ID: 977246726

View in Genome Browser
Species Human (GRCh38)
Location 4:94640100-94640122
Sequence CTGTGACTATGTAGGTAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977246726 Original CRISPR CTGTGACTATGTAGGTAAAT GGG (reversed) Intronic
900425260 1:2575444-2575466 GTGTGACTATGTTTGGAAATGGG - Intergenic
905002214 1:34681579-34681601 CTGTTGCTCTGCAGGTAAATGGG - Intergenic
906093841 1:43206299-43206321 CTCTGACAATGTAGGTTAACTGG - Intronic
915967079 1:160319143-160319165 GTGTGTCTGTATAGGTAAATGGG - Intronic
916119490 1:161514989-161515011 CTGTGACTTTCTAGAGAAATAGG + Intronic
916129254 1:161596646-161596668 CTGTGACTTTCTAGAGAAATAGG + Intronic
919198798 1:194324497-194324519 GTGTGACTATGTTGGGAGATAGG + Intergenic
919684146 1:200466328-200466350 CTGTGGCTATGTGAGTACATGGG - Intergenic
921572754 1:216798285-216798307 CTGTGACTCCCTAGCTAAATTGG - Intronic
923264114 1:232296707-232296729 TTGAGACTAGGTAGGGAAATAGG + Intergenic
924950687 1:248880110-248880132 CTGTGACAATATAGGAAAATGGG - Intergenic
1066264186 10:33759422-33759444 CTGTGAATATGTGGAAAAATAGG - Intergenic
1066528538 10:36309679-36309701 TTGTAACTACTTAGGTAAATTGG - Intergenic
1070584984 10:77757579-77757601 GTGTGACTTTGTAGGTGAAATGG - Intergenic
1071918064 10:90318573-90318595 GTGTGACCTTGGAGGTAAATGGG + Intergenic
1072689225 10:97560538-97560560 CTGTAACTATGTATGGAAACTGG + Intronic
1073638164 10:105220592-105220614 CAGTGACTTTGAAGGTAAAAGGG + Intronic
1074413602 10:113248123-113248145 CTGTGACTATGGGAGTAAGTTGG + Intergenic
1078645223 11:13135906-13135928 CTGTGTTTATGCAGGGAAATGGG - Intergenic
1080048750 11:27836804-27836826 CTGAGACTAGGAAGGTGAATAGG - Intergenic
1080953877 11:37069524-37069546 CTGTAAGTATGTAGTGAAATGGG - Intergenic
1081371898 11:42314308-42314330 CTGTGGCCATGTAGGATAATGGG - Intergenic
1084461322 11:69298195-69298217 GTGTTACTATGGAGATAAATAGG - Intronic
1084917626 11:72441035-72441057 CTTTGATCATGTAGTTAAATTGG - Intergenic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1092023230 12:5219942-5219964 CCGTGGCTAGGTAGGTAACTTGG - Intergenic
1095662639 12:44755548-44755570 CTGTGGCTATACAGGTAAAGTGG - Intronic
1096874417 12:54616009-54616031 CTCAGACTATGTAGGAAATTGGG - Intergenic
1097543209 12:60965857-60965879 CATTAACTATGTAAGTAAATAGG + Intergenic
1101715073 12:107303740-107303762 ATGTGACAATGAAGGTACATGGG - Intergenic
1103586087 12:121957065-121957087 CTGTGACAATGTAGCTGAAATGG - Exonic
1107003530 13:35580507-35580529 TTGTCAGTATGTAGGTAAGTAGG + Intronic
1110183551 13:72645784-72645806 AAGTGACCATGTAGTTAAATTGG - Intergenic
1110271465 13:73595713-73595735 ATGTCACTATGTGGGTAAAAAGG + Intergenic
1112103697 13:96217758-96217780 GTGTGACTATGTATGTATATAGG + Intronic
1113282200 13:108800522-108800544 GTGAGACTATATATGTAAATTGG - Intronic
