGAAGGGGGGGAGGGG + Intronic
1053057755 9:35004245-35004267 GTGAAGGAGAAGGGGTTGGGGGG - Intergenic
1053195031 9:36110812-36110834 GTGGAGGAGAAGTGGAGGAGAGG + Intronic
1055232823 9:74086569-74086591 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1055232842 9:74086633-74086655 GTGAAAGAGAAGGGGTTGAGGGG - Intergenic
1055347926 9:75356491-75356513 GTGAAGGAGAAGGGATTGGGGGG + Intergenic
1055626478 9:78181644-78181666 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1055809822 9:80138278-80138300 GTGAAGGAGAAGAGGTTGAGTGG - Intergenic
1055881540 9:81009966-81009988 CTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1056044919 9:82705275-82705297 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1056044941 9:82705339-82705361 GTGAAGGGGAAGGGGCTGAGGGG + Intergenic
1056060963 9:82884793-82884815 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1056323616 9:85459383-85459405 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1056437438 9:86587990-86588012 GTGAAGGAGAAGGGTTTGAGGGG + Intergenic
1056437456 9:86588054-86588076 GTGAACGAGAAGGGGTTGAGGGG + Intergenic
1056437474 9:86588118-86588140 ATGAAGGAGAAGGGGTTGAGGGG + Intergenic
1056437493 9:86588182-86588204 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1056437512 9:86588246-86588268 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1056437531 9:86588310-86588332 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1056522226 9:87411878-87411900 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1056829276 9:89901420-89901442 GAGAAGGAAATGGAGTTGAGAGG + Intergenic
1056919111 9:90770571-90770593 GTGAAGCAGAAGGTAGTGAGGGG + Intergenic
1057147865 9:92770524-92770546 GGGAGGGAGAGGGGCTTGAGGGG + Intergenic
1057195911 9:93115592-93115614 GTGAGGGAGAAGGTGAGGAGGGG + Intergenic
1057234614 9:93348526-93348548 GTGAAGGAGAAGGGGTGGAGGGG - Intergenic
1057355673 9:94329038-94329060 GGGAAGGAGCATGGGTTGATTGG - Intergenic
1057377771 9:94540794-94540816 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1057652086 9:96928588-96928610 GGGAAGGAGCATGGGTTGATTGG + Intronic
1057683704 9:97215433-97215455 GTGAAGGGGAAGGGGTTGAGGGG - Intergenic
1057683725 9:97215497-97215519 GTGAAGGGGAAGGGGTTGAGGGG - Intergenic
1057981772 9:99670708-99670730 TTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1057981788 9:99670772-99670794 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1058026452 9:100145551-100145573 GTGAAGGAGAAGGGGTTGGGGGG + Intronic
1058612208 9:106789230-106789252 GTGATGGAGAAGGGGTTGAGAGG - Intergenic
1058858563 9:109091075-109091097 GTGAAGGGGAAGTGGGTGAAGGG + Exonic
1058919124 9:109596632-109596654 GTGGAGGAGAAGGGATGGACTGG + Intergenic
1059546366 9:115179359-115179381 GTGAAAGAGAAGGGGTTGAGGGG + Intronic
1059574382 9:115474242-115474264 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1059574400 9:115474306-115474328 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1059574417 9:115474370-115474392 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1059606916 9:115843919-115843941 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1059863697 9:118490388-118490410 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1059897125 9:118878807-118878829 GAGGAAGAGAAGGGGATGAGGGG - Intergenic
1060299103 9:122363645-122363667 GAAAAGGAGAAGGAGATGAGAGG + Intergenic
1060738112 9:126079446-126079468 TTAAAGGAGAAGAGGTTGAGGGG + Intergenic
1061403757 9:130382650-130382672 GTGGGGGAGAGGGGGCTGAGGGG - Intronic
1061493002 9:130956653-130956675 GTGATGGAGATGGGGTTGTGGGG + Intergenic
1061889965 9:133613783-133613805 GAGGAGGAGATGGGGCTGAGAGG + Intergenic
1062050891 9:134446563-134446585 GTGAGGGGGAAGGAGTTGGGGGG - Intergenic
1062268475 9:135698226-135698248 CTGAAGGAGACGGGGATGACAGG + Intronic
1185835923 X:3346018-3346040 GGGAAGGAGAGGGGGAAGAGAGG + Intronic
1185858768 X:3559034-3559056 GGGAAGGAGAAGGGGTTGAGGGG + Intergenic
1185960866 X:4545050-4545072 GTGAAGGAGAAGGGGTTAAGGGG + Intergenic
1185960886 X:4545114-4545136 GTGAAGGAGAAGGGGTTGGGGGG + Intergenic
1185960905 X:4545180-4545202 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1185990853 X:4892598-4892620 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1186135928 X:6520780-6520802 TTGGAGGGGGAGGGGTTGAGGGG + Intergenic
1186170886 X:6875403-6875425 GTGTGGGAGATGGGGGTGAGAGG - Intergenic
1186266440 X:7839251-7839273 GAGAAGGAGAAGGGGGAAAGAGG + Intergenic
