ID: 977244726

View in Genome Browser
Species Human (GRCh38)
Location 4:94618019-94618041
Sequence TTCTCCGCAGTTGGCTTCCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977244720_977244726 29 Left 977244720 4:94617967-94617989 CCACTTCACCAAAGATGTTTCTT 0: 1
1: 0
2: 0
3: 33
4: 324
Right 977244726 4:94618019-94618041 TTCTCCGCAGTTGGCTTCCTCGG 0: 1
1: 0
2: 0
3: 14
4: 106
977244721_977244726 21 Left 977244721 4:94617975-94617997 CCAAAGATGTTTCTTTATTTCCT 0: 1
1: 0
2: 4
3: 82
4: 741
Right 977244726 4:94618019-94618041 TTCTCCGCAGTTGGCTTCCTCGG 0: 1
1: 0
2: 0
3: 14
4: 106
977244723_977244726 1 Left 977244723 4:94617995-94618017 CCTTTACAGTAACTCTCAGGAGC 0: 1
1: 1
2: 2
3: 12
4: 122
Right 977244726 4:94618019-94618041 TTCTCCGCAGTTGGCTTCCTCGG 0: 1
1: 0
2: 0
3: 14
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977244726 Original CRISPR TTCTCCGCAGTTGGCTTCCT CGG Exonic