ID: 977217322

View in Genome Browser
Species Human (GRCh38)
Location 4:94297786-94297808
Sequence GGGGTACTTGCCCCTGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 146, 1: 46, 2: 15, 3: 24, 4: 226}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977217310_977217322 25 Left 977217310 4:94297738-94297760 CCCTAGAAAAGCAGGACTTGCCG 0: 13
1: 152
2: 413
3: 413
4: 271
Right 977217322 4:94297786-94297808 GGGGTACTTGCCCCTGCCCCAGG 0: 146
1: 46
2: 15
3: 24
4: 226
977217309_977217322 26 Left 977217309 4:94297737-94297759 CCCCTAGAAAAGCAGGACTTGCC 0: 31
1: 190
2: 354
3: 230
4: 230
Right 977217322 4:94297786-94297808 GGGGTACTTGCCCCTGCCCCAGG 0: 146
1: 46
2: 15
3: 24
4: 226
977217311_977217322 24 Left 977217311 4:94297739-94297761 CCTAGAAAAGCAGGACTTGCCGC 0: 68
1: 346
2: 425
3: 284
4: 202
Right 977217322 4:94297786-94297808 GGGGTACTTGCCCCTGCCCCAGG 0: 146
1: 46
2: 15
3: 24
4: 226
977217308_977217322 27 Left 977217308 4:94297736-94297758 CCCCCTAGAAAAGCAGGACTTGC No data
Right 977217322 4:94297786-94297808 GGGGTACTTGCCCCTGCCCCAGG 0: 146
1: 46
2: 15
3: 24
4: 226
977217316_977217322 5 Left 977217316 4:94297758-94297780 CCGCTAAGGGTGAAGGAGAAGGG 0: 344
1: 216
2: 67
3: 432
4: 346
Right 977217322 4:94297786-94297808 GGGGTACTTGCCCCTGCCCCAGG 0: 146
1: 46
2: 15
3: 24
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977217322 Original CRISPR GGGGTACTTGCCCCTGCCCC AGG Intergenic
900125141 1:1065500-1065522 CGGGCACTTGCCCCAGCCCCAGG - Intergenic
900171879 1:1273396-1273418 GGGACACTTGCAGCTGCCCCAGG - Intronic
900297209 1:1957775-1957797 GGGGGACTTCCTGCTGCCCCTGG + Intronic
900503929 1:3019803-3019825 ATGGTGCCTGCCCCTGCCCCGGG + Intergenic
900568645 1:3347619-3347641 GGAGTCCATGACCCTGCCCCAGG + Intronic
901647543 1:10724727-10724749 AGGGCCCTTGCCCCTGCCTCTGG - Intronic
901923847 1:12553651-12553673 GGGTTCCCTGTCCCTGCCCCAGG + Intergenic
902288484 1:15421754-15421776 GGGGTTCACGCCCCAGCCCCTGG - Intronic
902454601 1:16523414-16523436 GGAGGACTTGGCCCTGCCCCTGG + Intergenic
902497857 1:16886939-16886961 GGAGGACCTGGCCCTGCCCCTGG - Intronic
903501222 1:23800990-23801012 TGGGTCCTTGCCGGTGCCCCGGG + Intergenic
903652186 1:24929223-24929245 GGTGTCCTTGCCCCTGTCCCGGG + Intronic
904431978 1:30470173-30470195 GGGGGACATGCACCTGCACCAGG + Intergenic
905254134 1:36669282-36669304 GAGGTTGTTGCCCCAGCCCCAGG + Intergenic
905645562 1:39622966-39622988 GGGGTATGTGGCCCTGCCCGGGG - Intergenic
905688742 1:39927369-39927391 GGGATCCTTACCCCTGCCCTGGG + Intergenic
908592219 1:65646865-65646887 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
908852187 1:68387214-68387236 GGGGTACTTGACCCTGCCCCAGG - Intergenic
909223855 1:72992534-72992556 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
909223874 1:72992598-72992620 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
909223893 1:72992662-72992684 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
909978648 1:82072191-82072213 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
911176210 1:94820515-94820537 GGGGGACTCGACCCTTCCCCGGG - Intronic
912721820 1:112026670-112026692 GGGGTATTTGGCTCTGCCCTGGG - Intergenic
915166934 1:153953246-153953268 GGGGTAAGTGGCCCTGTCCCAGG - Exonic
916984301 1:170174253-170174275 GGGGTACTTAGCCCAGCACCTGG - Intergenic
917514678 1:175697732-175697754 GGGGGACTTGGCCCTGCCATGGG + Intronic
918215351 1:182388671-182388693 GGTGTACATGTCCCTGCCTCAGG - Exonic
918857681 1:189779894-189779916 GCAGTATTTGCCTCTGCCCCTGG - Intergenic
919659218 1:200227041-200227063 AGGGTACATGCACCTGCCCCGGG + Intergenic
919774330 1:201184250-201184272 GGAGTCCCTGTCCCTGCCCCTGG + Intergenic
920829155 1:209449777-209449799 GGGGTACTTGCCCCTCCCCCAGG - Intergenic
920829173 1:209449841-209449863 GGGATACTTGCCCCTGCCCCAGG - Intergenic
920829191 1:209449905-209449927 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
921519921 1:216146519-216146541 GGGGTACTTGCCCCTGCCCCAGG - Intronic
921532923 1:216307466-216307488 TGAGGACTTGCCCCTGCTCCAGG + Intronic
921733202 1:218598592-218598614 GGGGTACTTCCCCCTGCCCCAGG + Intergenic
923016005 1:230127120-230127142 GGGTCACATGCCCCTGCCTCAGG - Intronic
923365725 1:233258826-233258848 GGGGGACCTGCCCTTGCACCAGG - Exonic
924159724 1:241218575-241218597 TGGGTCCTTTCCCCTTCCCCTGG + Intronic
924378433 1:243438016-243438038 AGGTTTCTTGCCCCTCCCCCGGG + Intronic
1063130350 10:3172619-3172641 GGGGTCCTCGTCCCTGCGCCCGG - Intronic
