ID: 977238792

View in Genome Browser
Species Human (GRCh38)
Location 4:94541640-94541662
Sequence CCTCACTTCTCAACTGGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977238792_977238796 12 Left 977238792 4:94541640-94541662 CCATTACCAGTTGAGAAGTGAGG 0: 1
1: 0
2: 1
3: 7
4: 134
Right 977238796 4:94541675-94541697 CTTTCTACTGCTTCTGCCCATGG 0: 1
1: 0
2: 4
3: 21
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977238792 Original CRISPR CCTCACTTCTCAACTGGTAA TGG (reversed) Intronic
900887766 1:5427532-5427554 CCTCAGTCCTCATCTGTTAAAGG - Intergenic
904148492 1:28415429-28415451 CCTCCCTTTTCAACTGCTTATGG + Intronic
904819254 1:33230185-33230207 CCTCACTTGTAAACTGGGAATGG + Intergenic
905092589 1:35441260-35441282 CCTCACTTCTCAGCCAGGAAAGG + Intronic
906464633 1:46065886-46065908 CCTCCCTTCTTAATTGGTTAAGG - Intronic
906641271 1:47442063-47442085 CATCTCTTCTCCACTGGTGAAGG - Intergenic
908075791 1:60516576-60516598 CCTAAATTCTCAAATGGTATTGG - Intergenic
914947210 1:152078540-152078562 CCTCACTTCCCAGATGGTGAGGG + Intergenic
917964443 1:180169544-180169566 CCTCACTTCACACTTGGCAACGG - Intronic
920673378 1:208021896-208021918 CCTCCCTTCTCTCCTGGGAAGGG + Intergenic
1063365010 10:5485343-5485365 CCTCACTTCTAACCTGGAACCGG - Intergenic
1064476846 10:15699780-15699802 CCTCACTCCTCCACTGCTAGTGG - Intronic
1065101071 10:22334249-22334271 CCTGACTTCTCCTTTGGTAAAGG + Intergenic
1066025977 10:31361542-31361564 CCTCACTTCCCAGATGGTGAGGG + Intronic
1068881787 10:62057107-62057129 CCTCACATTTCACCTGGAAAAGG - Exonic
1070593596 10:77817631-77817653 GCTCATTTCTCTACTGGGAAGGG - Intronic
1070645044 10:78195935-78195957 CCTGACTTCTTAATTGGTGACGG - Intergenic
1070789925 10:79182921-79182943 CCTCACTGCTCAGATGGTGAAGG - Intronic
1071283532 10:84124444-84124466 CCAGACTTCTGAACTGGTTAAGG + Intergenic
1080773244 11:35362082-35362104 CTTCAGTTCTCACCTGGTATAGG + Intronic
1086940072 11:92787138-92787160 CATCAGTTCTCAACTGGGGAGGG - Intronic
1093814796 12:23532727-23532749 CCACACTTCTGAAATGCTAAAGG + Exonic
1094717869 12:33031302-33031324 CCTCTCTTGGCAACTGGAAAAGG + Intergenic
1097069790 12:56346526-56346548 CCTCAGTGAGCAACTGGTAATGG + Exonic
1102162805 12:110783048-110783070 CATCACTTCTCACCTGGGCAAGG - Intergenic
1102605792 12:114066247-114066269 CCAGACTTCTGAACTGGTTAAGG - Intergenic
1107643260 13:42466607-42466629 ACTCTCTTCTTAACTAGTAATGG - Intergenic
1108293036 13:48980720-48980742 CATCACTATTCACCTGGTAATGG - Intronic
1109673263 13:65637934-65637956 CCTCACTTGTCAAATGTAAATGG + Intergenic
1110626321 13:77660000-77660022 CCTCACTTCCCAGATGGTGAGGG + Intergenic
