ID: 977255020

View in Genome Browser
Species Human (GRCh38)
Location 4:94731139-94731161
Sequence TAGAGTATAAAGAAGGAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977255016_977255020 9 Left 977255016 4:94731107-94731129 CCATAGGATCCTAAATGGGGCAT No data
Right 977255020 4:94731139-94731161 TAGAGTATAAAGAAGGAGTATGG No data
977255018_977255020 0 Left 977255018 4:94731116-94731138 CCTAAATGGGGCATCACAGGATG No data
Right 977255020 4:94731139-94731161 TAGAGTATAAAGAAGGAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977255020 Original CRISPR TAGAGTATAAAGAAGGAGTA TGG Intergenic
No off target data available for this crispr