ID: 977220231

View in Genome Browser
Species Human (GRCh38)
Location 4:94329484-94329506
Sequence TAGCTAGTTTTATCTCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977220231_977220233 3 Left 977220231 4:94329484-94329506 CCTGGAGGAGATAAAACTAGCTA 0: 1
1: 0
2: 0
3: 11
4: 126
Right 977220233 4:94329510-94329532 GGAACATAACCACCTCAAATAGG 0: 1
1: 0
2: 0
3: 5
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977220231 Original CRISPR TAGCTAGTTTTATCTCCTCC AGG (reversed) Intronic
904943656 1:34182931-34182953 TGGCTAGTGTTTTCTCCTCTTGG - Intronic
906305938 1:44719219-44719241 AAGCTAGTTTTGTCTCATCCTGG - Intronic
906987893 1:50706560-50706582 GTTCTATTTTTATCTCCTCCTGG + Intronic
910572312 1:88719273-88719295 TAACTAGTTTTATTTCCTCAGGG + Intronic
911463421 1:98220075-98220097 TATTTAATTTTATTTCCTCCAGG - Intergenic
912226782 1:107742952-107742974 TAGCTGGTTCTATATCCTGCAGG - Intronic
912729216 1:112087117-112087139 TAGATTCTTTTCTCTCCTCCAGG - Intergenic
913277360 1:117151988-117152010 TAGCTATTTTTATATCATCTTGG + Intronic
914331585 1:146676269-146676291 AAGCTAGTTATATTTCTTCCTGG - Intergenic
918697768 1:187564765-187564787 TATCAAGTTTTATTTTCTCCCGG - Intergenic
918937121 1:190935592-190935614 TAGATAATTTTATCCCCTACTGG - Intergenic
919061843 1:192643515-192643537 TATCTGGTTTTATCTACTCTGGG - Intronic
919316587 1:195978728-195978750 TTTCTAGTTTTATTTCATCCTGG + Intergenic
919443173 1:197665356-197665378 AAGCTGCTTTTATCTACTCCTGG - Intronic
923108228 1:230870332-230870354 TGGCTATTTTTATTCCCTCCAGG - Intergenic
923778690 1:237002197-237002219 TTGCTGCTTTTCTCTCCTCCTGG + Intergenic
1065058002 10:21867620-21867642 TAGCCAGCTTGATCTACTCCTGG - Intronic
1074195342 10:111179503-111179525 CAGCTATTTATATATCCTCCTGG + Intergenic
1075214293 10:120518454-120518476 TAACTTTTTTTATTTCCTCCTGG - Intronic
1079322958 11:19467515-19467537 TAACTTGTTTTATCACATCCTGG + Intronic
1080360536 11:31508313-31508335 GTGTTAATTTTATCTCCTCCAGG + Intronic
1082891738 11:58146259-58146281 TATCTACTTTTATCTCCTTTAGG + Intronic
1086270822 11:85064609-85064631 TAGTTAGTTTTATCTCAACTTGG + Intronic
1090325358 11:125881652-125881674 TACCTACTTTTATCTCCACCTGG + Intergenic
1090796884 11:130142916-130142938 TACTTGGTTTTATCTCCTGCTGG + Intronic
1093108720 12:15122301-15122323 TAACTAGTTTTATTTCTTCAAGG - Intronic
1097005111 12:55911066-55911088 TAGCTAGATCTATTTCTTCCAGG - Intronic
1099109679 12:78542804-78542826 TAGCTAGTTTATTAACCTCCTGG - Intergenic
1099712386 12:86243952-86243974 TGGCCAGTCTTTTCTCCTCCTGG - Intronic
1100699574 12:97132039-97132061 TATCTAGTTTTATCTGCACTGGG - Intergenic
1101208717 12:102514551-102514573 TAGCTGCTTTTTTCTCTTCCTGG - Intergenic
1101718146 12:107329043-107329065 TAGCTGGCTTTATCGTCTCCAGG + Intronic
1102967666 12:117140765-117140787 TAGCCAGCTTTATCACCTCTTGG - Intergenic
1103750046 12:123151901-123151923 TAGCTTGTCCTCTCTCCTCCAGG - Intergenic
1107717268 13:43212843-43212865 TACCTTGTTTTGTGTCCTCCTGG - Intergenic
1109496176 13:63175725-63175747 TAGCAAGTGTTATGTCCCCCTGG - Intergenic
1112605210 13:100897699-100897721 TGGCTAATTTTATGTCCACCTGG - Intergenic
1112876517 13:104047017-104047039 TAACCAGTTTTATGTTCTCCTGG - Intergenic
1114208058 14:20591729-20591751 TAGCGAGTTTCATTTCCACCCGG + Intronic
1114831142 14:26143314-26143336 TAGCAAGTTGTCTCTCTTCCGGG + Intergenic
1116501673 14:45631716-45631738 TACCTGGTTTTATCTACTCTGGG + Intergenic
