ID: 977231964

View in Genome Browser
Species Human (GRCh38)
Location 4:94462205-94462227
Sequence AAGATACACGAGCGTATAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 24}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977231959_977231964 25 Left 977231959 4:94462157-94462179 CCAGCTTAATTTTCTTTAGGTAA 0: 1
1: 0
2: 1
3: 28
4: 330
Right 977231964 4:94462205-94462227 AAGATACACGAGCGTATAGGGGG 0: 1
1: 0
2: 0
3: 2
4: 24
977231958_977231964 26 Left 977231958 4:94462156-94462178 CCCAGCTTAATTTTCTTTAGGTA 0: 1
1: 0
2: 2
3: 37
4: 402
Right 977231964 4:94462205-94462227 AAGATACACGAGCGTATAGGGGG 0: 1
1: 0
2: 0
3: 2
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977231964 Original CRISPR AAGATACACGAGCGTATAGG GGG Intronic
902348553 1:15836627-15836649 AAATTACCCGAGCGTATTGGCGG - Intergenic
906085624 1:43131160-43131182 GTGCTACACGAGCGTATAGTAGG - Intergenic
1086794836 11:91087050-91087072 TAGATACACGTGTGGATAGGTGG + Intergenic
1088463811 11:110112004-110112026 AACATACACAAGCATAGAGGAGG + Intronic
1088866586 11:113853500-113853522 AATATCTACGAGAGTATAGGAGG - Intronic
1099380440 12:81946075-81946097 AAAAAACACCAGCGTTTAGGAGG - Intergenic
1120540917 14:85749384-85749406 CAGATACACAAGGGTATAGGAGG + Intergenic
1127488817 15:59442911-59442933 AATATACACGAGTATTTAGGTGG - Intronic
1135755760 16:25096538-25096560 AAAATACACGAGTGTATAGTTGG + Intergenic
1144103763 17:11967477-11967499 ATGATACACTAGCGTATATCTGG + Intronic
942310332 2:174650507-174650529 CATATACAGGAGCTTATAGGAGG - Intronic
1174946032 20:54986532-54986554 GAGGTACACGAGCTTATATGAGG - Intergenic
1182404401 22:30112528-30112550 AACACACACAAACGTATAGGTGG + Intronic
963937425 3:151068563-151068585 AAAATACAAAAGCGTATATGTGG + Intergenic
977231964 4:94462205-94462227 AAGATACACGAGCGTATAGGGGG + Intronic
979664953 4:123301440-123301462 AAGATACATGAGTGTATACTGGG + Intronic
986751456 5:10791632-10791654 AAGATACACTACGTTATAGGTGG + Intergenic
1011496840 6:87944894-87944916 AAGATAAAGCAGCGTATAAGAGG + Intergenic
1017950887 6:159133996-159134018 AAGAGACACGGGCCTATCGGAGG - Intergenic
1022192167 7:28026954-28026976 AAGACACACTGGCGAATAGGAGG - Intronic
1025037331 7:55604018-55604040 AAGACACATGATCGTAAAGGTGG + Intergenic
1027655702 7:80928592-80928614 CACATACACCAGGGTATAGGTGG + Intergenic
1053554419 9:39120518-39120540 AAAATAGACGAGCGTAGTGGCGG + Intronic
1053818514 9:41940663-41940685 AAAATAGACGAGCGTAGCGGCGG + Intronic
1054108778 9:61084316-61084338 AAAATAGACGAGCGTAGCGGCGG + Intergenic
1054612079 9:67246809-67246831 AAAATAGACGAGCGTAGCGGCGG - Intergenic
1196510784 X:116509541-116509563 AAGATACAAGGGCCTATGGGAGG - Intergenic