1064141348 10:12793222-12793244 GGGCTACTTTCCCCAGCCCCAGG - Intronic
1064664011 10:17631504-17631526 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1064668089 10:17678393-17678415 GGGGTACATGCCACTGTGCCTGG + Intronic
1065443409 10:25773945-25773967 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1068592552 10:58865760-58865782 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1068592570 10:58865824-58865846 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1069796187 10:71053350-71053372 GGGCTGCTTCCTCCTGCCCCTGG - Intergenic
1070257561 10:74825345-74825367 GGGGTACCTGCCTCCGCCCCGGG - Intergenic
1070474610 10:76819176-76819198 GGGGTACTTGCCCCGGCCCCAGG - Intergenic
1070474630 10:76819240-76819262 GGGGTACTTGCCCCGGCCCCAGG - Intergenic
1070474650 10:76819304-76819326 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1070474669 10:76819368-76819390 GGGGTACTTGCCCCGGCCCCAGG - Intergenic
1070474689 10:76819432-76819454 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1070474708 10:76819496-76819518 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1070474727 10:76819560-76819582 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1071276930 10:84064060-84064082 GGGGTTCTTTCTCCTGCCCTTGG + Intergenic
1071897940 10:90085804-90085826 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1071916006 10:90295995-90296017 GGTGTACTTGCCCCTGCCCCAGG - Intergenic
1072155138 10:92717055-92717077 GTGTTTCTTGCCCCTCCCCCAGG + Intergenic
1074585884 10:114767894-114767916 GGGCTTCCTTCCCCTGCCCCCGG + Intergenic
1075248499 10:120845863-120845885 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1075420482 10:122296914-122296936 GTGGCACCTGCTCCTGCCCCAGG + Intronic
1077140696 11:1023680-1023702 GGGGTTCCTGGCCCTGGCCCTGG + Intronic
1077285163 11:1762355-1762377 GGGGTCCCTGCTCCTCCCCCAGG + Intronic
1079447262 11:20568781-20568803 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1081356608 11:42121565-42121587 GGGGTACTTTCCCCTGCCCCAGG - Intergenic
1081602695 11:44506351-44506373 GGGGTCCAGGCCCCTGTCCCAGG - Intergenic
1083197726 11:61099070-61099092 CAGGGACTTTCCCCTGCCCCGGG + Intergenic
1083595703 11:63917471-63917493 GGGTTACTGCCGCCTGCCCCGGG + Intergenic
1083780017 11:64913000-64913022 GGGGTACTCACCCCCTCCCCAGG + Intronic
1083875872 11:65524392-65524414 TGGGTGCCCGCCCCTGCCCCGGG + Intergenic
1085045885 11:73353154-73353176 TTGGTACTTACCCCAGCCCCTGG + Intronic
1085381098 11:76119475-76119497 GGCCTACTTGACTCTGCCCCTGG + Intronic
1087196692 11:95310479-95310501 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1087196711 11:95310543-95310565 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1089700421 11:120240875-120240897 GGGGGCATGGCCCCTGCCCCAGG - Intronic
1090850798 11:130569041-130569063 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1090872153 11:130758185-130758207 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1090872170 11:130758246-130758268 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1091282155 11:134387904-134387926 GGGTTCCTGACCCCTGCCCCTGG - Exonic
1093071368 12:14709606-14709628 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1096078478 12:48818859-48818881 GCAGTCCTTGCCCCTGCCTCCGG + Exonic
1097417256 12:59327950-59327972 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1097417273 12:59328014-59328036 GGGGTACTTTCCCCTGCCCCAGG + Intergenic
1098401985 12:70086196-70086218 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1098402004 12:70086260-70086282 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1098402023 12:70086324-70086346 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1098402041 12:70086388-70086410 GGGGTACATGCCCCTGCCCCAGG - Intergenic
1101131923 12:101698249-101698271 GGCGGACTGGCCACTGCCCCGGG + Intronic
1101773749 12:107775392-107775414 GCAGTACTTGCCCGTGCCGCTGG + Exonic
1102203222 12:111072628-111072650 GGGAGACCTGGCCCTGCCCCAGG + Intronic
1103027037 12:117582213-117582235 GGGGCTCTGGCCCCTGCCCTGGG - Intronic
1103209995 12:119158634-119158656 GGGGCACCTGCCCCTGTCCCAGG - Exonic
1106943222 13:34799593-34799615 GGGGTACTTGCCCCTGTCCCAGG - Intergenic
1106943240 13:34799657-34799679 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1107683348 13:42872151-42872173 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1107683366 13:42872215-42872237 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1108213533 13:48161471-48161493 GGGGTCTTTGCTGCTGCCCCAGG - Intergenic