1119406217 14:74401330-74401352 AAGCCAGTTCTAGCTCCTCCAGG - Intergenic
1125283079 15:38063870-38063892 AAGCTAGGTTTATTTCCACCTGG + Intergenic
1126999931 15:54490940-54490962 CAGCTAAATTCATCTCCTCCAGG + Intronic
1127649089 15:60988780-60988802 GACCTAGATTTATCTACTCCAGG + Intronic
1134775557 16:16850214-16850236 TACCGAGGTTTATCTCCTCCAGG - Intergenic
1138296704 16:55891989-55892011 TAGCTAGATTTTTTTCTTCCAGG + Intronic
1140001970 16:71034631-71034653 AAGCTAGTTATATTTCTTCCTGG + Intronic
1140572509 16:76125408-76125430 TAGCTCATTTTATCTGTTCCAGG + Intergenic
1141601645 16:85130367-85130389 GAGCTAGGTTTTTCTCTTCCAGG + Intergenic
1147517175 17:41130949-41130971 AAGCTCGTTTTATTTCCTTCTGG + Intergenic
1148808588 17:50276684-50276706 TACCTAGTTTCATTTCATCCTGG - Intronic
1152122121 17:78425271-78425293 GAGCTAGTTTTATCTTGTCTTGG + Intronic
1152293663 17:79454521-79454543 TAGCTATTTGTAGGTCCTCCTGG + Intronic
1155260759 18:24039712-24039734 TAACTTGTTTTCTTTCCTCCAGG - Intronic
1158596943 18:58824861-58824883 GAACTAGTTTTACATCCTCCTGG - Intergenic
1163626138 19:18390941-18390963 TCTCTAGTTCTATCTCCCCCAGG + Intergenic
927398794 2:22686846-22686868 GAGGAAATTTTATCTCCTCCTGG - Intergenic
930881856 2:56279179-56279201 TGGCTAGTATTATCTTCTCAAGG + Intronic
931030064 2:58164582-58164604 TAGCTTCTTTTTTCTCCTCCAGG - Intronic
931325230 2:61214865-61214887 TATCTATTTTTATCACCTCTTGG - Intronic
935386108 2:102501613-102501635 TAGCTAGTTCTGGCCCCTCCAGG - Intronic
935589593 2:104834449-104834471 TAGCTGATTATATGTCCTCCTGG + Intergenic
939558967 2:143711383-143711405 TAGCTTGTTTCATGTCCTCTGGG - Intronic
941850683 2:170177127-170177149 TACCTAGATTTATCTGCTCCAGG + Intergenic
942039142 2:172040559-172040581 TATTTAGTTTGATCTCCCCCTGG - Intronic
942555829 2:177171454-177171476 TAGCAGGTCTTATCTCCTTCTGG + Intergenic
947155677 2:227160745-227160767 TAGCTAGTTTTCTGTCCTGCAGG - Intronic
1168927733 20:1596818-1596840 CAGCTAGCATCATCTCCTCCTGG - Intronic
1172022663 20:31925343-31925365 TAGCAGGTTTTATCTCATTCAGG + Intronic
1172081734 20:32346848-32346870 TCGCTTGTTTAATTTCCTCCTGG + Intergenic
1172663798 20:36585566-36585588 AAGCTTGTTTTATCTCTCCCTGG + Intronic
1177856612 21:26406956-26406978 GAGCCAGTTTTCTCTCCTCAAGG + Intergenic
1184077394 22:42190622-42190644 TTGTTAGCTTTAACTCCTCCTGG - Intronic
1184848583 22:47104335-47104357 TAGCTAGATTTTTTTCTTCCAGG + Intronic
955877376 3:63506410-63506432 AAGCTTATTTTGTCTCCTCCAGG + Intronic
957588181 3:82159640-82159662 TAGTAAGTTTCTTCTCCTCCAGG - Intergenic
959463847 3:106660633-106660655 TAACTAATTTTATTTCCTCTTGG - Intergenic
963018478 3:140848773-140848795 TATCTTGTTTTTTCTCCTCTTGG - Intergenic
964315932 3:155444288-155444310 TAGCTAGATTAACCTCCTCATGG + Intronic
965727748 3:171736851-171736873 TAGCTACTTTTCTCTGTTCCTGG - Intronic
968310772 3:197681558-197681580 CAGCTGGTTTTATTTCCTCAGGG - Intronic
972476402 4:39454087-39454109 TAGCTAGTTTTTTTCCCTCGTGG - Intergenic
972590581 4:40482214-40482236 AGGCTAGTTATACCTCCTCCAGG - Intronic
972882538 4:43443707-43443729 TTTCTGGTTTTATATCCTCCAGG - Intergenic
976970801 4:91099913-91099935 TAGCTAGTTTTTTTTCTTCCTGG - Intronic
977220231 4:94329484-94329506 TAGCTAGTTTTATCTCCTCCAGG - Intronic
977244061 4:94608657-94608679 CAGCTAATTTTTTCTTCTCCAGG - Intronic
977367787 4:96093670-96093692 TAGCTAGGCTTATAACCTCCAGG + Intergenic
978111252 4:104966528-104966550 TAACTAGTTTTATCAGCCCCTGG - Intergenic
