ID: 977218595

View in Genome Browser
Species Human (GRCh38)
Location 4:94312750-94312772
Sequence TGAGATTCCCATACAATAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 4, 3: 71, 4: 181}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977218595_977218597 -10 Left 977218595 4:94312750-94312772 CCCATTATTGTATGGGAATCTCA 0: 1
1: 0
2: 4
3: 71
4: 181
Right 977218597 4:94312763-94312785 GGGAATCTCAGTCTCTTTGTAGG 0: 1
1: 210
2: 6945
3: 3368
4: 1619
977218595_977218600 18 Left 977218595 4:94312750-94312772 CCCATTATTGTATGGGAATCTCA 0: 1
1: 0
2: 4
3: 71
4: 181
Right 977218600 4:94312791-94312813 AAGGACTTGGTTTATGAAACTGG 0: 1
1: 35
2: 3094
3: 6493
4: 2773
977218595_977218601 19 Left 977218595 4:94312750-94312772 CCCATTATTGTATGGGAATCTCA 0: 1
1: 0
2: 4
3: 71
4: 181
Right 977218601 4:94312792-94312814 AGGACTTGGTTTATGAAACTGGG 0: 1
1: 81
2: 6396
3: 3929
4: 2319
977218595_977218598 -1 Left 977218595 4:94312750-94312772 CCCATTATTGTATGGGAATCTCA 0: 1
1: 0
2: 4
3: 71
4: 181
Right 977218598 4:94312772-94312794 AGTCTCTTTGTAGGTCTCTAAGG 0: 1949
1: 1831
2: 4022
3: 882
4: 362
977218595_977218599 5 Left 977218595 4:94312750-94312772 CCCATTATTGTATGGGAATCTCA 0: 1
1: 0
2: 4
3: 71
4: 181
Right 977218599 4:94312778-94312800 TTTGTAGGTCTCTAAGGACTTGG 0: 23
1: 25
2: 32
3: 33
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977218595 Original CRISPR TGAGATTCCCATACAATAAT GGG (reversed) Intronic
900277938 1:1844704-1844726 TGAGATACCCAAACCAGAATAGG + Intronic
906553385 1:46686286-46686308 AGAGATTGCAATACAAAAATAGG + Intronic
906585977 1:46978505-46978527 TTAGACTCCCACACAATAATGGG + Intergenic
906589319 1:47008948-47008970 TTAGACTCCCACACAATAATGGG + Intergenic
910852549 1:91662923-91662945 TGAGATTCTCACTCAATAGTGGG + Intergenic
910953866 1:92680308-92680330 GGAAATTCCCAAAGAATAATGGG + Intronic
912226013 1:107734737-107734759 TTAGACTCCCACACAACAATAGG + Intronic
912802708 1:112730536-112730558 TGAGATTCCAATCCAGTAAGGGG - Intergenic
916978345 1:170106481-170106503 TTAGACTACCACACAATAATAGG - Intergenic
917181670 1:172304414-172304436 TTAGACTCCCATACAATAAGGGG + Intronic
917207670 1:172594888-172594910 TCAGACTCCCACACAATAATGGG - Intronic
918451312 1:184661760-184661782 TGAGTTTCCCATTTACTAATAGG + Intergenic
918948877 1:191108813-191108835 TTAGATGACCATGCAATAATTGG - Intergenic
921471378 1:215554523-215554545 ACAGATTCCAATACAATAATTGG - Intergenic
921844147 1:219861106-219861128 AAAGATTCCCATTCAATAAGAGG - Intronic
923179867 1:231506310-231506332 TTGGATTCCCACACAATAAGTGG - Intergenic
924652515 1:245942507-245942529 TTAGACTCCCACACAATAATGGG + Intronic
1064395355 10:14977472-14977494 TGACATCCCCCTACAATATTGGG - Intronic
1065426680 10:25612899-25612921 AGAGACTGCAATACAATAATAGG - Intergenic
