ID: 977231064

View in Genome Browser
Species Human (GRCh38)
Location 4:94451974-94451996
Sequence CCTCGGGTCCGGCGCGGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 137}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977231064_977231082 28 Left 977231064 4:94451974-94451996 CCCGCGCCGCGCCGGACCCGAGG 0: 1
1: 0
2: 0
3: 20
4: 137
Right 977231082 4:94452025-94452047 CTCGGATCTCCGGTGGGAGAAGG 0: 1
1: 0
2: 0
3: 4
4: 69
977231064_977231083 29 Left 977231064 4:94451974-94451996 CCCGCGCCGCGCCGGACCCGAGG 0: 1
1: 0
2: 0
3: 20
4: 137
Right 977231083 4:94452026-94452048 TCGGATCTCCGGTGGGAGAAGGG 0: 1
1: 0
2: 0
3: 5
4: 49
977231064_977231076 10 Left 977231064 4:94451974-94451996 CCCGCGCCGCGCCGGACCCGAGG 0: 1
1: 0
2: 0
3: 20
4: 137
Right 977231076 4:94452007-94452029 CCGGCCGGCGATGCGCCTCTCGG 0: 1
1: 0
2: 0
3: 6
4: 73
977231064_977231074 -5 Left 977231064 4:94451974-94451996 CCCGCGCCGCGCCGGACCCGAGG 0: 1
1: 0
2: 0
3: 20
4: 137
Right 977231074 4:94451992-94452014 CGAGGTGAGTGGCGGCCGGCCGG 0: 1
1: 2
2: 2
3: 14
4: 147
977231064_977231078 18 Left 977231064 4:94451974-94451996 CCCGCGCCGCGCCGGACCCGAGG 0: 1
1: 0
2: 0
3: 20
4: 137
Right 977231078 4:94452015-94452037 CGATGCGCCTCTCGGATCTCCGG 0: 1
1: 0
2: 0
3: 5
4: 24
977231064_977231071 -9 Left 977231064 4:94451974-94451996 CCCGCGCCGCGCCGGACCCGAGG 0: 1
1: 0
2: 0
3: 20
4: 137
Right 977231071 4:94451988-94452010 GACCCGAGGTGAGTGGCGGCCGG 0: 1
1: 0
2: 0
3: 9
4: 109
977231064_977231080 22 Left 977231064 4:94451974-94451996 CCCGCGCCGCGCCGGACCCGAGG 0: 1
1: 0
2: 0
3: 20
4: 137
Right 977231080 4:94452019-94452041 GCGCCTCTCGGATCTCCGGTGGG 0: 1
1: 0
2: 1
3: 1
4: 32
977231064_977231079 21 Left 977231064 4:94451974-94451996 CCCGCGCCGCGCCGGACCCGAGG 0: 1
1: 0
2: 0
3: 20
4: 137
Right 977231079 4:94452018-94452040 TGCGCCTCTCGGATCTCCGGTGG 0: 1
1: 0
2: 0
3: 1
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977231064 Original CRISPR CCTCGGGTCCGGCGCGGCGC GGG (reversed) Exonic
900237546 1:1599944-1599966 CGTCGGGGCGGCCGCGGCGCAGG + Exonic
900237610 1:1600155-1600177 GCTCGGACCCGGCGCGGCGGCGG + Intergenic
900340265 1:2185235-2185257 CCGCGGATCCGCCGCGACGCAGG - Exonic
901506580 1:9689455-9689477 CCTCGGGGCTGGGGCGGGGCCGG - Intronic
902435114 1:16393432-16393454 CCTCGGGGCTGGCGCTGCCCAGG - Exonic
902768124 1:18630441-18630463 CCTCGGGTCCGGCGCCTCTCTGG - Intergenic
902917014 1:19645185-19645207 CCTCGGGGCCGGCGGGAGGCAGG - Intronic
903750582 1:25618051-25618073 GCCCGGGGCCGGCGCGGCGGGGG - Exonic
903907460 1:26696676-26696698 CGGCGGGCCCGGCGCGGAGCCGG + Exonic