978281644 4:107023426-107023448 TATCTAGTTTTGTCTCATCCAGG - Intronic
983318350 4:166162656-166162678 TACCTATTTTTATAACCTCCAGG - Intergenic
986994052 5:13585998-13586020 TTTCTAATTTTTTCTCCTCCAGG - Intergenic
988568070 5:32336473-32336495 TAGCTAGATTTTTTTCTTCCAGG - Intergenic
988708155 5:33745572-33745594 CTGCTTGTCTTATCTCCTCCAGG - Intronic
989084780 5:37664345-37664367 TCTCCAGTTTTATCTGCTCCTGG + Intronic
990726536 5:58761584-58761606 CAGCTCTTTTTATGTCCTCCTGG + Intronic
991193307 5:63901578-63901600 AAGACAGTTTTATCTCCTTCTGG - Intergenic
994811563 5:104525461-104525483 CATCTAGTTTCATCTCCGCCTGG + Intergenic
995002572 5:107152433-107152455 TAGCTACTTTTGTCTACACCTGG + Intergenic
997412256 5:133699291-133699313 TGGCTAGTTTTGTTTCCTCCTGG - Intergenic
1000547521 5:162621515-162621537 CAGCAAGCTTTATTTCCTCCAGG + Intergenic
1000647041 5:163771552-163771574 TAGTTAGTGTTTTCTCCTGCGGG + Intergenic
1000767671 5:165311804-165311826 ACTCAAGTTTTATCTCCTCCAGG - Intergenic
1001732509 5:173970859-173970881 TAGCTGGTTTAATTTCCTCGAGG - Intergenic
1007293182 6:40802264-40802286 TAGCTTGGTTTATGTCCTTCCGG + Intergenic
1009357183 6:62765116-62765138 TAGCTAGATTTTTTTCTTCCAGG - Intergenic
1010778395 6:79913131-79913153 TAGGTTTTTTAATCTCCTCCAGG + Intergenic
1016290248 6:142520918-142520940 TAGTTGGTGTTATCTTCTCCAGG + Intergenic
1018392778 6:163353080-163353102 TAGCTACTGTGATCTCCTTCTGG - Intergenic
1023087450 7:36585589-36585611 TAGTTATTTTTTTCTCCTACAGG - Intronic
1023462406 7:40413282-40413304 CAGCTAGTTTCTTTTCCTCCCGG + Intronic
1024486697 7:49927641-49927663 GAGCTAGTGTAATTTCCTCCTGG - Intronic
1027856069 7:83513281-83513303 CATCTACTTTAATCTCCTCCAGG + Intronic
1029380776 7:100213133-100213155 TAGCTTGCTGTTTCTCCTCCAGG - Intronic
1030513902 7:110518398-110518420 TTGCTAGTCTTATATACTCCTGG + Intergenic
1034574531 7:151985731-151985753 TAACTGCCTTTATCTCCTCCAGG + Intronic
1037557929 8:20043536-20043558 TAGCTAGTTTGGGCTTCTCCAGG + Intergenic
1037636246 8:20703234-20703256 TTTCTAGTTCTATCTCCTTCTGG + Intergenic
1037697427 8:21237219-21237241 TATCTTGTTTTATTTCCTCATGG - Intergenic
1037802964 8:22044991-22045013 TTGCTGGTTTTGTCTCCACCTGG - Intronic
1038739087 8:30200812-30200834 TAGCTAGATTTTTTTCTTCCAGG + Intergenic
1039554091 8:38464712-38464734 TTGATAGTTTAATTTCCTCCTGG - Intronic
1039859337 8:41443428-41443450 TAGCTGGGTTTATATCTTCCAGG - Intergenic
1040714108 8:50226407-50226429 TAGCTAGTTTTTTTTCTTCCAGG + Intronic
1043023057 8:75029052-75029074 TAGCTTCTTTTATCTCTTCTAGG - Intronic
1046021785 8:108674064-108674086 TACCTAGTTTTGTCAACTCCAGG - Intronic
1047946047 8:129881545-129881567 TAGCTATTTGTATTTCCTCATGG - Intronic
1048151363 8:131898109-131898131 TAACTGGTTTTATCTGCTCAGGG + Intergenic
1054937689 9:70706137-70706159 GAGCTAGGTTTCTCTCCTTCTGG - Intronic
1054939380 9:70724130-70724152 GAGCTAGGTTTCTCTCCTTCTGG - Intronic
1058319737 9:103614508-103614530 TTGGTGGTTTTATGTCCTCCTGG + Intergenic
1058707198 9:107647419-107647441 TAGCTATTTTTAGCTCTTCTTGG + Intergenic
1186556807 X:10568651-10568673 TAGCTATGTTGCTCTCCTCCAGG + Intronic
1186761017 X:12721567-12721589 TAGCTAGGAGCATCTCCTCCGGG - Exonic
1188492344 X:30750707-30750729 TGGCTATTTTTATGTCCTCTTGG + Intergenic
1192343002 X:70279713-70279735 TAGCTCATTCTACCTCCTCCAGG - Intronic
1196414292 X:115454552-115454574 TAGCTACTGTCATATCCTCCAGG + Intergenic