1108512767 13:51170784-51170806 GGGATACTTGCCCCTGCCCCAGG - Intergenic
1108512783 13:51170848-51170870 GGGGTACTTGCCCCTGCTCCAGG - Intergenic
1109709863 13:66146052-66146074 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1110314233 13:74086676-74086698 GGGGTACTGACCCCTACCTCGGG + Intronic
1111459080 13:88517677-88517699 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1111716685 13:91887319-91887341 GGGGCACCTGCACCTGGCCCAGG + Intronic
1113671071 13:112176234-112176256 GAGGTGCTTGCCGCTGTCCCGGG - Intergenic
1113850453 13:113414612-113414634 GAGGCACGTGGCCCTGCCCCTGG - Intergenic
1114647652 14:24264425-24264447 GGGGCACCTGCCCCCACCCCCGG - Intronic
1115240795 14:31250003-31250025 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1115240812 14:31250059-31250081 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1115240832 14:31250123-31250145 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1115240852 14:31250187-31250209 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1116613307 14:47105149-47105171 GGGGTACTTGCCCCTGCCCCAGG - Intronic
1116952719 14:50894204-50894226 GGGGTACTTGCCCCTGCCCCAGG - Intronic
1120765184 14:88322346-88322368 GGGGTGCTTCCCCCTGGACCTGG - Intronic
1122040781 14:98986153-98986175 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1122505274 14:102227828-102227850 GTGGTCCTGGCCCCAGCCCCAGG - Intronic
1122789572 14:104178632-104178654 GGTGGACCTGCCCCCGCCCCTGG + Exonic
1122793287 14:104193421-104193443 GGGCCACCTGCCCCTGCCCTGGG + Intergenic
1122956578 14:105074200-105074222 AGGGGAATAGCCCCTGCCCCGGG - Intergenic
1123189922 14:106559269-106559291 GGTGTTCTTGCCCCTTTCCCTGG - Intergenic
1125045523 15:35239591-35239613 GGGGTACTTGCCCCCGCCCCAGG - Intronic
1125045541 15:35239655-35239677 GGGGTACTTGCCCCTGCCCCAGG - Intronic
1125045559 15:35239719-35239741 GGGGTACTTGCCCCTGCCCCAGG - Intronic
1125678086 15:41513055-41513077 GCGGTCCTCGCCCCTGCCGCTGG - Exonic
1125710285 15:41779671-41779693 GTGGTGCTTGCCTCTGCGCCAGG + Intronic
1126676135 15:51160611-51160633 GGGCTCCTGGCCCCTGCCCTCGG + Intergenic
1130012274 15:80161000-80161022 GGGCCAGTTGACCCTGCCCCTGG + Intronic
1130390501 15:83450002-83450024 GGGCTCCCTTCCCCTGCCCCAGG - Intronic
1131539793 15:93266527-93266549 GGGGAGGTTGCCCCTGCTCCCGG + Intergenic
1131882739 15:96876673-96876695 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1131882758 15:96876737-96876759 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1132163571 15:99565152-99565174 GGGTGACCTGCCCGTGCCCCGGG + Intergenic
1132175321 15:99709482-99709504 CGGGTCCTTGCCCCAGCCCATGG + Intronic
1132600161 16:769592-769614 GGGGTACCTGCCCCTGGCGATGG - Exonic
1133213152 16:4273959-4273981 GTGGGACTTGCCCCTCCGCCAGG + Intergenic
1133779521 16:8926910-8926932 TAGGTAATTGTCCCTGCCCCTGG - Intronic
1134522022 16:14923180-14923202 CGGGTACCTGCCCCTTCACCAGG + Intronic
1134709691 16:16321831-16321853 CGGGTACCTGCCCCTTCACCAGG + Intergenic
1134716904 16:16361861-16361883 CGGGTACCTGCCCCTTCACCAGG + Intergenic
1134949912 16:18346814-18346836 CGGGTACCTGCCCCTTCACCAGG - Intergenic
1134957847 16:18390298-18390320 CGGGTACCTGCCCCTTCACCAGG - Intergenic
1136142729 16:28297879-28297901 GTGGAGCTTGCCCCTGCCCCAGG + Intronic
1136709913 16:32228650-32228672 GGGGGACCTGGCCCTGCTCCAGG - Intergenic
1136757996 16:32700761-32700783 GGGGGACCTGGCCCTGCTCCAGG + Intergenic
1136810110 16:33169614-33169636 GGGGGACCTGGCCCTGCTCCAGG - Intergenic
1136816586 16:33279694-33279716 GGGGGACCTGGCCCTGCTCCAGG - Intronic
1137244492 16:46691000-46691022 GGAGTACTTGCGCCTGTCCCGGG + Exonic
1138433328 16:56983304-56983326 GGGGCTCTGTCCCCTGCCCCAGG + Exonic
1138548814 16:57736014-57736036 GAGGGACCTGCCCCCGCCCCCGG + Intronic
1139039442 16:62983869-62983891 GGGGTACTTTCCCCTCCCCCAGG + Intergenic
1139039479 16:62983994-62984016 GGGGTACTTTCCCCTCCCCCAGG + Intergenic
1139039515 16:62984119-62984141 GGGGTACTTTCCCCTCCCCCAGG + Intergenic
1139226118 16:65234554-65234576 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1139943235 16:70621135-70621157 GGGGTACTTGCCCCTGCCCCAGG + Intronic
1140410773 16:74739168-74739190 GGGTTACTGTCCCCTGCACCAGG + Intronic
1140451379 16:75073730-75073752 GGGGACCTTGCCCGTTCCCCTGG + Intronic
1141625502 16:85259171-85259193 GGGGCACGAGCCCCCGCCCCTGG - Intergenic
1141645805 16:85366959-85366981 GGGGTCCCTGGCCCTGCCCCGGG - Intergenic
