ID: 977262269

View in Genome Browser
Species Human (GRCh38)
Location 4:94812214-94812236
Sequence ATACTGTTATAGAAGAAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977262266_977262269 10 Left 977262266 4:94812181-94812203 CCAAAATTTAAAGTCAGTTAGAG 0: 1
1: 0
2: 1
3: 29
4: 255
Right 977262269 4:94812214-94812236 ATACTGTTATAGAAGAAGCAGGG No data
977262264_977262269 19 Left 977262264 4:94812172-94812194 CCTAGTCCTCCAAAATTTAAAGT 0: 1
1: 0
2: 1
3: 25
4: 274
Right 977262269 4:94812214-94812236 ATACTGTTATAGAAGAAGCAGGG No data
977262265_977262269 13 Left 977262265 4:94812178-94812200 CCTCCAAAATTTAAAGTCAGTTA 0: 1
1: 0
2: 4
3: 30
4: 375
Right 977262269 4:94812214-94812236 ATACTGTTATAGAAGAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977262269 Original CRISPR ATACTGTTATAGAAGAAGCA GGG Intronic
No off target data available for this crispr