903907462 1:26696684-26696706 CTTCAGGTCCGGCTCCGCGCCGG - Exonic
906197181 1:43936402-43936424 CCGCGGGGGCCGCGCGGCGCGGG + Exonic
906382219 1:45340093-45340115 TCCCGGGTCCGGCGCGGGGAAGG - Exonic
915326914 1:155085473-155085495 CCTAGGCTCCGGGGCGGGGCCGG + Intronic
916070710 1:161168106-161168128 CCTCAGGTCCAAGGCGGCGCTGG - Exonic
918511276 1:185316763-185316785 GCGCGGGCCCAGCGCGGCGCGGG + Intronic
919403426 1:197147621-197147643 CCTAGGGTCGGGCGCCGCTCAGG - Intergenic
920612342 1:207454232-207454254 CCTGGGGGCTGACGCGGCGCCGG - Exonic
921692273 1:218164943-218164965 CCTCCAGTCCCGGGCGGCGCCGG + Intergenic
923171603 1:231422069-231422091 CCTAAGCTCCGGCGCAGCGCCGG + Exonic
923171748 1:231422534-231422556 CCTCGGGGACGCCGAGGCGCAGG + Exonic
923372730 1:233328672-233328694 GCGCGGGTCCGGGGCGGCGTTGG - Exonic
1063115350 10:3068254-3068276 CCTCGTGCCCTGCGCGGCGTGGG + Intronic
1069018948 10:63465151-63465173 CCGCGAGTCCGGCGCCGCGCGGG - Intronic
1077049646 11:560957-560979 GCCCGGGTGCGCCGCGGCGCTGG + Intronic
1077360986 11:2139980-2140002 CCGGGGCTCCGGCGCGGCACCGG - Intronic
1077514244 11:2992158-2992180 CCGCGGGTCCGGCGCGGGCGCGG - Intronic
1080418490 11:32091031-32091053 CCTCTGCTCCGGCTCGGGGCGGG + Exonic
1083258120 11:61508891-61508913 CCCGGGGGCCGGCGCGGCTCCGG + Exonic
1083800127 11:65041709-65041731 GCTCGGGCCCGACGCGGCGCGGG + Exonic
1084129140 11:67119621-67119643 CCGGGGGGCCGGGGCGGCGCGGG + Intronic
1084888084 11:72223737-72223759 CCTCGGGCAAGTCGCGGCGCGGG - Intronic
1084888482 11:72224995-72225017 CCCCGGGCCCGGCGCCCCGCAGG - Exonic
1085205821 11:74731336-74731358 CCTGGGGCCCGGCGGGGCGGCGG + Intronic
1095432023 12:42144674-42144696 CGTCGGGGCGGGCGCGGCGGCGG - Exonic
1096143912 12:49264947-49264969 CCGCGGGTGCGGCCGGGCGCAGG + Exonic
1096738876 12:53677205-53677227 GCTCGGGGCCGGGGCGCCGCGGG - Intronic
1098450084 12:70609936-70609958 CCTCGGGGCTGGCGACGCGCAGG + Intronic
1101892836 12:108731585-108731607 GGTTGGGTCCCGCGCGGCGCGGG - Intronic
1104961500 12:132490370-132490392 CCCCGGGCCCGGCGCGGCCTGGG - Exonic
1105964445 13:25372053-25372075 CCTCGGGCGCGGCCCGGCACAGG + Exonic
1106157523 13:27171856-27171878 CCCCGGCTCCGCCCCGGCGCAGG + Exonic
1112402189 13:99086689-99086711 CGGGGTGTCCGGCGCGGCGCGGG + Intergenic
1112574946 13:100627285-100627307 CCACGAGGCCGGCGCGGGGCGGG + Intronic
1113861590 13:113490757-113490779 CCTCGGCTCCGGGGCAGTGCCGG + Exonic
1122505471 14:102229125-102229147 CCGCGGGTGCGGCAGGGCGCAGG + Exonic
1122558231 14:102592788-102592810 GCGCGGGGCCGGCGCGGGGCCGG - Exonic