1141796493 16:86278750-86278772 GGGGTACCTGCCCCTGCCCCAGG - Intergenic
1141796513 16:86278814-86278836 GGGGCACCTGCCCCTGCCCCAGG - Intergenic
1141796533 16:86278878-86278900 GGGGCACCTGCCCCTGCCCCAGG - Intergenic
1141796553 16:86278942-86278964 GGGGCACCTGCCCCTGCCCCAGG - Intergenic
1141796573 16:86279006-86279028 GGGGTACCTGCCCCTGCCCCAGG - Intergenic
1141796596 16:86279093-86279115 GGGGTACTTGTCCCTACCCCAGG - Intergenic
1141865415 16:86746715-86746737 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1142126864 16:88414713-88414735 GGGGTAACTTCCCCTGCCCCAGG + Intergenic
1142149453 16:88506212-88506234 GGTCTCCCTGCCCCTGCCCCTGG - Intronic
1142189792 16:88712570-88712592 GGGGCACCTGCCCGTGTCCCGGG + Intronic
1142291623 16:89195931-89195953 GGGGTACTCAGCCATGCCCCAGG + Exonic
1203060147 16_KI270728v1_random:961110-961132 GGGGGACCTGGCCCTGCTCCAGG + Intergenic
1142599051 17:1044173-1044195 CCGGCTCTTGCCCCTGCCCCCGG - Intronic
1142959861 17:3545706-3545728 GGGATAATAGCCCCTGCACCCGG - Intronic
1146597659 17:34184140-34184162 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1146597678 17:34184204-34184226 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1147169448 17:38609443-38609465 AGGGTGCTTCCCGCTGCCCCAGG + Intergenic
1147993718 17:44350319-44350341 GGGGTGCTGCCCCATGCCCCAGG + Exonic
1152077364 17:78168119-78168141 GGGGTCTTTGACCCTACCCCAGG + Intergenic
1152144793 17:78561681-78561703 GGGGTGCCTGCCCCTGCCCAGGG + Intronic
1152409227 17:80113404-80113426 GAGTTACGTGCCCCTCCCCCAGG - Intergenic
1155275949 18:24187723-24187745 GGGATACTTTGCCCTGACCCAGG + Intronic
1158478610 18:57802431-57802453 GGAGTACCTGGCCCTGCCACAGG + Intronic
1159834822 18:73325564-73325586 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1159834840 18:73325626-73325648 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1161172115 19:2817491-2817513 GGGGTTCTTACCCCTGACGCAGG + Intergenic
1161226482 19:3148839-3148861 GGGGAACTTGGCCCTGCTCCGGG - Intronic
1161295038 19:3515136-3515158 GAGGTTCTTGTCCCTGGCCCGGG - Intronic
1161661513 19:5549483-5549505 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1162366225 19:10251273-10251295 GGGGGACATGGCCCTGCCCTGGG + Intergenic
1162411788 19:10510507-10510529 GACGTGCTGGCCCCTGCCCCCGG - Intergenic
1163012587 19:14434681-14434703 GGGGTCCCTGCCTCTACCCCCGG + Intronic
1163322810 19:16584494-16584516 GGGGTGCTGGCCCCTCCCTCAGG - Intronic
1163426068 19:17241635-17241657 GGGGTAGTTGCTCCAGGCCCAGG - Intronic
1163468960 19:17486058-17486080 GGAGGGATTGCCCCTGCCCCAGG - Intronic
1163906836 19:20155557-20155579 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1164152764 19:22569220-22569242 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1165401257 19:35601966-35601988 GGGGAAAATACCCCTGCCCCTGG - Intergenic
1166094557 19:40530740-40530762 GGCGTCCTTGCCCCTCCCCCAGG - Intronic
1166499155 19:43328291-43328313 GTGGTACTTGCCCCTGCCCCAGG + Intergenic
1167344191 19:48935131-48935153 GGGGTGCTGGCCGCCGCCCCTGG + Intronic
1167633427 19:50639620-50639642 GGGCCACGTGCCCCTCCCCCGGG + Intronic
926230802 2:11002552-11002574 CGGGATCTTGCCACTGCCCCTGG - Intergenic
926815757 2:16796673-16796695 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
927197101 2:20555571-20555593 GGGCTACTTGCTCCTCCCTCTGG - Intergenic
927326608 2:21812558-21812580 GGGACAGTTTCCCCTGCCCCAGG - Intergenic
928321115 2:30283570-30283592 GGGGTACTTGCCCAGGGGCCCGG + Intronic
930954887 2:57193963-57193985 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
930954906 2:57194027-57194049 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
931236651 2:60418302-60418324 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
931236668 2:60418364-60418386 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
931236686 2:60418428-60418450 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
931236701 2:60418492-60418514 GGGGTACTTGCCCCTGCCTCAGG - Intergenic
931236720 2:60418556-60418578 GGGGTAGTTGCCCCTGCCCCAGG - Intergenic
931236736 2:60418620-60418642 GGGGTAGTTGCCCCTGCCTCAGG - Intergenic
931625528 2:64253358-64253380 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
931625545 2:64253419-64253441 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
931625562 2:64253483-64253505 GGGGTACTTGGCCCTGCCCCAGG - Intergenic
932359030 2:71089816-71089838 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