1067050521 10:43015393-43015415 TCAGATTCCAATACACAAATAGG + Intergenic
1068369368 10:56093649-56093671 TTAAACTCCCAAACAATAATAGG - Intergenic
1068469794 10:57447076-57447098 TTAGACTCCCACACAATAATGGG - Intergenic
1068552382 10:58421350-58421372 TAAGACTCCCACACAATAATGGG - Intergenic
1068861012 10:61848054-61848076 TGAGAGTCCCATTGAATAAAAGG + Intergenic
1072774834 10:98180674-98180696 CAAGACTCCCACACAATAATGGG - Intronic
1075016142 10:118911099-118911121 TGAGATTCCCACAAAATTCTTGG + Intergenic
1076672078 10:132127745-132127767 AGATAATCCCATACAATGATTGG - Intronic
1077202300 11:1316635-1316657 GTAGACTCCAATACAATAATAGG - Intergenic
1077713902 11:4561903-4561925 TTAGACTCCCACACAATAATGGG + Intergenic
1078331240 11:10423713-10423735 TTAGACTCCCACACAATAATAGG - Intronic
1079152469 11:17912951-17912973 TGAGATTCCAATGAGATAATGGG + Intronic
1079671190 11:23173409-23173431 TGAAATTCAGTTACAATAATAGG + Intergenic
1080200614 11:29665184-29665206 TTAGAATCCCACACAATAATGGG + Intergenic
1081132600 11:39398782-39398804 TTAGATTCCCACAAAATAATAGG - Intergenic
1082908386 11:58339788-58339810 TGAGATTCCCAGGAAATCATTGG + Intergenic
1083127050 11:60580378-60580400 TGAGATAGCAACACAATAATAGG + Intergenic
1087275329 11:96155304-96155326 TGAGATTCCCATAAAGGAAGTGG + Intronic
1087573890 11:99965771-99965793 TTAGACTCCCACACAATAGTGGG - Intronic
1087881526 11:103421241-103421263 TTAGACTCCCACACAATAGTGGG + Intronic
1087898516 11:103613864-103613886 TTAGACTCCCACACAATAATGGG + Intergenic
1088103719 11:106182552-106182574 TTAGACTCCCACACAATAGTGGG + Intergenic
1088530383 11:110801669-110801691 TCAGATTCCCTTACAATCAGGGG - Intergenic
1089193087 11:116669247-116669269 TTAGACTCCCACACAATAGTGGG + Intergenic
1090592431 11:128286784-128286806 TGGGGTTACCATACACTAATTGG - Intergenic
1091089767 11:132760412-132760434 TCAGACTCCCACACAATAAGAGG - Intronic
1092641650 12:10518222-10518244 TTAGACTCCCACACAATAATGGG - Intronic
1092663423 12:10765328-10765350 TGAGATAACCATTCAATAATAGG - Intergenic
1093078100 12:14777768-14777790 TAAGATTCCCATATAGAAATAGG + Intronic
1095356637 12:41282399-41282421 TTAGACTACCACACAATAATAGG + Intronic
1095429152 12:42113659-42113681 TTAGACTCCCACACAATAATGGG + Intronic
1095936025 12:47682422-47682444 AGACATTCCCATATATTAATAGG + Intronic
1097325519 12:58272065-58272087 TGAGACTCCAATACAATCTTAGG + Intergenic
1097367912 12:58740765-58740787 TTAGATTCCCATATAATAAATGG - Intronic
1097855546 12:64457898-64457920 TTAGATTTCCACACTATAATGGG - Intronic
1097950523 12:65422255-65422277 TTAGACTCCCACACAATAGTAGG + Intronic
1099179988 12:79465386-79465408 TAATATTCCCATAGAATAATAGG - Intergenic
1101688190 12:107046907-107046929 ATAGATTCCATTACAATAATAGG + Intronic
1104256140 12:127140912-127140934 TTAGACTCCCACACAATAATGGG - Intergenic