1122582208 14:102777789-102777811 GCGCGGGCCCGGCGCGGCGCAGG + Intronic
1122624099 14:103075439-103075461 GCTCGGCTCCGGCGCGGAGCGGG - Intergenic
1123630801 15:22258321-22258343 CCCGGGGCGCGGCGCGGCGCGGG + Intergenic
1127789894 15:62390463-62390485 ATTCGGGGACGGCGCGGCGCCGG - Intergenic
1127922576 15:63504848-63504870 CCTCGGGTGCGCTGCGGGGCCGG - Intronic
1129404692 15:75308216-75308238 CCTCGGCTCCCGCGCTGCTCTGG + Intergenic
1129735545 15:77959568-77959590 CCTCGGTTCCCGCGCGGCTCTGG - Intergenic
1129836317 15:78709552-78709574 CCTCGGCTCCCGCGCTGCTCTGG + Intronic
1130517059 15:84633696-84633718 CCTAGGCTCCGGCGCAGCGCAGG - Intergenic
1131052598 15:89358686-89358708 GCTCGGGACCCGCGCAGCGCGGG - Intergenic
1132498867 16:275962-275984 ACCCGGGCGCGGCGCGGCGCGGG - Intronic
1132879528 16:2155868-2155890 CCCCGGGTCGGGCGCGCCGCGGG - Intronic
1132941408 16:2510224-2510246 CCTGGGGTCCTGCCCGGTGCTGG + Intronic
1133325139 16:4937404-4937426 CCTCGGGCCCGGCGCGCCTCTGG + Intronic
1139545650 16:67648403-67648425 CAGCGCGGCCGGCGCGGCGCGGG - Exonic
1140442584 16:74999162-74999184 CCTCGGGCGGGCCGCGGCGCTGG - Exonic
1141683294 16:85556383-85556405 CCCTGGGTCCCGCGCGGCGCCGG + Intergenic
1141840127 16:86568574-86568596 GCCCGGGGCCGCCGCGGCGCAGG + Exonic
1142812228 17:2400727-2400749 CCTCGGCCCCGGCGCGCCCCCGG - Exonic
1144586739 17:16491922-16491944 TCGGGGGCCCGGCGCGGCGCCGG + Exonic
1144816620 17:18039644-18039666 CCTCGGCTCCCGCGCGGCGGCGG + Exonic
1145214447 17:21041988-21042010 CCTCGGGGCCCGCGAGGAGCTGG - Intronic
1147161705 17:38572610-38572632 CCTCGGGTTGGGCGGGGGGCGGG - Intronic
1147617065 17:41835988-41836010 CCTCGGGCCCAGCGTGGCGCAGG - Intronic
1148936292 17:51166596-51166618 CCGCAGGTCCCGCGCGGCGTCGG + Exonic
1149512625 17:57256253-57256275 CCTCCGGGCCGGCAGGGCGCAGG - Intronic
1151370834 17:73645206-73645228 CCGCAGCTCCGGCTCGGCGCAGG - Intergenic
1151875974 17:76868545-76868567 CCATGGGCGCGGCGCGGCGCGGG + Intronic
1151917387 17:77128292-77128314 CCTCTGGTCAGGCGCCGTGCTGG - Intronic
1152413557 17:80144140-80144162 CCTGGGGTGCGGCGCAGGGCTGG - Intronic
1152572814 17:81127986-81128008 CCTGGGGGCCGGCGTGGGGCGGG - Intronic
1152758729 17:82097754-82097776 CCTCGGCTCCGGGGCGGCTCCGG + Intronic
1160453598 18:78980679-78980701 CCTGGGGGGCGGCGCGGCGGCGG - Intronic
1160592148 18:79951017-79951039 CCTCGGGGCCTGCGGGGAGCGGG + Exonic
1161069262 19:2252305-2252327 CCTGGACTCCGGCGCGGGGCCGG + Exonic
1162046759 19:8005366-8005388 CCCCCGGTCCGGCGCGGCCTGGG + Intronic
1162486060 19:10961189-10961211 CCGCGGGGGCAGCGCGGCGCGGG + Intronic