932359049 2:71089880-71089902 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
932359066 2:71089944-71089966 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
933079049 2:77966037-77966059 GGGTTTCTTGCCCCTCCCCCAGG - Intergenic
933079067 2:77966101-77966123 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
934567352 2:95347973-95347995 GGGGCACTTCCCCATGCCCGAGG - Intronic
935296960 2:101658024-101658046 GGAGTGCTTGGCCCTGGCCCAGG + Intergenic
938402617 2:131005617-131005639 GGGGTACGTGGCCAAGCCCCTGG - Intronic
940912059 2:159217615-159217637 TGGGTACCTGCCAATGCCCCTGG - Exonic
941353184 2:164460110-164460132 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
941456401 2:165715227-165715249 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
944408450 2:199412449-199412471 GGGGTTCCTTCCCCTGCCCAAGG - Intronic
945394111 2:209300259-209300281 GGGGTACTTGCCCCTGTCCCAGG - Intergenic
945445461 2:209932503-209932525 TGTGTACCTGCCCCTTCCCCAGG + Intronic
946031544 2:216708833-216708855 GGGGCACTGGCCACTACCCCAGG - Intergenic
947796609 2:232897141-232897163 GGGGGTCTGGCCCCTTCCCCAGG + Intronic
948073316 2:235144945-235144967 AGGGCACTTGCCTCTGTCCCTGG + Intergenic
948676182 2:239598151-239598173 TGGGTGCTTGCCCTGGCCCCCGG - Intergenic
1168998053 20:2147177-2147199 AGGGCGTTTGCCCCTGCCCCGGG - Exonic
1169227315 20:3864812-3864834 GGGATCCTGGCCCCTTCCCCCGG + Intronic
1170106018 20:12754835-12754857 GGGAAACTTGCCCTTGCCCCAGG - Intergenic
1170165691 20:13358978-13359000 GGGGTACTTGACCCTGCCCCAGG - Intergenic
1170820900 20:19755802-19755824 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1172301163 20:33851445-33851467 GGGGCACTTACCCCTGACCCGGG + Intronic
1172845605 20:37928245-37928267 GGGTTGCTTGTCCCTCCCCCAGG - Intronic
1174861505 20:54095875-54095897 TGGGAATGTGCCCCTGCCCCTGG - Intergenic
1175180115 20:57140483-57140505 GGGGCAATTGCCCCTTCCCCGGG - Intergenic
1175333302 20:58179166-58179188 GGAGTGCATGACCCTGCCCCTGG - Intergenic
1175759767 20:61554043-61554065 GGAGAACCTGCCCCTGCCCTGGG - Intronic
1175994884 20:62807607-62807629 TACGTACCTGCCCCTGCCCCGGG + Intronic
1176038469 20:63051821-63051843 AGGCCACCTGCCCCTGCCCCTGG - Intergenic
1176423478 21:6533681-6533703 GTGGGACGTGGCCCTGCCCCCGG - Intergenic
1178817741 21:35946795-35946817 GGGGAACATACCCCTGTCCCAGG - Intronic
1179698972 21:43141997-43142019 GTGGGACGTGGCCCTGCCCCCGG - Intergenic
1180560682 22:16612243-16612265 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1180560719 22:16612371-16612393 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1180980611 22:19876432-19876454 GGGCTCCTGGCCTCTGCCCCAGG - Intronic
1181449501 22:23009399-23009421 AGGGTAATTGCCCCAGCACCTGG + Intergenic
1182113720 22:27742901-27742923 GGGGTAGTTGCCCCTGCCCCAGG - Intergenic
1182554734 22:31123068-31123090 GGGTTCCCTGCCCATGCCCCAGG + Exonic
1182732063 22:32503702-32503724 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1182911574 22:33988905-33988927 AGGGCACATGCCCCTGGCCCAGG - Intergenic
1183323891 22:37181034-37181056 GAGATACCTGCCCCTGCCACCGG + Exonic
1183906152 22:41041802-41041824 CGGGTACATGCCCCTGTGCCTGG + Intergenic
1184853904 22:47136252-47136274 AGGGTCCTGGCCCCCGCCCCAGG + Intronic
1185187804 22:49413314-49413336 GGGGGAGTTTCTCCTGCCCCCGG - Intergenic
1185234860 22:49705822-49705844 GGGGTGCTGGCCCCTCCCCTCGG - Intergenic
1185398614 22:50604765-50604787 GGGGCCCGTGCCCCTGCCCCCGG - Exonic
949190574 3:1244374-1244396 GGGGTACTTGGCCCTGCCCCAGG + Intronic
949190593 3:1244438-1244460 GGGGTACTTGGCCCTGCCCCAGG + Intronic
949190612 3:1244502-1244524 GGGGTACTTGGCCCTGCCCCAGG + Intronic
950362972 3:12462696-12462718 AGGGAAGTTGCCCCTCCCCCTGG - Intergenic
952343740 3:32466025-32466047 GGGGTTCTTGTCCCTCCTCCAGG + Intronic
952945458 3:38475742-38475764 AGGGTACTTTGCCCTCCCCCAGG + Intronic
953912946 3:46901955-46901977 TGGGTCCTTTCCCTTGCCCCAGG - Intronic
954593526 3:51804679-51804701 GTGGGACTTGTCCCTCCCCCTGG + Intergenic
954969488 3:54639277-54639299 GGGGTACTTGCCCCTGCCCCAGG + Intronic
959972481 3:112422362-112422384 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
961333485 3:126156555-126156577 GGGCTGCTTGCCCCTGCCCGAGG - Intronic
961447282 3:126986782-126986804 GGGCTGCCTGCCCCTCCCCCAGG - Intergenic
961730381 3:128960778-128960800 GGGGTACTTGCCCCTGCCCCAGG - Intronic
961730400 3:128960842-128960864 GGGGTACTTGCCCCTGCCCCAGG - Intronic
962263012 3:133927028-133927050 TGGGTACCTGCCCCTTTCCCGGG + Intergenic