1113351901 13:109537716-109537738 CTGTTCCTATGTATGTAACTTGG + Intergenic
1115759470 14:36564107-36564129 CTGTTAGTAGGTATGTAAATTGG + Intergenic
1116870546 14:50065712-50065734 GTGTGACTGTGTGGGGAAATGGG - Intergenic
1117250803 14:53935524-53935546 CTGTGACTAGTTAGCTAAGTTGG + Intergenic
1120120257 14:80670411-80670433 CTGTGTGTATGTATATAAATAGG - Intronic
1121364550 14:93296398-93296420 CTGTAACTATATATTTAAATTGG - Intronic
1121382690 14:93488067-93488089 CTGTTAATATTTTGGTAAATTGG + Intronic
1122181508 14:99958450-99958472 CTGTGAATATGTAGGTTACATGG + Intergenic
1124406669 15:29398859-29398881 CTGTGAATATGTATGTGATTAGG + Intronic
1130840205 15:87692605-87692627 CTATGACAATGTGGGAAAATGGG - Intergenic
1131947050 15:97635014-97635036 CTGTGATTTTGTAGAAAAATTGG - Intergenic
1133439444 16:5808113-5808135 ATGTGACTATGTATGGAGATAGG + Intergenic
1137580079 16:49628212-49628234 GTGTGAGTATGTAGATAAATGGG - Intronic
1137872428 16:51963130-51963152 CTGTAACGACGTGGGTAAATGGG + Intergenic
1138033996 16:53584004-53584026 CTGTGAAGATGGAGGTCAATTGG + Intergenic
1138381478 16:56605898-56605920 CTGTGACTAGGTAGGTGGAATGG + Intergenic
1139278798 16:65751916-65751938 CTATGACTATGGAGGGAGATGGG - Intergenic
1139314110 16:66053568-66053590 GTGTGTGTAGGTAGGTAAATAGG - Intergenic
1142053924 16:87979829-87979851 CTGGGACTATCCAGGTTAATAGG - Intronic
1142895602 17:2975762-2975784 CTGTGACTGGGTGGGTAAGTTGG + Intronic
1143900591 17:10171618-10171640 CTGTGATTATTTAGGGAGATGGG - Intronic
1146369238 17:32254641-32254663 TTGTGAGGATGTAGGTAAAAAGG - Intergenic
1149091783 17:52791704-52791726 TTGTGACTATGGAGGCAACTTGG + Intergenic
1149204316 17:54226382-54226404 CCATGACTATTTAGGTAATTAGG - Intergenic
1158051120 18:53221322-53221344 CTATGACTGTGTGGGGAAATGGG - Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158267543 18:55676931-55676953 CTGTGACTATGTCAATAAATTGG - Intergenic
1158981537 18:62766553-62766575 CTGTGACTAGGTAGAGAAACTGG + Intronic
1167333432 19:48870239-48870261 CTGTGACTATCTTGGTCAAGTGG + Intergenic
930213871 2:48672703-48672725 CTGTGATTATGTAGTCAAATGGG + Intronic
931144591 2:59503327-59503349 CTGTGACTATATATTTGAATTGG - Intergenic
931238305 2:60430443-60430465 CTGTGTAGATGTAGGTAATTTGG + Intergenic
932552896 2:72790007-72790029 CTGTGAGCATCCAGGTAAATTGG - Intronic
934092586 2:88565661-88565683 GTATGACTATGTAGAAAAATTGG + Intronic
936594844 2:113838254-113838276 TTGTGACTGTGTTGGTAAAAAGG - Intergenic
936966583 2:118133180-118133202 CTGTGGCTATGCAGGTTGATTGG + Intergenic
937392934 2:121507453-121507475 ATGTGACTATGTTGGTACATTGG - Intronic
938000951 2:127736555-127736577 CTTTGCCTATGTAGGTAAAATGG + Intronic
940807146 2:158200481-158200503 CTGTCAATATGTAAGCAAATGGG - Intronic
941017837 2:160377156-160377178 CTGTGCCTATTTATGTATATAGG - Intronic
941399663 2:165015087-165015109 TTGGTACTATGTAGGGAAATTGG - Intergenic