1186397564 X:9225185-9225207 GTGAAGGAGAAAGGCATGGGGGG - Intergenic
1186452565 X:9685616-9685638 GTGAAGGAGAAAGGTTTGTAAGG - Intronic
1186783860 X:12940825-12940847 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1187260278 X:17679172-17679194 GTTAGAGAGAAGGGGTAGAGAGG - Intronic
1188235413 X:27724091-27724113 GTGCAGTAGAATGGGTTAAGAGG + Intronic
1188463595 X:30453843-30453865 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1190214007 X:48468346-48468368 GGGAAGGAGAGGGGGTGGCGCGG - Intronic
1190239250 X:48644589-48644611 GAGAAGGAGAAGGGGAGGAAGGG - Intergenic
1190440306 X:50469861-50469883 GGGAATGGGAAGGGGTTGGGAGG - Intronic
1190527487 X:51342562-51342584 GGGAAGGAAAACGGGCTGAGAGG + Intergenic
1191875144 X:65788132-65788154 GTGACTGAGAAGGGGTTGAGGGG - Intergenic
1192046960 X:67686159-67686181 ATGAGGGAGAAGGGGGAGAGAGG - Intronic
1194186444 X:90778020-90778042 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1194234990 X:91372279-91372301 GTTGAGGAGCAGGGGTTCAGTGG - Intergenic
1194285093 X:92000545-92000567 TTGAAGGATAAGTGCTTGAGGGG - Intronic
1194293823 X:92104931-92104953 GTGAAGGAGAAGGGGTTGAGGGG + Intronic
1194308752 X:92277795-92277817 GTGAAGGAGATGGGGTTGAAGGG + Intronic
1194351064 X:92825431-92825453 GTGAAGGAGAGGGGGTTGAGGGG - Intergenic
1194351084 X:92825495-92825517 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1194401556 X:93443213-93443235 GTGAAGAAGTAGGTGTTGAGTGG + Intergenic
1194785597 X:98080288-98080310 ATGAAGGAGCATGGGTTGATTGG + Intergenic
1194809634 X:98374888-98374910 GTGAAGGAGAATGGATTTATTGG + Intergenic
1194822975 X:98528999-98529021 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1194822994 X:98529063-98529085 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1195701399 X:107708312-107708334 GAGAAGGAAATGGGGTTGGGGGG + Intergenic
1196006373 X:110841780-110841802 GAGAAGGAGAAGGGGGAGAGAGG - Intergenic
1196072848 X:111544796-111544818 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1196165287 X:112531391-112531413 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1196165318 X:112531516-112531538 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1196299805 X:114040977-114040999 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1196341975 X:114606234-114606256 GTGAAGGAGAAGGGCTTGAGGGG + Intronic
1196525694 X:116725674-116725696 GTGAAGGAGAAGGGGTTGGGGGG + Intergenic
1196533745 X:116817202-116817224 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1196533764 X:116817266-116817288 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1196572313 X:117280248-117280270 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1196774065 X:119322471-119322493 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1197064696 X:122223004-122223026 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1197352264 X:125393554-125393576 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1197694487 X:129536462-129536484 GTGAAGAATAAGAGGTTGTGTGG - Intergenic
1198722376 X:139636549-139636571 GTGAGGGAGGAGGGGATGGGAGG + Intronic
1198770912 X:140129056-140129078 GAGAAGGAGAAAAGGTTGGGTGG - Intergenic
1199514986 X:148665974-148665996 GTGAAGCAGGATGGGTTGAATGG + Intronic
1199563331 X:149187470-149187492 GGGAAGGAGAATGGGGTGTGGGG - Intergenic
1199576244 X:149316581-149316603 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1199576276 X:149316706-149316728 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1199582354 X:149372920-149372942 GGGAAGGAGAAGGGAGAGAGGGG + Intergenic
1199692115 X:150316645-150316667 GGGATGCATAAGGGGTTGAGAGG - Intergenic
1199787160 X:151115885-151115907 GGGATGGAGAAGGGGGTGACAGG + Intergenic
1200533044 Y:4360096-4360118 GTGAAGGAGAAGGGGTTGAGGGG + Intergenic
1200602662 Y:5225089-5225111 TTGAAGGATAAGTGCTTGAGGGG - Intronic
1200611340 Y:5329472-5329494 GTGAAGGAGAAGGGGTTGAGGGG + Intronic
1200659393 Y:5942111-5942133 GTGAAGGAGAGGGGGTTGAGGGG - Intergenic
1200659413 Y:5942175-5942197 GTGAAGGAGAAGGGGTTGAGGGG - Intergenic
1201115683 Y:10833555-10833577 CTGAATGGGAAGGAGTTGAGTGG - Intergenic
1201176759 Y:11314583-11314605 GTGAGGGGGAAGGGGTGAAGGGG - Intergenic
1201176766 Y:11314598-11314620 ATGAAGAGGAAGGGGGTGAGGGG - Intergenic
1201936862 Y:19419430-19419452 GTGAAGAAGAAGGGGTTGAGTGG - Intergenic
1202076761 Y:21044175-21044197 GTGAAAGAGAAGGGGTTGAGGGG + Intergenic