962530791 3:136277931-136277953 AGTGCACTTCCCCCTGCCCCTGG + Intronic
962691877 3:137907374-137907396 GTGGTGGTTGCCCCTTCCCCTGG - Intergenic
962697076 3:137960633-137960655 TGGGTCCTTTCCCCTGACCCTGG + Intergenic
963264454 3:143227120-143227142 GTGGTACCTGCAGCTGCCCCTGG + Intergenic
963483082 3:145902280-145902302 GGAGTACTTTCCCCTGCTCATGG - Intergenic
965286926 3:166828746-166828768 GGGGTACTTGCCCCTCCCCCAGG + Intergenic
965713169 3:171577305-171577327 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
965713188 3:171577369-171577391 GGGGTACTTGCCCCTTCCCCAGG - Intergenic
967212379 3:187180272-187180294 GGGGTACTTGCCCCTGCCCCAGG + Intronic
967561191 3:190921139-190921161 GGGGTACTTGCCCCTTCCCTAGG - Intergenic
968045678 3:195622716-195622738 GGAGTAGTTGCCTCTGTCCCTGG + Intergenic
968056591 3:195696783-195696805 GGGGTCTCCGCCCCTGCCCCGGG - Intergenic
968064391 3:195750481-195750503 GGAGTAGTTGCCTCTGTCCCTGG + Intronic
968308978 3:197667371-197667393 GGAGTAGTTGCCTCTGTCCCTGG - Intergenic
968904224 4:3444192-3444214 CGGGGACTTGCTCCGGCCCCTGG - Intronic
971123394 4:23726753-23726775 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
971123427 4:23726878-23726900 GGGGTTCTTGCCCCTGCCTCAGG + Intergenic
971180353 4:24324246-24324268 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
971199960 4:24502139-24502161 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
974428612 4:61769052-61769074 GGGGTACTTGCCCCTGCCCCAGG + Intronic
975485410 4:74930106-74930128 GGGCTAATTGTCCCTGCACCAGG - Intergenic
975865344 4:78718792-78718814 GGGGTACTTGCCCCTTCCCCAGG + Intergenic
975934118 4:79558780-79558802 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
976398636 4:84583421-84583443 GGGGAAGCTGCCCCGGCCCCAGG + Exonic
976640321 4:87330953-87330975 GGGGTACTTCCCCCTTCACTGGG - Intergenic
977041824 4:92026892-92026914 GGGGCACTTGCCCCTGCCCCAGG - Intergenic
977041842 4:92026956-92026978 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
977198636 4:94089345-94089367 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
977217322 4:94297786-94297808 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
977217338 4:94297850-94297872 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
977217357 4:94297914-94297936 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
978061377 4:104344615-104344637 GGAGTGCTTGCTCCTGCTCCTGG + Intergenic
979146423 4:117253096-117253118 GGGGTACTTGTCCCTCCCCTAGG - Intergenic
981539465 4:145833478-145833500 GGGGTACTTGCCCCTGCCCCAGG - Intronic
982180673 4:152746029-152746051 GGGGTACTTGCCCCTGCCCCAGG + Intronic
982180692 4:152746093-152746115 GGGGTACTTGCTCCTGCCCCAGG + Intronic
982180707 4:152746157-152746179 GGATTACTTGCCCCTGCCCCAGG + Intronic
982414421 4:155113296-155113318 GGGGTACTTGCCCCTCCCCCAGG + Intergenic
982535207 4:156601161-156601183 GGGGTACTTGACCCTTCCCCAGG - Intergenic
983023647 4:162710053-162710075 GGGGTACTTGCCCCTTCCCCAGG - Intergenic
983055271 4:163094071-163094093 GAGGTACTTGCCCCTGCCCCAGG - Intergenic
983055285 4:163094132-163094154 GGGGTACTTGACCCTGCCCCAGG - Intergenic
983055307 4:163094215-163094237 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
983207916 4:164930632-164930654 GTGGTACCTGGCGCTGCCCCTGG + Intergenic
985487090 5:158039-158061 GGGGTTCCTGTTCCTGCCCCAGG - Intronic
985861600 5:2475854-2475876 TGGGAACTTCCACCTGCCCCTGG - Intergenic
986905558 5:12490783-12490805 GGGGTACTTGCCCCTACCCCAGG - Intergenic
986905577 5:12490847-12490869 GGGGTACTTGCCCCTACCCCAGG - Intergenic
987498326 5:18673537-18673559 GGGGTACTTTCCCCTGCCCCAGG + Intergenic
987792971 5:22592387-22592409 GGGGTAGTTTCACCTGACCCTGG - Intronic
995796445 5:115946221-115946243 GGGTTACTTGCCACTGCTCTTGG + Intergenic
997769891 5:136544411-136544433 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
997981032 5:138467402-138467424 GGGGTACTTGCGCATGCGGCTGG - Exonic
997990685 5:138542685-138542707 TGGGTAGTAGCCCCTGACCCAGG - Intronic
998157145 5:139793486-139793508 GGTCTCCTTGCCCCTGCCACAGG + Intergenic
998875088 5:146591096-146591118 GGGGTACTTGCCCTGGCCCAAGG - Intronic
998996594 5:147873587-147873609 GGGGTACTTGCCCCTGCCCCAGG + Intronic
999619073 5:153454430-153454452 AGGGTACTTGCCCCTGCCCCAGG + Intergenic
1000382309 5:160640027-160640049 GAGGTACTGGCCCTTGGCCCAGG + Intronic
1001705284 5:173737084-173737106 GGGTTTCTTCCCCCAGCCCCAGG - Intergenic