941429120 2:165390276-165390298 ATGTGACTATTTTTGTAAATGGG + Exonic
942839648 2:180344570-180344592 CTGTGACTACTTAAGTGAATTGG - Intergenic
944546009 2:200799636-200799658 CTGTGACTATGTAGGTTACATGG + Intergenic
945474664 2:210266856-210266878 ATCTATCTATGTAGGTAAATAGG + Intergenic
946134656 2:217635962-217635984 CTGTGACTATGTTGGGTTATAGG - Intronic
1173653652 20:44683938-44683960 CTCAGATTATGTATGTAAATGGG - Intergenic
1175310975 20:58011350-58011372 CTGTCACTGTGCAGGTAACTGGG + Intergenic
1175638480 20:60605725-60605747 CTGTTCCTGTGCAGGTAAATGGG + Intergenic
951317949 3:21209266-21209288 ATGTGGCTCTGTAGGTGAATTGG - Intergenic
952661577 3:35856451-35856473 CTGTGACTTTATGGGTAAATTGG + Intergenic
952685773 3:36146754-36146776 CTGTGTCTATGTGGAGAAATTGG + Intergenic
956252379 3:67248238-67248260 CTGTGACTTTGTAGTTGAAGTGG - Intergenic
959003355 3:100990498-100990520 ATGTGACTAGGTATGCAAATAGG + Intronic
959734280 3:109640094-109640116 CTGTGGCCATGTAGGCCAATTGG + Intergenic
959980888 3:112516380-112516402 ATGTGACTATGTTTATAAATAGG + Intergenic
960735874 3:120780165-120780187 CAGGTACTATTTAGGTAAATGGG + Intronic
962606610 3:137037502-137037524 CTGTCACTATTTAGCTCAATAGG - Intergenic
963887178 3:150595925-150595947 TTGTGATTTTGTAGGAAAATGGG - Intronic
965397532 3:168177449-168177471 CTATGACAATGTAGCTAACTAGG + Intergenic
967454414 3:189666847-189666869 TTGTGTGTATGTATGTAAATGGG + Intronic
969866894 4:10082187-10082209 CTGGGCATCTGTAGGTAAATTGG - Intronic
969889051 4:10242801-10242823 CTTGGACTATGTAGGGAAATAGG - Intergenic
970372174 4:15418878-15418900 CTGAGACTGTGTAGGGAATTGGG + Intronic
973124300 4:46565312-46565334 CTGTCACCATGTAGGCAAGTGGG - Intergenic
976830234 4:89307377-89307399 CTCTGGCTTTGAAGGTAAATGGG - Intronic
977246726 4:94640100-94640122 CTGTGACTATGTAGGTAAATGGG - Intronic
978497636 4:109377320-109377342 CTGTGAGTATGTAGAGAGATGGG + Intergenic
984588533 4:181590391-181590413 CTGTGACTGGGTAGGTAAATCGG - Intergenic
986214679 5:5708285-5708307 CTGTGACTATGTAGGTTACATGG - Intergenic
993878023 5:93330772-93330794 CTGTGTCTATGTTGGTAAACTGG - Intergenic
994657153 5:102608068-102608090 ATGTGACGATGTTGGTAGATAGG - Intergenic
995385563 5:111585092-111585114 CTGTGAGAATGCAGGGAAATAGG + Intergenic
996408785 5:123133130-123133152 CTGTGAATATGAAAGTAAAAAGG + Intronic
998786842 5:145720647-145720669 CTGTGAAAATTTAGGTAAAAGGG + Intronic
1000248190 5:159467872-159467894 CTTTGCCTTTGTAGGTGAATTGG - Intergenic
1004532662 6:16468083-16468105 ATGTTACTATGAAGGCAAATAGG - Intronic
1009738904 6:67718517-67718539 CTGAGATTATGTAAGTAAAGGGG - Intergenic
1012299720 6:97570928-97570950 CTATGACTATTTGGGTATATTGG - Intergenic
1014147368 6:118013518-118013540 CTGTGATTATGTTTGTGAATAGG + Intronic
1014469739 6:121799688-121799710 CTGTGACCATATTTGTAAATAGG + Intergenic