1107547504 13:41447315-41447337 TAACATTCCCCTACAATATTGGG + Intergenic
1109216291 13:59593154-59593176 TTAGACTCCCACAGAATAATGGG + Intergenic
1109375049 13:61481686-61481708 TTAGATTCCCACACAATAATAGG - Intergenic
1109529860 13:63627889-63627911 TGAAATTTCCAGACAAGAATAGG - Intergenic
1110028978 13:70581150-70581172 TGAGTTTCCCAAAGACTAATTGG - Intergenic
1110605550 13:77427699-77427721 TGAGATTTCAATATAAAAATTGG + Intergenic
1111835388 13:93382515-93382537 TGATATTCTCATAGAATCATGGG - Intronic
1114962166 14:27906506-27906528 TGAAATTCAGATAAAATAATTGG - Intergenic
1117796798 14:59403323-59403345 TTAGACTCCCACACAATAATGGG - Intergenic
1117892881 14:60445592-60445614 TTAGACTCCCACATAATAATGGG + Intronic
1119006872 14:70939743-70939765 TTAGACTCCCACACAATAATGGG - Intronic
1121404824 14:93713296-93713318 TGGGAATCCCAAACAAGAATGGG + Intergenic
1125224684 15:37381979-37382001 TTAGACTCCCACACAATAATGGG + Intergenic
1126074269 15:44894139-44894161 TTAGACTCTCACACAATAATGGG - Intergenic
1126083923 15:44992653-44992675 TTAGACTCCCACACAATAATGGG + Intergenic
1126668099 15:51093368-51093390 AGAGATTCCCATAGAGTAAAGGG - Intronic
1127000731 15:54501397-54501419 TGAGATTCAATTACAATTATTGG - Intronic
1127567996 15:60212401-60212423 TGAGAAGCTCATATAATAATTGG - Intergenic
1130413408 15:83666901-83666923 TAAGATTCTCATAGAAAAATGGG - Intronic
1131583531 15:93669103-93669125 TGAGATACCGATGCAATAATAGG + Intergenic
1135512308 16:23096372-23096394 TTAGACTCCCACACAATAATGGG + Intronic
1135897558 16:26421767-26421789 TTAGACTCCCACACAATAATGGG + Intergenic
1137371692 16:47912377-47912399 TTAGACTCCCACACAATAATGGG + Intergenic
1149229463 17:54516771-54516793 TTAGACTCCCACAAAATAATGGG - Intergenic
1149238222 17:54617913-54617935 TGAGATTCTGATAGAATAAAAGG + Intergenic
1150708123 17:67506685-67506707 TTAAATTCTCATTCAATAATTGG + Intronic
1152489768 17:80622368-80622390 TGAGTTTGCTATACAATAATTGG + Intronic
1153857880 18:9169326-9169348 TTAAACTCCCACACAATAATGGG - Intronic
1154941844 18:21121371-21121393 TGCTATTCCCAATCAATAATTGG + Intergenic
1157056520 18:44235367-44235389 AGATATTCCCATAAAATAAGTGG + Intergenic
1157058010 18:44253851-44253873 TTAGACTCCCACACAATAATGGG - Intergenic
1157416297 18:47506102-47506124 TGAGATTCAAATAAAATGATGGG + Intergenic
1158054083 18:53258823-53258845 TTAGACTCCCATACAATAATGGG - Intronic
1158728857 18:60001302-60001324 TTAGACTCCCACACAATAGTGGG - Intergenic
1159319364 18:66827167-66827189 TAGGATTCCCAAACATTAATGGG - Intergenic
1159691017 18:71487376-71487398 TGAAATTCCCCTGGAATAATGGG + Intergenic
1164085408 19:21897559-21897581 TTAGACTCCCACATAATAATGGG - Intergenic
1164132915 19:22382285-22382307 TTAGACTCCCACACAATAATGGG - Intergenic
1164165903 19:22674446-22674468 TTAGACTCCCACACAATAATGGG + Intergenic
1166896380 19:46024368-46024390 TGAGATGCCCATGAAATATTAGG - Intergenic
