ID: 977259605

View in Genome Browser
Species Human (GRCh38)
Location 4:94783023-94783045
Sequence GGTTGCACCCACCATTAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 55}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977259605_977259612 12 Left 977259605 4:94783023-94783045 CCTCTCTAATGGTGGGTGCAACC 0: 1
1: 0
2: 0
3: 4
4: 55
Right 977259612 4:94783058-94783080 ACAGTTACCTTTGGATGAAAGGG No data
977259605_977259614 28 Left 977259605 4:94783023-94783045 CCTCTCTAATGGTGGGTGCAACC 0: 1
1: 0
2: 0
3: 4
4: 55
Right 977259614 4:94783074-94783096 GAAAGGGTTTCTGTCTCTGACGG 0: 1
1: 0
2: 0
3: 21
4: 203
977259605_977259609 3 Left 977259605 4:94783023-94783045 CCTCTCTAATGGTGGGTGCAACC 0: 1
1: 0
2: 0
3: 4
4: 55
Right 977259609 4:94783049-94783071 GGCATGTCCACAGTTACCTTTGG 0: 1
1: 0
2: 6
3: 28
4: 152
977259605_977259611 11 Left 977259605 4:94783023-94783045 CCTCTCTAATGGTGGGTGCAACC 0: 1
1: 0
2: 0
3: 4
4: 55
Right 977259611 4:94783057-94783079 CACAGTTACCTTTGGATGAAAGG 0: 1
1: 0
2: 0
3: 16
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977259605 Original CRISPR GGTTGCACCCACCATTAGAG AGG (reversed) Intronic
901614680 1:10529068-10529090 GGTTGCATCAAAAATTAGAGGGG + Intronic
902294244 1:15455559-15455581 GCTTCCCCCCATCATTAGAGTGG + Intergenic
902297078 1:15474970-15474992 GCTTCCCCCCATCATTAGAGCGG + Intronic
903191991 1:21662090-21662112 GGCTGCACCCTGCATTGGAGTGG - Intronic
905743857 1:40396252-40396274 GACGGCACCCACTATTAGAGAGG - Intronic
906266191 1:44432007-44432029 GGTTGCAGCCAATATTACAGAGG - Intronic
910127814 1:83862894-83862916 GTTTGCACCCATTCTTAGAGAGG + Intergenic
915266708 1:154723893-154723915 TTTTGCACCCATTATTAGAGGGG + Intronic
918360392 1:183751386-183751408 GCTTGCATCCACCATTACTGAGG - Intronic
920180496 1:204129335-204129357 GTTTGGACCCACCAGTGGAGTGG - Intergenic
920210462 1:204324464-204324486 CTTTGCAGCCCCCATTAGAGAGG + Intronic
1062998528 10:1891776-1891798 GCTTTCACCCACCATTCCAGTGG + Intergenic
1072638069 10:97190035-97190057 GGTTCCACACACCATTAGCAAGG + Intronic
1075932744 10:126313248-126313270 GGTTTCCCCCACCAGTTGAGAGG + Intronic
1077315566 11:1918012-1918034 GGTTGGCCCCACCATGGGAGAGG + Intergenic
1080742953 11:35082729-35082751 GCTGCCACCCACCATTGGAGAGG - Intergenic
1083715885 11:64576769-64576791 GGTTGAACCCATGATTAGACTGG - Intergenic
1092817944 12:12327339-12327361 AGTTGCACCCACCATCCTAGGGG + Exonic
1106489441 13:30204934-30204956 GGTTGCAGCTTCCATTAAAGAGG + Exonic
1124371988 15:29109278-29109300 GGTTACACCCACCGTCAGGGTGG + Intronic
1128246126 15:66134058-66134080 GGTTGCAGCCACCATTAATCAGG + Intronic
1132933334 16:2469514-2469536 GGTTCCTCCCACCCTTAGGGTGG + Intergenic
