ID: 977218978

View in Genome Browser
Species Human (GRCh38)
Location 4:94316331-94316353
Sequence GATAGACGTTGCCATGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 88}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977218978_977218981 28 Left 977218978 4:94316331-94316353 CCTTCCACATGGCAACGTCTATC 0: 1
1: 0
2: 1
3: 1
4: 88
Right 977218981 4:94316382-94316404 CAAATTTTTCGTATTTTTCTTGG 0: 1
1: 0
2: 5
3: 141
4: 2792

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977218978 Original CRISPR GATAGACGTTGCCATGTGGA AGG (reversed) Intronic
901963623 1:12847844-12847866 GATAGACGTTGACGTTTCGAGGG + Exonic
903498846 1:23791045-23791067 GATAGAAGCTGCCATGTTGGAGG - Exonic
904058513 1:27687946-27687968 GGTAGAGGTTGCTAGGTGGAAGG - Intergenic
907168561 1:52438262-52438284 GATAGATGTTGCCGTGTGTGTGG - Exonic
912454039 1:109785992-109786014 GAAAGAGGTTGCCCTGGGGAAGG + Intergenic
916590429 1:166184877-166184899 GCTAGATGTTGCCAAGTGAAAGG + Intergenic
920046744 1:203137817-203137839 AATAGAGGTTGCCTTTTGGAGGG - Intronic
920881378 1:209883468-209883490 TTTAGTTGTTGCCATGTGGATGG + Intergenic
924599505 1:245476093-245476115 GATGCATGCTGCCATGTGGATGG + Intronic
1067306648 10:45070945-45070967 GATAGTGTTTGTCATGTGGATGG + Intergenic
1073957355 10:108888939-108888961 GAGAGACATTGCCTTGTGCAAGG - Intergenic
1091120524 11:133053860-133053882 AAGTGAAGTTGCCATGTGGATGG - Intronic
1094631897 12:32183872-32183894 GATAGAGGTTGCTAGGGGGAGGG + Intronic
1104238268 12:126960971-126960993 CCTAGACGTTGCCATGGGGTGGG - Intergenic
1106796996 13:33216972-33216994 AATGGAGGTTGCCAGGTGGAGGG + Intronic
1108159091 13:47619089-47619111 TTTAGCAGTTGCCATGTGGATGG - Intergenic
1111959425 13:94793776-94793798 GATACACGCTACAATGTGGATGG + Intergenic
1114234476 14:20812503-20812525 GCAAAACGTTGCAATGTGGACGG - Intergenic
1114778899 14:25516436-25516458 GATATAAATTGCCATGGGGATGG - Intergenic
1120410384 14:84146635-84146657 GATAGTGGTTGCTAGGTGGAGGG - Intergenic
1120596835 14:86450243-86450265 GACAGCAGTTACCATGTGGATGG - Intergenic
1122844408 14:104483775-104483797 GAGGGACTTTGCCAGGTGGAGGG + Intronic
1123777067 15:23590562-23590584 GAGAGAAGCTGCAATGTGGAGGG + Intronic
1124211254 15:27766837-27766859 AATAGAGGTTGCTAGGTGGAGGG + Intronic
1124649005 15:31461352-31461374 AATAGAGGTTGCTAGGTGGAGGG - Intergenic
1125907158 15:43403537-43403559 GATAGACACTGCCACGTGCAAGG - Exonic
1127187732 15:56497062-56497084 GGTAGACGTTGCCTTTAGGAAGG + Intergenic
1132316915 15:100897154-100897176 GACAGACACTGCCCTGTGGATGG + Intronic
1135956787 16:26962630-26962652 AATGGAAGTTGCCAGGTGGAGGG + Intergenic
1137937493 16:52648541-52648563 GAGAGACATTGCCATATAGAAGG - Intergenic
1138849078 16:60605037-60605059 CCTAGACGTTGCCATGGGGTTGG - Intergenic
1144821295 17:18076531-18076553 GGTAGAAGTTGCCATTTAGATGG - Intergenic
1147555169 17:41474103-41474125 GATAGAAGGTGCTACGTGGATGG - Intergenic
1149526846 17:57363198-57363220 GATAGATGCTACAATGTGGATGG + Intronic
1149693990 17:58601872-58601894 GATAGACATTGACATCGGGATGG + Exonic
1150526296 17:65926371-65926393 TATAGCCTTTGCCAGGTGGAGGG - Intronic
1155922322 18:31615759-31615781 GCAAGATGTTGCCATGAGGAGGG - Intergenic
1165223110 19:34333791-34333813 GAGGCACGTTACCATGTGGATGG - Exonic
1166050812 19:40257832-40257854 GAGACATGCTGCCATGTGGAGGG + Intronic
1168003486 19:53467632-53467654 GAGAGACTTTGCCCTTTGGAAGG - Intergenic
934165331 2:89289016-89289038 CATACATGTGGCCATGTGGAAGG + Intergenic
