ID: 977247596

View in Genome Browser
Species Human (GRCh38)
Location 4:94651609-94651631
Sequence CAGTCTAACCAGAGGCAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977247596_977247600 -7 Left 977247596 4:94651609-94651631 CCCACTTGCCTCTGGTTAGACTG 0: 1
1: 0
2: 0
3: 11
4: 113
Right 977247600 4:94651625-94651647 TAGACTGTAAATCTGGCTTTAGG 0: 1
1: 0
2: 1
3: 8
4: 196
977247596_977247602 22 Left 977247596 4:94651609-94651631 CCCACTTGCCTCTGGTTAGACTG 0: 1
1: 0
2: 0
3: 11
4: 113
Right 977247602 4:94651654-94651676 AGTAGTCTACCAAAAATGAAAGG 0: 1
1: 0
2: 0
3: 14
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977247596 Original CRISPR CAGTCTAACCAGAGGCAAGT GGG (reversed) Intronic
901232703 1:7650073-7650095 CAGTCTTACCAGGAGCAAGATGG + Intronic
904026099 1:27504693-27504715 CATTCTCACCAGAGGGAAGCAGG - Intergenic
905005507 1:34706475-34706497 CAGTGAATCCAGAGGCAAGAAGG + Intergenic
906191346 1:43901371-43901393 CAGTCTGTCCAGTGGGAAGTAGG - Intronic
908740387 1:67321456-67321478 CATTATAACCAGAGACATGTAGG + Intronic
912384756 1:109265762-109265784 CAGTCACACAAGAGGCAGGTGGG - Exonic
912445773 1:109735107-109735129 CAGTCTTACTGCAGGCAAGTGGG - Exonic
913218395 1:116639514-116639536 CAGTCTACACAGAGGCAAGAAGG + Intronic
914463915 1:147909356-147909378 CTGTCCAACCAGAGGCTGGTGGG - Intergenic
917701299 1:177584248-177584270 CAATTTTACCATAGGCAAGTGGG - Intergenic
917787269 1:178472203-178472225 CAGTCTAACTAAAGGAAAGTAGG - Intronic
919428118 1:197459334-197459356 CAGTCCAAACAGAGTAAAGTAGG - Intronic
922221941 1:223615310-223615332 AAGTCTAGCCAGAAGCAAATTGG - Intronic
922744293 1:228035647-228035669 CAGGCTCTCCAGGGGCAAGTGGG + Intronic
1067976350 10:51029862-51029884 CTGTGTAACCTGGGGCAAGTAGG + Intronic
1068358946 10:55950578-55950600 CATGCTAACCAGAAGCATGTAGG + Intergenic
1069031782 10:63603808-63603830 CAGTATAACTTGAGGCAAATAGG - Intronic
1075151657 10:119938235-119938257 TAGCTTAAGCAGAGGCAAGTTGG - Intronic
1080813764 11:35733563-35733585 CACTCCAACTAGAGGGAAGTAGG - Intronic
1081191679 11:40111537-40111559 TAGTCTATCCAAAGGCAACTGGG - Intergenic
1083323600 11:61862407-61862429 CAGTCCAGCCAGAGGCAGGGAGG + Intronic
1084110557 11:67011666-67011688 CAGTCCAAGCAGAGGAAACTGGG - Intronic
1084261452 11:67981450-67981472 CATTCTAACCAGAGGCTCTTTGG + Intergenic
1087250013 11:95888455-95888477 GAGTCTATCCAGAGGGAACTTGG - Intronic
1090443045 11:126740075-126740097 CAGTTTAACCTGAGGTAATTTGG + Intronic
1091007428 11:131966143-131966165 CACTCTAGCCAGAGTCTAGTTGG + Intronic
1093179367 12:15949996-15950018 CAGTGTAATCAGGGGAAAGTAGG - Intronic
1100107486 12:91193668-91193690 CAGGCTATGCAGAGGGAAGTGGG - Intergenic
1100596642 12:96077909-96077931 AAGTCTTAACAGAGGCAAGTGGG - Intergenic
1105808568 13:23973601-23973623 AAGCCCAACCAGAGGCAAGAGGG + Intergenic
1107076255 13:36324145-36324167 CATTCTTCCCAGAGGGAAGTGGG + Intronic
1108588571 13:51892496-51892518 CAATCTAACAGGAAGCAAGTGGG - Intergenic
1110326805 13:74225838-74225860 CAGTCTAAGAAGAGGAAAGAGGG + Intergenic
1110653728 13:77972602-77972624 CAGTCTAAAGAGAGTCAAGAGGG + Intergenic
1112381306 13:98893174-98893196 CAGTGTAACCAGAGCGAAATCGG + Intronic