1112392853 13:99001157-99001179 ACTCACTTCGCAAGTAGTAAAGG + Intronic
1112549704 13:100408255-100408277 GCTGGCTTCACAACTGGTAAGGG - Intronic
1113524914 13:110967151-110967173 CCAGACTTCTGAACTGGTTAAGG - Intergenic
1118354168 14:64998108-64998130 CTTTTCTTCTCAACTAGTAAAGG - Intronic
1118525661 14:66638653-66638675 TCTGAATTCTCAACTGGAAAAGG - Intronic
1125721294 15:41846361-41846383 CCTCACTTCTCCACATGGAAAGG + Exonic
1129966220 15:79738230-79738252 TCTCACTTCTGAACACGTAATGG - Intergenic
1131716734 15:95119758-95119780 CTTCACTTTTCCAATGGTAAAGG - Intergenic
1134653788 16:15931184-15931206 CCTTCCTTCTCAATAGGTAATGG - Intergenic
1138829135 16:60357801-60357823 CCTCACTTCCCAGATGGTGAGGG + Intergenic
1139231508 16:65287441-65287463 CCTGCCTTCTCAACAGGAAAAGG - Intergenic
1143595359 17:7910745-7910767 CCACACTCCACAACTGCTAAGGG - Intronic
1148021341 17:44556173-44556195 CCACATCTCTCACCTGGTAAGGG - Intergenic
1148902152 17:50886436-50886458 CCTGCCTTCTCATCTGGGAAAGG + Intergenic
1157166677 18:45363866-45363888 CCTCACCTCTCATCTGTTAAAGG - Intronic
1160173947 18:76578393-76578415 CCCCACTTCTGAGCTGATAAAGG - Intergenic
1161360983 19:3849564-3849586 CATCAGTTCTTAACTGGTCAAGG - Intronic
1162268453 19:9595181-9595203 CCGGACTTCTGAACTGGTTAAGG + Intergenic
1163825184 19:19519499-19519521 CCTCACTCCTCCACCGGGAAAGG - Intronic
1164521450 19:28983121-28983143 CCTCAGTTCTCACCTGACAAAGG - Intergenic
1165227621 19:34365696-34365718 CCTCTCTTCACAACTGCGAAAGG - Intronic
1167783063 19:51613075-51613097 CCTCACTTCTTTTCTGGTCAAGG + Intronic
929419678 2:41777911-41777933 CCTCACTTCTGAACTGCCCATGG + Intergenic
930447424 2:51491577-51491599 CATAACTTCTAAACTGGAAATGG - Intergenic
931104105 2:59035190-59035212 CCTCACTTCCCAAGTGGCATGGG - Intergenic
932062922 2:68527037-68527059 CCTCACTTCCCAGATGGTGAGGG + Intronic
932713700 2:74086187-74086209 CCTCACATCTTATCTGGTCATGG + Intronic
935047938 2:99498575-99498597 CCAGACTTCTGAACTGGTTAAGG - Intergenic
935160218 2:100523557-100523579 CCTCACCTCTCTGCTGGGAAAGG - Intergenic
944621236 2:201517737-201517759 CCTCACTTGTAAAATGGAAATGG - Intronic
944937588 2:204585183-204585205 CCACACTTCCCAACTGGTCTGGG - Intronic
945013260 2:205487143-205487165 CCTTACTTTTCTACTGTTAAAGG - Intronic
945239930 2:207667524-207667546 CCTCACTTCTCAACTTGCAATGG - Intergenic
947682790 2:232051066-232051088 TCCCAAGTCTCAACTGGTAAGGG + Intronic
1170710921 20:18789872-18789894 CCTCACTCCTCCCCTGGAAAGGG - Intergenic
1173572409 20:44085966-44085988 CCACACTTCTCACCTGGTACGGG - Intergenic
1173604854 20:44324671-44324693 CCTGACTGCCCAACTGGGAAGGG + Intergenic
1174490018 20:50886282-50886304 CCTGACATCTCAGCTGGCAAAGG - Intergenic