934201943 2:89893446-89893468 CATACATGTGGCCATGTGGAAGG - Intergenic
938791683 2:134681724-134681746 GATTGAAGTTGCCATGTGCTGGG - Intronic
1170868414 20:20181688-20181710 GATGGAAGAAGCCATGTGGATGG + Intronic
1171403939 20:24897161-24897183 AATGGAGGTTGCCAGGTGGAGGG + Intergenic
1176160352 20:63644373-63644395 GATAGAGGCAGCCATGGGGAGGG - Intronic
950924082 3:16722799-16722821 AATAGATGTTGTCATGAGGATGG - Intergenic
961179810 3:124867644-124867666 GTTAGGCATTGCCATGTGGCTGG + Intronic
961744668 3:129056818-129056840 GACAGAAGTTGGCATGTGGGTGG + Intergenic
966730162 3:183144328-183144350 CATAGACTTTGCCTTGGGGATGG + Intronic
968453094 4:684230-684252 GACTGACGGTGCCCTGTGGATGG - Intronic
970517742 4:16850212-16850234 GCTAGATGTGTCCATGTGGAGGG - Intronic
977218978 4:94316331-94316353 GATAGACGTTGCCATGTGGAAGG - Intronic
983114870 4:163802210-163802232 GATAGACTCTGGCATGTTGAGGG - Intronic
985205542 4:187531243-187531265 GGTAGAGGTTGCAATGAGGAAGG + Intergenic
990485960 5:56259495-56259517 AGGAGACTTTGCCATGTGGAAGG - Intergenic
992942038 5:81772097-81772119 GATAGACCTTTCCAGGTGGTAGG + Intergenic
994520019 5:100822177-100822199 AATAGAGATTGACATGTGGAGGG - Intronic
994583269 5:101674846-101674868 AATAGACAATGCCATGTAGATGG - Intergenic
997816462 5:137023635-137023657 GACAGAAGGTGCCATGAGGAAGG + Intronic
998649616 5:144103508-144103530 GAAAATCGATGCCATGTGGATGG + Intergenic
999073800 5:148776078-148776100 GATAGAATTTGGCATGTGGTAGG - Intergenic
999121265 5:149211273-149211295 GAGAGGCGTTGCCATGGTGATGG - Intronic
1000839096 5:166194220-166194242 AATAGACGTTTCCATGTTTATGG + Intergenic
1003209598 6:4049755-4049777 GATAAACGTTACAATGTGTATGG + Exonic
1003483930 6:6558201-6558223 GATAGACTTTGACAGGTGAATGG - Intergenic
1005329690 6:24737608-24737630 GACAGAAGTTGGAATGTGGAGGG + Intergenic
1011549784 6:88520595-88520617 GACACACGTGGCCATCTGGAAGG + Intergenic
1018056203 6:160054494-160054516 GATGGACGTTGTCAGGTGGTAGG + Intronic
1018671055 6:166177780-166177802 GAGAGACACGGCCATGTGGAGGG + Intergenic
1018688823 6:166326652-166326674 GCTAGAAGCTGGCATGTGGAAGG + Intronic
1022303205 7:29121040-29121062 GATGGTTGGTGCCATGTGGAAGG - Exonic
1023451974 7:40295934-40295956 GATTTACTTTGCCATGTGTAGGG + Intronic
1029576296 7:101405808-101405830 GATTGAGTTTTCCATGTGGAGGG - Intronic
1030718150 7:112835362-112835384 GATAGAAGTGGGCAAGTGGATGG + Intronic
1030971855 7:116067275-116067297 CATAGACGTTTCCATGTCTAAGG + Intronic
1038249982 8:25894430-25894452 GAAAGAAGTTGGCTTGTGGAAGG - Intronic
1049163439 8:141112062-141112084 GGAACACGTTGCCCTGTGGAGGG + Intergenic
1049999781 9:1065074-1065096 GATAGACTTGGCCACGAGGATGG + Intergenic
1053132082 9:35621342-35621364 GATAGAATTTGCCATGTGGAAGG + Intronic
1056716771 9:89037892-89037914 GATAGAGGTGGGAATGTGGAGGG + Intronic
1059567313 9:115395808-115395830 GATAAACATGGCCAGGTGGAAGG - Intronic
1061210100 9:129186519-129186541 GAGAGACGCTGCCATGAGGAAGG - Intergenic
1061734452 9:132643966-132643988 GATAGACGTTACTATTTGCATGG - Intronic
1189311792 X:40024214-40024236 GATGGAGGTTGCTAGGTGGAGGG + Intergenic
1189436605 X:40998359-40998381 GAGAGAGGTTGGCAGGTGGATGG - Intergenic
1190473886 X:50809312-50809334 GATAGAGGTTGTCTTGTGGCTGG - Intronic
1198100528 X:133418132-133418154 GATACATGTTACCATATGGATGG - Intergenic
1201765243 Y:17568953-17568975 GATATACCTTGCCTGGTGGAGGG + Intergenic
1201836309 Y:18337036-18337058 GATATACCTTGCCTGGTGGAGGG - Intergenic
1202510925 Y:25573800-25573822 GAGAAACGGTGCCATATGGACGG + Intergenic