ID: 977222456

View in Genome Browser
Species Human (GRCh38)
Location 4:94354208-94354230
Sequence GGTTCTTTGGAGATTGTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977222456_977222463 13 Left 977222456 4:94354208-94354230 CCATGGACAATCTCCAAAGAACC No data
Right 977222463 4:94354244-94354266 GGGTCAGTCACAGTCCAATCAGG No data
977222456_977222460 -8 Left 977222456 4:94354208-94354230 CCATGGACAATCTCCAAAGAACC No data
Right 977222460 4:94354223-94354245 AAAGAACCATGGAGGAAGATAGG No data
977222456_977222461 -7 Left 977222456 4:94354208-94354230 CCATGGACAATCTCCAAAGAACC No data
Right 977222461 4:94354224-94354246 AAGAACCATGGAGGAAGATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977222456 Original CRISPR GGTTCTTTGGAGATTGTCCA TGG (reversed) Intergenic
No off target data available for this crispr