ID: 977256309

View in Genome Browser
Species Human (GRCh38)
Location 4:94744306-94744328
Sequence TTTGTTTAAAACTAACAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977256309_977256311 -3 Left 977256309 4:94744306-94744328 CCTGGCTGTTAGTTTTAAACAAA No data
Right 977256311 4:94744326-94744348 AAATGAAAATGTTGGTATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977256309 Original CRISPR TTTGTTTAAAACTAACAGCC AGG (reversed) Intergenic
No off target data available for this crispr