1118153473 14:63214709-63214731 GAGTCAGACTAGAGGCAAGTGGG + Intronic
1120286332 14:82506486-82506508 AAGTTTAACCAGTGGAAAGTTGG - Intergenic
1121827957 14:97026258-97026280 CAGGCTTACCAAAGGGAAGTGGG + Intergenic
1122038509 14:98965290-98965312 CAGGCTCACCACAGGCAGGTGGG + Intergenic
1125795898 15:42403690-42403712 CAGTGTCACCAGAAGCAAGCAGG - Intronic
1127284522 15:57520837-57520859 CAGCTTAACCAGAAGGAAGTTGG - Intronic
1133277294 16:4646702-4646724 CAGTCTGCCCAGAGACATGTCGG + Intronic
1134084554 16:11347363-11347385 GAGTCTAACTAGAGGCAGATAGG + Intronic
1137913622 16:52404636-52404658 CAGGCTTCTCAGAGGCAAGTGGG - Intergenic
1145284539 17:21495557-21495579 CATCCTAAGCAGAGGCAAGGAGG + Intergenic
1147487814 17:40834920-40834942 CATTCTTACCAGAGGCCATTGGG + Exonic
1147685383 17:42283913-42283935 CTGTCCAAGCAGAGGCAAGGTGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1160089193 18:75810009-75810031 CAGTCAAAGCAGAGGAAAGGCGG - Intergenic
924977661 2:192779-192801 CAGGCTACCCAGGGGAAAGTTGG + Intergenic
926146172 2:10398248-10398270 CAAACTCACCAGATGCAAGTCGG - Intronic
927477574 2:23425698-23425720 CAGTCTAATCTAAGGCAAGCTGG - Intronic
928629964 2:33180950-33180972 TATTCTAATCAGAGACAAGTGGG + Intronic
946323735 2:218971132-218971154 CATTCTAAAGAGAGGCACGTGGG - Intergenic
947742567 2:232491287-232491309 CAGAGTAACCAGAGGAAAGAGGG - Intergenic
948149696 2:235735382-235735404 CAGTCTACACAGAGACAAGTCGG - Intronic
948341300 2:237254396-237254418 CACTGTAACCAGAGAAAAGTTGG + Intergenic
948856079 2:240731287-240731309 CAGACTAAACAGAGGCAGGGAGG + Intronic
1169518205 20:6341375-6341397 CAGTTTAAGCAGAAACAAGTTGG + Intergenic
1169882497 20:10362426-10362448 CAGTTTAACCAGATGCCAATGGG - Intergenic
1169995534 20:11552176-11552198 CAGTCCCACCTGAGGCAAGGGGG + Intergenic
1176062053 20:63176739-63176761 CAGTCTAAACAAAGGCCAGCGGG + Intergenic
1177905991 21:26971911-26971933 CAGTCTCACCCCTGGCAAGTAGG + Intergenic
1180819696 22:18817594-18817616 CGGTCTACACAGAGGCAAGAAGG + Intergenic
1181205921 22:21252039-21252061 CGGTCTACACAGAGGCAAGAAGG + Intergenic
1181792890 22:25282126-25282148 CAGGCTAAGCAGAGCAAAGTGGG - Intergenic
1181806019 22:25374901-25374923 CATTCTAACCAGGGGAAAGCTGG + Intronic
1181813529 22:25420464-25420486 CAGGCTAAGCAGAGCAAAGTGGG - Intergenic
1203221000 22_KI270731v1_random:43374-43396 CGGTCTACACAGAGGCAAGAAGG - Intergenic
1203269825 22_KI270734v1_random:43447-43469 CGGTCTACACAGAGGCAAGAAGG + Intergenic
950168748 3:10821467-10821489 AAGTGTAACCAGAGGAAAATGGG + Intronic
952168354 3:30776722-30776744 CAGTCTAACTAGAAGGAAGAGGG - Intronic
952828908 3:37546738-37546760 CAGTCCAGACAGAGGCAAGCAGG - Intronic
952834839 3:37593948-37593970 GAGTCTGACCAGGGGCAAGCAGG + Intronic
952928912 3:38344651-38344673 CAGTCTAGTCACAGGCAAGAAGG + Intergenic
954410983 3:50370977-50370999 CAGTCCAACCAGAGACGGGTCGG + Intronic
956020252 3:64926284-64926306 TAGTCCAACCAGAGGCATGTAGG + Intergenic
957897922 3:86447492-86447514 CAGACTACCGAGAGGAAAGTTGG + Intergenic
957980136 3:87498103-87498125 AAGGCTAACCAAAGGCAAATAGG - Intergenic
959565014 3:107825325-107825347 CAGGTTAAGCAGAGGCAAGTGGG - Intergenic