1163607102 19:18281494-18281516 CCCCCGGGCCGGCGCGGCGGGGG - Exonic
1166081062 19:40444349-40444371 GCTCGGCTCCGGGGCGGGGCTGG - Exonic
925497148 2:4464754-4464776 CCTGGGGTCTGGTGCTGCGCTGG + Intergenic
927679766 2:25131906-25131928 CCGTGGGTGCGGCGCGGGGCCGG + Exonic
929452875 2:42048330-42048352 CCCCGGGTCCGGGCCGTCGCGGG + Exonic
931602538 2:64019040-64019062 GCTCGGGCCCGGCCGGGCGCCGG - Exonic
935112344 2:100104911-100104933 GCGCGGGGCGGGCGCGGCGCGGG - Intronic
936569413 2:113602218-113602240 TCTCTGCGCCGGCGCGGCGCGGG + Intergenic
938583688 2:132669775-132669797 CCTCGGGGCCAGCCCTGCGCTGG - Intronic
940971992 2:159904838-159904860 CCTCGGCCCCGGGGCGGAGCGGG + Intergenic
945088815 2:206159826-206159848 CCTTCGGTCCGGCGCGGTGGAGG + Exonic
947518750 2:230828505-230828527 GCCCGGGCCCGCCGCGGCGCTGG - Intergenic
1174607034 20:51768453-51768475 CCCCCGGGGCGGCGCGGCGCCGG - Exonic
1175856123 20:62122046-62122068 CCCAGGGTCCGGGGCGGCGCCGG + Intergenic
1176014976 20:62926357-62926379 CCTCGGGAGCGGGGCGGGGCCGG - Intronic
1178992626 21:37367687-37367709 CCTCGGCTCCGGCCCGGCTGCGG - Intronic
1179783884 21:43719086-43719108 CCGCGAGTTCCGCGCGGCGCCGG - Intronic
1181087705 22:20449949-20449971 CCTCCGGGCCGGGGCGGCGGCGG + Intronic
1182237035 22:28883907-28883929 CGCGGGGCCCGGCGCGGCGCGGG + Exonic
1182321525 22:29480997-29481019 CCAGGGCTCCGGCGCCGCGCAGG + Exonic
1182903849 22:33920440-33920462 CCCGGGCTCCGGCGCGGCGGCGG + Intronic
1183702164 22:39457104-39457126 CCCCCGGCCCGGCGCGGCGGCGG + Intergenic
1183702479 22:39457929-39457951 CCTCCGGCGCGGCGCGGGGCTGG + Intronic
1184706110 22:46214656-46214678 CCACGGGTCCGGAGACGCGCGGG + Intronic
1184975274 22:48057378-48057400 CCTCGCGTCAGGCCCAGCGCTGG - Intergenic
1185221748 22:49632490-49632512 CCTCGGGTGAGGCCCGGCCCCGG - Intronic
1185259515 22:49853815-49853837 CCCAGGGCCCCGCGCGGCGCGGG - Intergenic
1185259634 22:49854150-49854172 GGGCGGGTCCGGGGCGGCGCCGG - Intronic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
952152315 3:30606696-30606718 CCTGGAGGCCGGCGAGGCGCGGG - Exonic
953013705 3:39052421-39052443 CCTCGGCTCCGACGCAGCGAGGG - Intronic
953170876 3:40506089-40506111 CCGCGAATCCCGCGCGGCGCAGG - Exonic
963133299 3:141877195-141877217 CCTCCCGCCCGGCGCGGCGCCGG + Intronic
965520447 3:169664315-169664337 TCCCGGGTCCGGGCCGGCGCTGG + Intergenic
968775337 4:2536683-2536705 ACTCTGGTCAGCCGCGGCGCCGG + Intronic
968879880 4:3293291-3293313 TCCCGGGCCCGGCGCGGGGCGGG + Intronic
975883608 4:78939399-78939421 TGCCGGGTCCGCCGCGGCGCTGG - Exonic
977231064 4:94451974-94451996 CCTCGGGTCCGGCGCGGCGCGGG - Exonic
