ID: 977226669

View in Genome Browser
Species Human (GRCh38)
Location 4:94400003-94400025
Sequence TAAGTGTGTGGGCCCCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977226660_977226669 29 Left 977226660 4:94399951-94399973 CCAACCAGCAACTGTATGAAGTG No data
Right 977226669 4:94400003-94400025 TAAGTGTGTGGGCCCCTGGAAGG No data
977226661_977226669 25 Left 977226661 4:94399955-94399977 CCAGCAACTGTATGAAGTGCTAA No data
Right 977226669 4:94400003-94400025 TAAGTGTGTGGGCCCCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977226669 Original CRISPR TAAGTGTGTGGGCCCCTGGA AGG Intergenic
No off target data available for this crispr