1015928742 6:138335309-138335331 CTCTGACTTTGGAGGGAAATCGG - Intronic
1017000773 6:149995782-149995804 CTGTGACTGTGCAGGGACATAGG - Intergenic
1020466951 7:8490948-8490970 CTGTGTCTATGAATGTAAATAGG + Intronic
1021465532 7:20938756-20938778 GTGTGACTGTGCAGGCAAATGGG + Intergenic
1022762246 7:33366859-33366881 CTGTCACTTTGTCTGTAAATTGG + Intronic
1023068969 7:36409395-36409417 CAGAGAATATGTAAGTAAATGGG - Intronic
1024752623 7:52486254-52486276 CTGTGTATATGTATGTACATAGG - Intergenic
1025171746 7:56764555-56764577 CTGTGGCTATTTAGGAAAATGGG - Intergenic
1025700118 7:63810983-63811005 CTGTGGCTATTCAGGAAAATGGG + Intergenic
1025842403 7:65163084-65163106 CTGTGGCTACGTAGGGAGATGGG + Intergenic
1025880642 7:65532885-65532907 CTGTGGCTACGTAGGGAGATGGG - Intergenic
1025892795 7:65669719-65669741 CTGTGGCTACGTAGGGAGATGGG + Intergenic
1028727063 7:94100209-94100231 ATGTGAGTATGTAGGAAAATGGG + Intergenic
1030359274 7:108578778-108578800 CTGTGACTATTAAGATAAATGGG + Intergenic
1034679554 7:152918313-152918335 CTGTGACAATGGGGGTGAATGGG - Intergenic
1034833849 7:154333389-154333411 CTGTCACTATGTTGCTATATTGG - Intronic
1042442199 8:68841530-68841552 TTGTGACTATGTAGCTATAGAGG + Intergenic
1046888341 8:119393800-119393822 ATGTGACTGTGAATGTAAATTGG + Intergenic
1049264810 8:141662067-141662089 CTATTACAATGTTGGTAAATAGG - Intergenic
1049763658 8:144342997-144343019 CTGTGTCTCTGTAGGTGAGTGGG - Intergenic
1052046192 9:23797029-23797051 CTGTGTCCATTTAGCTAAATTGG - Intronic
1052137358 9:24929588-24929610 TTGTGTCTATGTAGGCATATGGG + Intergenic
1052199199 9:25757338-25757360 ATGTGACTATGTATGAAGATAGG + Intergenic
1052447807 9:28587389-28587411 CTGTGACTAGGAAGGTGAAGAGG - Intronic
1054965176 9:71016875-71016897 TGGTGAATATGTAGATAAATTGG - Intronic
1055178457 9:73351347-73351369 CTGTGGGTAGGAAGGTAAATTGG - Intergenic
1055979053 9:81983651-81983673 GGGTGACGGTGTAGGTAAATTGG + Intergenic
1056314888 9:85378567-85378589 CTCTGACTTAGTAGGCAAATGGG + Intergenic
1057705022 9:97389919-97389941 CTGTGACTTCTTAAGTAAATGGG - Intergenic
1185798986 X:2992495-2992517 CCAGGTCTATGTAGGTAAATTGG - Intergenic
1193332270 X:80248127-80248149 TTGTGATTATGTAAGTTAATGGG + Intergenic
1193846641 X:86479682-86479704 CTGTAACTATGTATTTCAATTGG + Intronic
1195664270 X:107414356-107414378 CTGGGATTCTGCAGGTAAATTGG + Intergenic
1196596673 X:117553858-117553880 CTGTGACTCTGGAGCTAATTTGG + Intergenic
1197189881 X:123634409-123634431 GTGTGACTATGTATGTAGAGAGG - Intronic
1198710606 X:139497801-139497823 ATGTGACTATGTGGATAAAAGGG - Intergenic
1199675511 X:150185957-150185979 CTGGGGCTATGTGGGAAAATCGG + Intergenic
1200416216 Y:2913479-2913501 CTGTGTCTCTATAGGTAAAGTGG - Intronic
1200770744 Y:7123062-7123084 ATGTGATTATGCAGATAAATTGG - Intergenic
1202108508 Y:21396249-21396271 TTGAGAGTATGTAGATAAATTGG + Intergenic