1174886268 20:54338793-54338815 CCTCTCTTTTCCACTGGAAAAGG - Intergenic
1177008270 21:15700494-15700516 CATCACTTCTCACCTGCTCAAGG - Intergenic
1178368753 21:32009731-32009753 GCTCACTTCTCCACTGCTATGGG + Intronic
1179965985 21:44806148-44806170 CCACATTTCTCATTTGGTAATGG - Exonic
1181807962 22:25386380-25386402 CCTCTCTTCCCAACCAGTAAAGG + Intronic
1181862032 22:25826484-25826506 TCTCACTCATCAACAGGTAACGG + Exonic
950880831 3:16321517-16321539 CCTCACTCCTCAGCTGACAAGGG - Intronic
951995432 3:28722617-28722639 CCTCACTTATTAAATGGTAAGGG - Intergenic
955336752 3:58093155-58093177 CTTCACTACACAACTGCTAAAGG - Intronic
956717197 3:72088749-72088771 CCTCACTTCCCAAATGGTGCTGG - Intergenic
957616332 3:82532658-82532680 CCTCAAACCTCAACTGGTATAGG + Intergenic
970323640 4:14900506-14900528 GCTGACTTCTGAACTGGAAAAGG - Intergenic
971469352 4:27003816-27003838 CTTGCCTTCTCCACTGGTAAAGG + Intronic
972277208 4:37568405-37568427 CCCCCCTTCTCCACTGGGAATGG - Intronic
974192013 4:58517816-58517838 TCTCAAGTCTCAACTGGAAAGGG + Intergenic
974532179 4:63123224-63123246 CCTCACTTCAAAACAGGTAGGGG - Intergenic
974991138 4:69092263-69092285 CCTGGCTTATCATCTGGTAATGG + Intronic
977118509 4:93066011-93066033 CCTCACCTCTAAAGTGGAAATGG - Intronic
977238792 4:94541640-94541662 CCTCACTTCTCAACTGGTAATGG - Intronic
979688889 4:123540025-123540047 CCTCAATTCTCCAATGGTAATGG + Intergenic
983923256 4:173370291-173370313 CCTGACTTCTCAACTGTGACAGG - Intronic
985055970 4:186035865-186035887 CATCAGTTATCAACTGGTAAAGG + Intergenic
985134535 4:186772713-186772735 CCTCACTGGTCAAATGGAAATGG - Intergenic
987383297 5:17306397-17306419 CCTGACTTCTCAGCTGTTCAGGG + Intergenic
989615645 5:43334760-43334782 CCAGACTTCTGAACTGGTTAAGG + Intergenic
989667832 5:43876872-43876894 ACTCACTTCTGAATTTGTAAGGG + Intergenic
991465530 5:66908493-66908515 CATTAATTCTCAACTGGGAATGG - Intronic
993119914 5:83762119-83762141 CAACAATTCTCAAATGGTAATGG - Intergenic
993436751 5:87905218-87905240 CCTCACATCTCCACTGGGGAAGG - Intergenic
994241780 5:97431010-97431032 CCTCACTTGGAAACTTGTAATGG + Intergenic
994470438 5:100197982-100198004 CCTCACATCAAAACTGGGAATGG + Intergenic
995226992 5:109711697-109711719 CATCACTTTACAACTGGAAATGG - Intronic
995821896 5:116244624-116244646 CCTTACTTGTTAAGTGGTAATGG - Intronic
995962737 5:117863161-117863183 GCTATCTTCTCAACTGGAAAGGG - Intergenic
996348993 5:122517858-122517880 CCTCACTTCCCACCTTGGAAAGG + Intergenic
1000767136 5:165306137-165306159 CGTCACTTCTAAACTTTTAATGG - Intergenic
1000852200 5:166354581-166354603 CCTCATTTCTCCAGTGGTCAGGG + Intergenic
