ID: 977256070

View in Genome Browser
Species Human (GRCh38)
Location 4:94741426-94741448
Sequence CACTGTGTGTTGTAAGATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977256067_977256070 3 Left 977256067 4:94741400-94741422 CCATATATGAGTCAGAGAAACAC No data
Right 977256070 4:94741426-94741448 CACTGTGTGTTGTAAGATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977256070 Original CRISPR CACTGTGTGTTGTAAGATAA GGG Intergenic
No off target data available for this crispr