927066518 2:19476829-19476851 GGGAATTCCCATACAATTATGGG + Intergenic
929841842 2:45474779-45474801 TGAGATTTCCATCCACTAATGGG + Intronic
929960914 2:46495691-46495713 TGGGATATCCATACAATATTTGG + Intronic
931698967 2:64893535-64893557 TTAGACTCCCACATAATAATGGG + Intergenic
933110554 2:78395019-78395041 TTAGACTCCCACACAATAGTAGG - Intergenic
933568851 2:83983264-83983286 TCAGATTCTCAGACATTAATAGG + Intergenic
936665332 2:114588187-114588209 TGAGATCCTCAGAAAATAATTGG + Intronic
936910944 2:117592947-117592969 TGAGATAGCAACACAATAATAGG - Intergenic
937148101 2:119664536-119664558 TTAGACTCCCACGCAATAATAGG + Intergenic
937833063 2:126444706-126444728 TGACATTCCCATAATAGAATGGG + Intergenic
937834156 2:126454984-126455006 TTAGACTCCCACACAATAATGGG - Intergenic
938559202 2:132456090-132456112 TTAGACTCCCATACAATAATTGG - Intronic
939124016 2:138153488-138153510 TGATATTACCATACCAAAATTGG - Intergenic
939363462 2:141203562-141203584 TTAGACTCCCACACAATAATGGG + Intronic
939507981 2:143072539-143072561 TAAGAATCAGATACAATAATTGG - Intergenic
940114670 2:150194702-150194724 TTAGACTCCCACACTATAATGGG + Intergenic
940823145 2:158380270-158380292 TGAGATACCCATACAATGCAAGG + Intronic
941482506 2:166034540-166034562 TGAGATTTCCAAACACTAAATGG + Intronic
941566348 2:167113261-167113283 TTAGATTCCCACACAATTATAGG - Intronic
942434870 2:175960089-175960111 TTACACTCCCACACAATAATGGG + Intronic
942744343 2:179214518-179214540 TTAGACTCCCACACAATAATGGG + Intronic
942991190 2:182205196-182205218 AGAGAGTCCCATAGAATATTAGG + Intronic
944423555 2:199556507-199556529 TGAGATTCTCACACAGAAATAGG + Intergenic
944635449 2:201671778-201671800 TTAGACTCCCACACAATAATAGG + Intronic
944764916 2:202854419-202854441 TTAGACTCGCACACAATAATAGG + Intronic
944884467 2:204048654-204048676 GGAGATTACCATATAGTAATGGG + Intergenic
946913272 2:224487633-224487655 TCAGACTCCCACACAATAATAGG + Intronic
1169659286 20:7960224-7960246 AGAGACTCCCATATAATGATGGG - Intergenic
1170275544 20:14582840-14582862 TGAGATACTCATATAATAAGAGG + Intronic
1172257804 20:33535313-33535335 TGGGATTCCCTTACAAAAACTGG + Intronic
1174215599 20:48913835-48913857 AGAGGGTCCCATGCAATAATTGG - Intergenic
1181640957 22:24198243-24198265 AGAGATTCCCATGCAAGATTTGG + Intergenic
1182382158 22:29900368-29900390 TGAAATTCACGTAAAATAATAGG + Intronic
949754039 3:7388519-7388541 TGAGATGTCCATAGAAGAATTGG - Intronic
951751368 3:26040238-26040260 TTAGACTCCGACACAATAATGGG - Intergenic
951826912 3:26878395-26878417 TTAGACTCCCACACAATAGTGGG + Intergenic
952073945 3:29672810-29672832 TTAGACTCCCACACAATAATGGG + Intronic
952104419 3:30052640-30052662 TTAGACTCCCACACAATAATGGG + Intergenic
953279222 3:41536510-41536532 TAAGATTCCCAGTCAACAATAGG - Intronic
953433656 3:42860381-42860403 TTAGACTCCCACACAATAATGGG + Intronic