1002099904 5:176852210-176852232 CCTCACCTCTCACCTGGCAGAGG - Intronic
1003392309 6:5724531-5724553 CCTCCCTTCTCAACTAGTGGTGG - Intronic
1003621695 6:7706440-7706462 GCACACTTCTAAACTGGTCATGG - Intergenic
1003684413 6:8287047-8287069 CCTCACTTCCTACCTGGGAAAGG + Intergenic
1004756013 6:18611147-18611169 CCACACCAATCAACTGGTAATGG - Intergenic
1005410846 6:25544432-25544454 GCTCACTTCTCAATAGTTAATGG + Intronic
1006050086 6:31335650-31335672 CCAGACTTCTGAACTGGTCAGGG + Intronic
1008894104 6:56532170-56532192 CCTCATTCCTCTAATGGTAATGG - Intronic
1008989836 6:57589317-57589339 CCTCACTTGGCAACAGGTACTGG + Intronic
1010478681 6:76322078-76322100 ACTCGCTTCTCAGATGGTAAGGG + Intergenic
1015622339 6:135144342-135144364 CTTCACTTCTCAACTCTAAAAGG - Intergenic
1016599588 6:145842801-145842823 CCTTCTTTCTCAACTGGTTAAGG - Intergenic
1017677715 6:156830942-156830964 CCTCACTTCTCAATTATTGAAGG + Intronic
1018028559 6:159824110-159824132 TCTCACTTCTCTTCTTGTAAGGG + Intergenic
1018837358 6:167494970-167494992 CCTCACTGCTGTACTGGTCAGGG - Intergenic
1023798343 7:43811987-43812009 CCGGACTTCTGAACTGGTCAAGG - Intergenic
1026523465 7:71135333-71135355 TCTCATTTCTCAACTGGGGATGG - Intronic
1032520787 7:132543233-132543255 CCTGACTTCACAACTTGCAAAGG + Intronic
1033275443 7:139968035-139968057 TTTCACTTCTCAAATGGTGAAGG - Intronic
1037692986 8:21198343-21198365 CCTCACTTCTGCACTGGACAGGG + Intergenic
1037732159 8:21535218-21535240 CCTCACTTCTGGACTGCTCATGG + Intergenic
1038754888 8:30331209-30331231 CCACACTTCTCTATCGGTAAAGG + Intergenic
1045475791 8:102551049-102551071 CCTCATTTCTCTACTGGTTGGGG - Intergenic
1045742312 8:105375604-105375626 CTTCACTACTCAACTGGTGAAGG - Intronic
1050696042 9:8280526-8280548 CTTCACTTCTCAAATGGATATGG - Intergenic
1051956887 9:22706244-22706266 CCTATTTTCTTAACTGGTAAGGG + Intergenic
1052042481 9:23754887-23754909 GCTTACTTCTGAACTGGTACAGG - Intronic
1052413698 9:28150230-28150252 CCTCACTTCCCAGATGGTGAGGG - Intronic
1053296023 9:36913427-36913449 GCTCACCTCTCTACTGGTGAAGG - Intronic
1056019926 9:82430912-82430934 CCTCACTTCCCAGATGGTGAGGG + Intergenic
1056020127 9:82431796-82431818 CCTCACTTCCCAGCTGGTGCAGG + Intergenic
1057071777 9:92105522-92105544 CCTCACTTCCCAGATGGTACAGG - Intronic
1057071919 9:92106121-92106143 CCTCACTTCCCAGATGGTGAGGG - Intronic
1186251857 X:7676747-7676769 CATCACTTCTCACCTGCCAATGG + Intergenic
1186681977 X:11884312-11884334 CCTCAATTATCAAATGGAAAAGG - Intergenic
1188421267 X:29992887-29992909 CCTGGCTTCTCAACTTGTTATGG + Intergenic
1195336645 X:103861344-103861366 CCTCACTTTTCAAATAGAAAAGG + Intergenic
1201467756 Y:14303073-14303095 CATCACTTCTCACCTGCCAATGG + Intergenic