1160132196 18:76235672-76235694 GGTTTCACACACCAGAAGAGAGG + Intergenic
935185043 2:100724163-100724185 GGTTGCACCAGCTATTGGAGTGG - Intergenic
941621410 2:167783465-167783487 TGATGCTCCCACCAGTAGAGTGG + Intergenic
942283357 2:174389759-174389781 GGTTGTACCCAGCAGTTGAGAGG - Intronic
944435428 2:199683979-199684001 GATTGCACCCACAATTAAAGTGG - Intergenic
945155480 2:206833226-206833248 CGTTTCAGCCACCAATAGAGTGG - Intergenic
947364657 2:229381438-229381460 GGTTGCAGCCACCTTTCCAGGGG - Intronic
1170545041 20:17428686-17428708 TGTTCCACCCACCATTAAAATGG + Intronic
1184256704 22:43291034-43291056 GGCTGTACTCACCATTGGAGCGG + Exonic
1184833519 22:47006667-47006689 GGGTGCAACCGCCACTAGAGCGG - Intronic
1185294459 22:50046398-50046420 GGTAGCACGCGCCATTAGAGAGG + Intronic
950705602 3:14778064-14778086 AGCAGCACCCACCATCAGAGGGG - Intergenic
964430879 3:156604812-156604834 GGTTGCACTCAGGAGTAGAGTGG - Intergenic
966681889 3:182650661-182650683 GCATGCACACATCATTAGAGTGG - Intergenic
970380162 4:15499311-15499333 GATTGCACCCACCACCAGAGTGG - Intronic
974699650 4:65424052-65424074 GGTGGGACTCACCATTAGAGTGG - Intronic
977259605 4:94783023-94783045 GGTTGCACCCACCATTAGAGAGG - Intronic
983054194 4:163082650-163082672 GGTTGCACCCACACTTCAAGGGG - Intergenic
994100896 5:95891599-95891621 GTTAGCATCCACCATTAGTGTGG - Intronic
996242523 5:121221235-121221257 GGGGGCACCCACCATTACTGAGG + Intergenic
1010294782 6:74183047-74183069 GCTTGCTCCTACCATCAGAGTGG + Intergenic
1017658215 6:156649859-156649881 GGTTGCTCCCTCACTTAGAGAGG + Intergenic
1018908303 6:168087877-168087899 GGTTGGAAGCACCATGAGAGGGG - Intergenic
1023031164 7:36091692-36091714 GGTTTCACCAGCCATTAGCGTGG - Intergenic
1027701038 7:81470417-81470439 GGTTGCACCTACCCTTTTAGGGG + Intergenic
1034304600 7:150038949-150038971 GGAGGCACCCACCACAAGAGTGG - Intergenic
1039642971 8:39244023-39244045 TGTTGCACCTACCATAAAAGGGG - Intronic
1040526090 8:48226472-48226494 GGATGCCCCCTCCATTAAAGGGG + Intergenic
1047174958 8:122531619-122531641 GCATGCACCAACCATTAGAAAGG + Intergenic
1049069723 8:140347130-140347152 AGGAGCCCCCACCATTAGAGCGG + Intronic
1049362141 8:142216884-142216906 GGTTTCAGCCCCCATCAGAGGGG + Intronic
1051008270 9:12376954-12376976 GTTTCCACCCACTATTGGAGAGG + Intergenic
1057354623 9:94323227-94323249 GGTTGCATCCCCCCTTGGAGCGG - Intronic
1057653134 9:96934408-96934430 GGTTGCATCCCCCCTTGGAGCGG + Intronic
1189870968 X:45382119-45382141 GCTGGCACCCACCACTGGAGGGG - Intergenic
1196019876 X:110980271-110980293 GGTTCCACCCACACTCAGAGGGG + Intronic
1196360917 X:114856863-114856885 AGTTTCACCCACCATTACATTGG + Intronic
1196980454 X:121208424-121208446 GTTTGTACCCACCCTTAGTGGGG + Intergenic