955049077 3:55391233-55391255 TTAGACTCCCACACAATAATGGG + Intergenic
957396663 3:79648111-79648133 TGAGATACCCATACATTATAAGG + Intronic
957506836 3:81132510-81132532 TCACATTCTCAAACAATAATTGG + Intergenic
957747431 3:84363887-84363909 TTAGATTCCCACACAATAATAGG - Intergenic
959519957 3:107314352-107314374 ACAGACTCCCACACAATAATGGG - Intergenic
960257874 3:115530946-115530968 TTAGACTCACACACAATAATAGG - Intergenic
960688319 3:120316084-120316106 TTAGACCCCCACACAATAATAGG + Intergenic
960776775 3:121265003-121265025 TCAGACTCCCACACAATAATAGG + Intronic
962277465 3:134027148-134027170 TGAGATTCTCACTCAATAGTGGG - Intronic
964147360 3:153481420-153481442 TGAAATTCTCACACATTAATAGG - Intergenic
965983632 3:174724002-174724024 AGAAATTCCCTTAAAATAATGGG + Intronic
966152585 3:176880326-176880348 TTAGACTCCCACACAATAGTGGG + Intergenic
968692380 4:1999668-1999690 TTAGACTCCCACACAATAATAGG + Intronic
969831897 4:9804658-9804680 AGTGATTCCAACACAATAATAGG - Intronic
971437483 4:26642957-26642979 TTAGACTCCCACACAATAATGGG + Intronic
971655238 4:29335923-29335945 TGAGATTCACCTACAATATATGG - Intergenic
972949106 4:44296377-44296399 TGACCTTCCCATACAATCAATGG + Intronic
973531052 4:51837249-51837271 TGTGATTTCCATAAAATAAAAGG + Intergenic
973753161 4:54044181-54044203 TTACACTCCCACACAATAATGGG + Intronic
974177215 4:58339606-58339628 TTAGACTCCCACACAATAATGGG + Intergenic
976319370 4:83695520-83695542 TGAGATTCTCAAAGAATACTAGG - Intergenic
977218595 4:94312750-94312772 TGAGATTCCCATACAATAATGGG - Intronic
979937049 4:126710942-126710964 TGAGAAGACCAGACAATAATAGG + Intergenic
980037577 4:127903109-127903131 TTAGACTCCCACATAATAATGGG - Intergenic
980740212 4:136940474-136940496 TTATATTCCCATATAAAAATAGG - Intergenic
982989928 4:162260172-162260194 TGATATTCCCACTTAATAATGGG - Intergenic
983893710 4:173058781-173058803 TAAGATTCTCATTCAATACTGGG + Intergenic
985353076 4:189087493-189087515 TGAGATTTCCATACTAAAAATGG + Intergenic
986418295 5:7550420-7550442 AGATATTCCCATAGAACAATGGG - Intronic
987605400 5:20128168-20128190 TGAGGTTCACAAACATTAATAGG - Intronic
987896723 5:23955723-23955745 TTAGGCTCCCACACAATAATAGG - Intronic
987923832 5:24315573-24315595 ATAGACTCCCACACAATAATAGG - Intergenic
988076054 5:26356702-26356724 AGTGATTCCAATACAATAATAGG - Intergenic
988608045 5:32698587-32698609 ATAGATCCCAATACAATAATAGG - Intronic
989623229 5:43405036-43405058 TTAGACTCCCACACAATAATGGG + Intronic
989665797 5:43852493-43852515 TGAGATTCCTAAACAGCAATGGG + Intergenic
990860142 5:60318098-60318120 TTAGACGCCCATACAATAATGGG - Intronic
993341404 5:86729450-86729472 TTACACTCCCACACAATAATGGG - Intergenic
993477280 5:88380881-88380903 TCAGATTCCCATTCATTACTGGG - Intergenic
993837435 5:92833080-92833102 TTGGACTCCCATATAATAATGGG - Intergenic