960445252 3:117740455-117740477 CAGACTAACCAGAGATAAGTTGG - Intergenic
963761906 3:149293253-149293275 CAGTTTAATCAGCAGCAAGTGGG + Intergenic
965574595 3:170205256-170205278 TAGTCTAGCCAGACACAAGTGGG + Intergenic
973766375 4:54166954-54166976 CATTCAAATCATAGGCAAGTGGG + Intronic
973824480 4:54691548-54691570 CAGCCTAAGGAGAGGCAGGTTGG + Intronic
977247596 4:94651609-94651631 CAGTCTAACCAGAGGCAAGTGGG - Intronic
983534864 4:168846675-168846697 CAGTCTACCCAGAGGAAGATAGG + Intronic
988238017 5:28572093-28572115 CAGTCTAAACAGAGACACATTGG - Intergenic
989550000 5:42723479-42723501 CAGTCTACTCAGAGGGATGTAGG - Intergenic
992005508 5:72473563-72473585 CAGTCTAAACAAAGGCAACGAGG - Intronic
992217274 5:74538387-74538409 CAGTCCCACAAGAGGCAACTTGG - Intergenic
994937326 5:106271859-106271881 CAATCTAACCAAAGACAAATTGG - Intergenic
997532719 5:134592144-134592166 CTGACTGACCAGAGGCAAGGAGG + Intergenic
998893982 5:146778460-146778482 CAGCCTACTCAGAGGCAATTTGG + Intronic
998939298 5:147263150-147263172 CAGTATTATCAGAGCCAAGTGGG - Intronic
1001838152 5:174849752-174849774 CATGCTAAACTGAGGCAAGTGGG - Intergenic
1002777320 6:340329-340351 CAGTCCACCCAGAGGTAAGTGGG - Intronic
1003144678 6:3499622-3499644 AAGTCTAACCAGAAGAAAATTGG + Intergenic
1004658998 6:17693307-17693329 CAGTCTTACCAGAAACCAGTTGG - Intronic
1014330380 6:120056246-120056268 CAGTCTACCCAAAGGCTAGTTGG + Intergenic
1015474922 6:133649597-133649619 CAGTCTAATCAGCTGCCAGTGGG + Intergenic
1016074272 6:139777562-139777584 CAGTATCACCAGAGGGAATTGGG + Intergenic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018641873 6:165911478-165911500 CTGTGTAACCAGATGAAAGTTGG - Intronic
1021377595 7:19927125-19927147 CAGGTTTACTAGAGGCAAGTAGG + Intergenic
1022387066 7:29910904-29910926 AAGTCTATCCAGAGCAAAGTTGG + Intronic
1022456508 7:30563036-30563058 CATTCTAACCAGAGTCAAGAGGG - Intergenic
1028236200 7:88364509-88364531 TAGTCTAACAAGAGTCATGTCGG + Intergenic
1031310959 7:120196439-120196461 CAGTTAAACCAGACGCAACTTGG - Intergenic
1032488792 7:132308368-132308390 CTTTCTAACCAGAGGCACATGGG - Intronic
1046939848 8:119920546-119920568 CATTCTAAGCAGAGGCATGGAGG + Intronic
1048375122 8:133816565-133816587 CAGTGGAACCAGAGGGAATTTGG + Intergenic
1048624829 8:136173591-136173613 CACTCTTACCACAGGCATGTAGG + Intergenic
1051009013 9:12387258-12387280 CAGTTTGACCAGAGGCCAGTGGG - Intergenic
1051842639 9:21415498-21415520 GAGTATAATTAGAGGCAAGTAGG + Intronic
1056256143 9:84801285-84801307 CTGCCTAACCAGCGGCAGGTGGG + Intronic
1059535147 9:115073738-115073760 CAGTCTCCCCACAGGCCAGTGGG - Exonic
1059609770 9:115879675-115879697 GAGTCTAACCAGAAGCCAGAAGG + Intergenic
1062176602 9:135166694-135166716 CAGTCCACCCAGCGGCAAGAAGG + Intergenic
1188169686 X:26909780-26909802 CACTCTTTTCAGAGGCAAGTGGG + Intergenic
1188379688 X:29476220-29476242 GAGTATAACCAGAGACAAGATGG + Intronic
1192230752 X:69263287-69263309 CCATCTAACCAGGGGCTAGTAGG + Intergenic
1196388133 X:115181179-115181201 CAGTGTAACTAGAGGGAAATGGG + Intronic
1196718144 X:118828973-118828995 CAGTCTCTCCAGAGCCAAGAGGG + Intergenic
1199565766 X:149214251-149214273 TTTTCTAACCAGAGGCAAGAAGG - Intergenic