981688514 4:147481252-147481274 CCCGGGCTCCGGCGCGGCGGCGG - Exonic
985111987 4:186555501-186555523 CGTGGCGTCCGGCGCGGCGTGGG - Exonic
985462602 4:190121391-190121413 CCCCCGCTCCGGCGCCGCGCCGG + Intergenic
986132133 5:4941875-4941897 CCTCAGGTGAGGCGGGGCGCGGG + Intergenic
987374014 5:17217833-17217855 CCCCGGGTCCGCGGCGGCGCGGG - Intronic
988482072 5:31639309-31639331 GCTCGGGGCAGGCGCGGCGGCGG + Intergenic
990553698 5:56909572-56909594 CCTCGGGCCCGCCCCGGCCCGGG - Exonic
990910006 5:60843770-60843792 ACTGGGGTCCCGCGCGGCGCTGG - Intronic
992671909 5:79069679-79069701 CCGCGGGGCCGGCGGGGCGGGGG + Intronic
1002071427 5:176680753-176680775 CCTGGGGTCTGGCGAGGCGCTGG - Intergenic
1003074428 6:2971198-2971220 CCTCGGGTCCGCGGCGTCACCGG + Intronic
1003139200 6:3456903-3456925 GCGCGGGCCGGGCGCGGCGCCGG - Intronic
1003995814 6:11538227-11538249 CCTCGGGTGCCGGGCGGCGGCGG - Intergenic
1007451268 6:41941590-41941612 CCGCGGGTCCGGCCCGGCCCGGG + Exonic
1007625383 6:43243620-43243642 CCCCGGGGCCGGGGCGGGGCGGG - Intergenic
1011416272 6:87122835-87122857 CCTCTGTTCCGGCGCGGGGCGGG - Intergenic
1018400078 6:163413819-163413841 CGTCGGGCCCGCCACGGCGCGGG - Intergenic
1018686478 6:166307955-166307977 CCGCCGGCCCGGCGCGGCCCCGG - Exonic
1022113813 7:27246379-27246401 CCTCTGGTCCAGCGCGACGGAGG - Exonic
1024308865 7:47950815-47950837 CCTCGGGGCCAGCGCTGGGCTGG + Intronic
1035266548 7:157692848-157692870 GCTCGGGGGCGGCGCGGCGGCGG + Intronic
1036811023 8:11867856-11867878 CCTGGGGGCCGGCGGGGAGCCGG - Intronic
1039884312 8:41646606-41646628 CCCCGGGCCCCGGGCGGCGCGGG - Exonic
1039996894 8:42541777-42541799 CCCCGCGTCCGGGGCGGGGCGGG - Intronic
1046067146 8:109210912-109210934 CCTGGGGTTCGGGGCCGCGCGGG + Intergenic
1048308038 8:133297178-133297200 CCTCGGCTTCCGCGGGGCGCTGG - Exonic
1053198355 9:36136699-36136721 CCTGGGCTCTGGGGCGGCGCTGG + Intronic
1057773279 9:97984831-97984853 CCGCGCGCCCGGCGCGGGGCGGG - Intronic
1061149061 9:128818711-128818733 CCTGGCGTCGGGCGCGGGGCTGG + Exonic
1062305925 9:135907212-135907234 CACCGGGCCCGGCGCGGCGAGGG - Exonic
1186423250 X:9443479-9443501 CAACGGGTCCCACGCGGCGCGGG + Intergenic
1190385639 X:49879966-49879988 CCCCGGCCCCGGCGCGGCCCTGG + Exonic
1193969972 X:88039136-88039158 CCCCGGGTCGGGCGGGGGGCGGG - Intergenic
1199772560 X:150983926-150983948 CCTGCGGGCCCGCGCGGCGCCGG - Intronic
1200292560 X:154886617-154886639 CCACGGGCCCGGGGAGGCGCTGG + Exonic
1200339404 X:155382357-155382379 CCACGGGCCCGGGGAGGCGCTGG + Exonic
1200347066 X:155458336-155458358 CCACGGGCCCGGGGAGGCGCTGG - Exonic