995012519 5:107273975-107273997 TTTGATACCCACACAATAATGGG + Intergenic
995983147 5:118132880-118132902 TTAGACTCCCACACAATAATGGG - Intergenic
996481984 5:123986230-123986252 TTAGACTCCCACACAATAATAGG - Intergenic
996893407 5:128451120-128451142 TGAGCTTACCAAAAAATAATAGG - Intronic
996953010 5:129150764-129150786 TTAGACTCCCACACAATAATAGG - Intergenic
998290942 5:140914184-140914206 AGAGATCACAATACAATAATAGG - Intronic
999335814 5:150715528-150715550 TGTGATCCCCATACAACAAATGG - Intronic
999488421 5:152024304-152024326 TTAGACTCCCACACAATAGTGGG - Intergenic
1001003365 5:168028634-168028656 TGAATTTCCCACACAATATTTGG - Intronic
1008536894 6:52513101-52513123 TGACATTCCTATAAAATTATTGG + Intronic
1010670301 6:78678533-78678555 TTAGACTCCCATGGAATAATGGG + Intergenic
1011137156 6:84113203-84113225 TTAGACTCCCACACAATAATGGG - Intergenic
1012176831 6:96097256-96097278 TGTGATTCCCACACTATATTAGG - Intronic
1012697152 6:102400567-102400589 TGAGATTACGATAGAAGAATAGG - Intergenic
1012878678 6:104759079-104759101 TTAGACTCCCACACAATAATGGG + Intronic
1012983360 6:105852753-105852775 TGGGATTCCCTTACAAAAACTGG + Intergenic
1013860640 6:114631613-114631635 TTAGACTCCCACACAATAATGGG - Intergenic
1014120908 6:117723808-117723830 TTAGACTCCCAAACAATAGTAGG + Intergenic
1014567134 6:122963238-122963260 AGAAATTCCTATACAATAAATGG + Intergenic
1016483250 6:144505867-144505889 TTAGACTTCCACACAATAATAGG - Intronic
1018782843 6:167084553-167084575 TTAGACTCCCACACAATAATGGG - Intergenic
1020940624 7:14530580-14530602 TGAGTTTACCATACGATATTGGG + Intronic
1021071912 7:16251254-16251276 TTAGACTCCCACCCAATAATAGG + Intronic
1022929467 7:35095346-35095368 GTAGACTCCCACACAATAATGGG + Intergenic
1024706999 7:51971911-51971933 TGAACTTCCCATGCAATATTCGG + Intergenic
1024740550 7:52349327-52349349 TGAGATTCTATTACAATATTAGG - Intergenic
1025802666 7:64801762-64801784 TTAGATTCTGATACAATAGTGGG - Intronic
1027637347 7:80691518-80691540 TTAGACTCCCACACAATAATAGG + Intergenic
1027760955 7:82278144-82278166 TATGATTCCCATATAAAAATAGG + Intronic
1028329898 7:89577264-89577286 TTAGACTTCCACACAATAATGGG + Intergenic
1028429692 7:90733433-90733455 TTAGACTCCCAAACAATAGTAGG - Intronic
1029809764 7:103035309-103035331 TGGGATTCCCAGACACAAATGGG + Intronic
1030897535 7:115079598-115079620 TGTGATTCAAAGACAATAATAGG - Intergenic
1032756446 7:134895479-134895501 TAAGACTCCCATCCAAAAATGGG + Intronic
1033831440 7:145258608-145258630 TTAGACAGCCATACAATAATAGG + Intergenic
1037071460 8:14655441-14655463 TGTCATTCCCATAAAACAATTGG - Intronic
1040669259 8:49668409-49668431 TGAAATTCCAATACAAATATTGG - Intergenic
1040848523 8:51873259-51873281 TGGATTTCCCATACAATAAAGGG + Intronic
1041609396 8:59827110-59827132 AGAGAGCCCCATAGAATAATGGG - Intergenic