1002611176 5:180419463-180419485 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1005014886 6:21366276-21366298 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1006716164 6:36122138-36122160 GGGTTATTTGCCCCTGACCAAGG + Intergenic
1007077680 6:39078346-39078368 GAGGTACTTGACAATGCCCCAGG - Exonic
1007631591 6:43275943-43275965 GAGGGGCTGGCCCCTGCCCCCGG + Intronic
1008000008 6:46350445-46350467 GGGTTGCCTGCCCCTGACCCAGG - Intronic
1009270158 6:61604700-61604722 TGGGGATTTGCCCCTGCCCAGGG + Intergenic
1009702291 6:67200656-67200678 GGGGCACTTGCCCCTTCTCTGGG - Intergenic
1010586941 6:77665399-77665421 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1010586960 6:77665463-77665485 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1010827125 6:80487156-80487178 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1011771149 6:90674912-90674934 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1012689323 6:102293693-102293715 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1013891461 6:115032760-115032782 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1013891480 6:115032825-115032847 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1014455121 6:121625312-121625334 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1015266531 6:131296446-131296468 GGGGTACTTACCCCTGCCCCAGG - Intergenic
1015271141 6:131339780-131339802 GGGGTTCTTGCCCCTGCCCCAGG - Intergenic
1015271158 6:131339843-131339865 GGGGTTCTTGCCCCTGCCCCAGG - Intergenic
1015271176 6:131339907-131339929 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1017939268 6:159036798-159036820 AGGGGACTTCCCCGTGCCCCGGG - Exonic
1019070393 6:169340661-169340683 GGGGTGCTTGCCTCTGTCCATGG + Intergenic
1019365854 7:632436-632458 GGGGGTCTTCCCACTGCCCCTGG + Intronic
1020013355 7:4818015-4818037 AGGGTCCTGGCCCCTTCCCCAGG - Intronic
1021978061 7:26028757-26028779 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1021978080 7:26028821-26028843 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1022088142 7:27088416-27088438 GGGGCACCAGCGCCTGCCCCCGG - Intergenic
1022710224 7:32842488-32842510 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1022710242 7:32842549-32842571 GGGGTACTTGGCCATTCCCCAGG + Intergenic
1023699104 7:42875369-42875391 GAGGTACTTGCCCCTGTCCCAGG + Intergenic
1023699122 7:42875433-42875455 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1024697362 7:51870799-51870821 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1024697381 7:51870863-51870885 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1024697400 7:51870927-51870949 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1024697418 7:51870991-51871013 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1026462904 7:70630517-70630539 AGTGAACTTGCCACTGCCCCTGG + Intronic
1026735996 7:72949054-72949076 GGGCTAGGTGTCCCTGCCCCGGG + Exonic
1026973208 7:74480383-74480405 GGGGCGCTTGCCCCTGCACTGGG - Intronic
1027107734 7:75416007-75416029 GGGCTAGGTGTCCCTGCCCCGGG - Intergenic
1029639806 7:101814068-101814090 GGGGTGCTTCCGCCTTCCCCTGG - Intergenic
1030751681 7:113238163-113238185 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1030751700 7:113238227-113238249 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1031399812 7:121316696-121316718 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1031769842 7:125829662-125829684 GTGGCATTTGCCCCTGCCCTAGG - Intergenic
1032344835 7:131107936-131107958 GGGGTCCTTGGCCCTGGCCGGGG - Intergenic
1034552879 7:151832543-151832565 GGGGTTCTCCCCCCTTCCCCTGG + Intronic
1035323632 7:158050890-158050912 GGGATGCTTGCCCCTCCCGCTGG + Intronic
1035820819 8:2589545-2589567 GGGTTTCTTGTCCCTCCCCCGGG + Intergenic
1038400559 8:27281016-27281038 GGGGAGCTTCCCCCTGCCCTGGG + Intergenic
1041469167 8:58189904-58189926 GAGGGACTTGCCCCGTCCCCTGG - Intronic
1043024817 8:75052736-75052758 GGGGTAATTTCCCCTGCCTGTGG + Intergenic
1043382871 8:79722064-79722086 TGGGTACTTGCCACTGTGCCTGG - Intergenic
1043405834 8:79932030-79932052 GGAGTACTTGCCCTGGCCCTGGG + Intronic
1044416845 8:91948888-91948910 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1044416864 8:91948952-91948974 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1044416882 8:91949013-91949035 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1044924925 8:97201802-97201824 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1044924943 8:97201866-97201888 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1044926088 8:97209990-97210012 GTGTGACTTGCCCCTGACCCTGG + Intergenic