1042305259 8:67324459-67324481 TGAGTTTGCCATAGAATTATAGG - Intronic
1043813827 8:84777151-84777173 TGAGTTTCCAAGACAATAAAGGG + Intronic
1044111083 8:88275187-88275209 TTAGATTCACACAAAATAATGGG - Intronic
1044243510 8:89913892-89913914 TGAGATTCCCAAAAGAAAATAGG + Intronic
1044786447 8:95798834-95798856 TTAGACTCCCACACAATAATGGG - Intergenic
1047543055 8:125789230-125789252 TGAGATTCCAAAATAATTATTGG + Intergenic
1050368774 9:4899690-4899712 TTAGACTCCCACACAATAGTAGG - Intergenic
1050370665 9:4918659-4918681 TTAGACTCCCACACAATAGTAGG - Intergenic
1050425094 9:5504534-5504556 TCAGACTCCCATACAACAATAGG + Intergenic
1050841599 9:10156747-10156769 TTAGACTCCCATGCAACAATAGG - Intronic
1051597752 9:18842649-18842671 TTAGACTCCCACACAATAATGGG - Intronic
1052724668 9:32215442-32215464 TTAGACTCCCACACAATAATCGG - Intergenic
1054796053 9:69302907-69302929 TGAGATTCACATGCAATTATGGG + Intergenic
1056163781 9:83922694-83922716 GGACATTCACATACAATATTTGG + Intergenic
1058214924 9:102221520-102221542 TTAGACTCGCACACAATAATGGG - Intergenic
1058224198 9:102339729-102339751 TTAGACTCCCACACAATAATGGG + Intergenic
1059020656 9:110572961-110572983 AGAGATTCCTATATAATACTAGG + Intronic
1186369840 X:8935763-8935785 TTAGATTCCCACACAATAGTGGG - Intergenic
1186431190 X:9505832-9505854 TTAGACTCCCACACAATAATAGG + Intronic
1186968272 X:14811694-14811716 TTAGACTCCCATATAATAATGGG + Intergenic
1187161290 X:16767779-16767801 TGTGGTTCCCATGCAAGAATGGG - Intergenic
1188190897 X:27170504-27170526 TGAGATTTCCATTAAATTATGGG - Intergenic
1188420778 X:29988574-29988596 TGAAATCAACATACAATAATGGG - Intergenic
1188796627 X:34474564-34474586 TGTTATTCCCAAACAATATTGGG + Intergenic
1190600389 X:52086816-52086838 TTAGACTCCCACACAATAATAGG - Intergenic
1190806064 X:53838056-53838078 ATAGATTCCAATACAATAATAGG - Intergenic
1190936681 X:55004153-55004175 TGAGAATACCATCCTATAATTGG - Intronic
1192923417 X:75731851-75731873 TTAGATTCCCACATAATAATTGG - Intergenic
1193017594 X:76753237-76753259 AGAGACACCAATACAATAATAGG + Intergenic
1193068274 X:77280362-77280384 TTAGATAACTATACAATAATAGG + Intergenic
1193163310 X:78254174-78254196 AGAGTGTCCAATACAATAATAGG - Intergenic
1193270406 X:79522876-79522898 TTAGATAACCACACAATAATAGG + Intergenic
1193623393 X:83785987-83786009 TGAGATGACAATAAAATAATTGG + Intergenic
1193703635 X:84793241-84793263 TTAGACTCTCATAAAATAATAGG + Intergenic
1194208273 X:91037746-91037768 TTAGACTCCCACACAATAATTGG - Intergenic
1194542752 X:95194716-95194738 TTAGACTCCCACACAATAACAGG - Intergenic
1198178491 X:134180802-134180824 TGACATTCCTAAACAACAATGGG - Intergenic
1201245637 Y:12001074-12001096 TTAGACTCCCACACAATAATAGG - Intergenic
1202355930 Y:24048752-24048774 TGACATTCCCATATAAAAACTGG - Intergenic
1202514848 Y:25621357-25621379 TGACATTCCCATATAAAAACTGG + Intergenic