1045217363 8:100161706-100161728 AGGGTAATTGCCCCAGCACCTGG + Intronic
1046131537 8:109973921-109973943 GGGGTACCTGTCCCTGCAGCAGG + Exonic
1046386583 8:113514387-113514409 TGGGTACTTGCCCCTGCCCCAGG + Intergenic
1046559066 8:115815583-115815605 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1047281912 8:123453196-123453218 GGAGATCTTGTCCCTGCCCCTGG + Intronic
1048168638 8:132084937-132084959 GGGGTACTTGCCCCTGCCCCAGG + Intronic
1048168657 8:132085001-132085023 GGGGTATTTGCCCCTGCCCCAGG + Intronic
1050692289 9:8241563-8241585 AGGGTAGTTGGCCCTGCCACAGG + Intergenic
1051052412 9:12949294-12949316 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1051598898 9:18852395-18852417 GTAGTACTTGCTCTTGCCCCTGG + Intronic
1051825107 9:21211045-21211067 TGGGGACCTGCCCCTCCCCCTGG - Intronic
1051849501 9:21490443-21490465 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1054336269 9:63813060-63813082 GAGGTGCTCGCCCGTGCCCCCGG - Intergenic
1055818955 9:80238863-80238885 TGGGTGCTTGCCCCTTCCTCTGG - Intergenic
1056044920 9:82705294-82705316 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1056044942 9:82705358-82705380 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1056437439 9:86588009-86588031 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1056437457 9:86588073-86588095 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1056437475 9:86588137-86588159 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1056437494 9:86588201-86588223 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1056437513 9:86588265-86588287 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1056437532 9:86588329-86588351 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1057141230 9:92727858-92727880 AGTGAACATGCCCCTGCCCCAGG + Intronic
1057683724 9:97215478-97215500 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1057683745 9:97215542-97215564 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1057683766 9:97215604-97215626 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1057748778 9:97773225-97773247 AGGCTCCTTGCCCCTCCCCCAGG + Intergenic
1057773168 9:97984484-97984506 GGGGCCCCTGCCCTTGCCCCGGG + Intronic
1058282376 9:103131727-103131749 GAGGTTCTTCCCCCTGACCCCGG - Intergenic
1059518898 9:114921428-114921450 GGTGTACTTTCCACTGCCCTAGG + Intronic
1059606917 9:115843938-115843960 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1061152619 9:128837513-128837535 GGGATTCTTGCCCCTGTCCTGGG + Intronic
1061556502 9:131373300-131373322 GGGGTGGTGGCCGCTGCCCCGGG - Intergenic
1061618243 9:131794082-131794104 GGGGTACTTCCCTCCGACCCTGG - Intergenic
1061726490 9:132584783-132584805 GTGGTCCTTGCTCCTCCCCCGGG + Intronic
1061779883 9:132989276-132989298 TGGGTCCCTCCCCCTGCCCCTGG + Intronic
1061862128 9:133473475-133473497 GGGGGACTTGGCGCAGCCCCTGG - Exonic
1061893244 9:133633729-133633751 GGGGTGCTTGCCCCAGGCACTGG + Intergenic
1062350293 9:136135415-136135437 AGGGTGAGTGCCCCTGCCCCAGG - Intergenic
1185960867 X:4545069-4545091 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1194077903 X:89419460-89419482 GGTGTACTGGTCCCTGCCCATGG - Intergenic
1194293824 X:92104950-92104972 GGGGTACTTGCCCCTGCCCCAGG + Intronic
1194351083 X:92825476-92825498 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1194822995 X:98529082-98529104 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1194874042 X:99164296-99164318 GGGTTTCTTGCCTCTCCCCCAGG + Intergenic
1195908884 X:109869933-109869955 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1196533746 X:116817221-116817243 GGGGTACTTGCCCCTGCCCCAGG + Intergenic
1196533765 X:116817285-116817307 GGGGTACTTGCCCCTGCCACAGG + Intergenic
1196572295 X:117280168-117280190 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1196572312 X:117280229-117280251 GGGGTACTTGCCCCTGCCCCAGG - Intergenic
1196572330 X:117280293-117280315 GGGATACTTGGCCCTGCCCCAGG - Intergenic
1200054165 X:153450075-153450097 TGGGTAGCTGCCACTGCCCCTGG + Intronic
1200430552 Y:3075021-3075043 GGTGTACTGGTCCCTGCCCATGG - Intergenic
1200611341 Y:5329491-5329513 GGGGTACTTGCCCCTGCCCCAGG + Intronic
1200643820 Y:5757085-5757107 GTGGTATTTGCCCCTGCCCTAGG + Intergenic
1200659376 Y:5942029-5942051 GGGGTATTTGCCCCTTCCCCAGG - Intergenic
1200659412 Y:5942156-5942178 GGGGTACTTGCCCCTGCCCCAGG - Intergenic