ID: 977265137

View in Genome Browser
Species Human (GRCh38)
Location 4:94844901-94844923
Sequence GATAATAGTGGGCCAGACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 104}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977265137 Original CRISPR GATAATAGTGGGCCAGACCC TGG Intronic
900845609 1:5097975-5097997 GATAATAGTGGGACCACCCCTGG - Intergenic
901176298 1:7301906-7301928 GATGACAGGGGGCCAGGCCCAGG - Intronic
902413952 1:16228071-16228093 GATAAAAGTGGGACAGAGCGGGG - Intergenic
904319040 1:29684646-29684668 CATAATAGTGTGTCAGACCAGGG + Intergenic
904613430 1:31737440-31737462 GATCCTCGTGGGCCAGTCCCGGG - Exonic
908939401 1:69413213-69413235 GACAATAGTGGCTCAGAGCCTGG - Intergenic
911596563 1:99804751-99804773 GATCATTGTGGGCCAGATCTAGG + Intergenic
911836761 1:102629526-102629548 GTAAATAGTGTGCCAGACACTGG - Intergenic
912650389 1:111433466-111433488 GATAGTCATGGGCCAGACGCAGG + Intergenic
917159604 1:172042941-172042963 GAGAACAGTAGGCCAGACCAGGG + Intronic
918074947 1:181162962-181162984 AATAATAGGGGGCCTGAGCCAGG - Intergenic
918984653 1:191608528-191608550 GACAATAGTGGCTCAGAGCCAGG - Intergenic
921225841 1:213018154-213018176 GTTAACAGTGGGCCAGAACTTGG + Intergenic
1069043513 10:63718888-63718910 GATAAAAGTAGGTTAGACCCAGG + Intergenic
1070972004 10:80575333-80575355 GAAAATAGTTTGCCAGCCCCTGG - Intronic
1075500791 10:122971820-122971842 CACAATAGTGGGACAGACACAGG - Intronic
1079560608 11:21814414-21814436 GACAATAGTGGCTCAGAGCCAGG - Intergenic
1084742465 11:71148495-71148517 GATAAAAGTTGGCTTGACCCAGG + Intronic
1084785866 11:71441334-71441356 GATGATGGTGGGCGAGAACCAGG + Exonic
1084991801 11:72932603-72932625 GATAAGAGTGAGCCAAACCATGG - Intronic
1087031152 11:93705935-93705957 GATATTATTGAGCCAGACCTAGG + Intronic
1091507806 12:1090754-1090776 AATAATAATGGGCCAGGCACAGG - Intronic
1092661272 12:10740664-10740686 GAAAAGAGAGGGCCAGAGCCTGG - Intergenic
1095586331 12:43853792-43853814 GATCATAGTGGGCCAGGACAGGG + Intronic
1097262089 12:57725854-57725876 GATAGTAGTGGGAGGGACCCAGG + Intronic
1099208657 12:79758408-79758430 GAGAATAGTGGGCCAGAGTTAGG - Intergenic
1102826529 12:115951785-115951807 AATAATGGTGGGCCACACCCTGG - Intergenic
1103238738 12:119396588-119396610 GATCAAATTGGGCCAGACACAGG + Intronic
1110001223 13:70203900-70203922 GACAATAGTGGCCCAAAGCCAGG - Intergenic
1116160563 14:41262635-41262657 GATAATTATGGGCCAGGCACAGG - Intergenic
1116882333 14:50184243-50184265 AATAATAGTTGGCCATAACCGGG - Intronic
1121949214 14:98155755-98155777 CCTCATAGTGGGTCAGACCCGGG + Intergenic
1121957275 14:98226014-98226036 GATAATAGTGGGCTAGAAGAAGG + Intergenic
1124984314 15:34591432-34591454 GATGATAGTGTACCACACCCGGG - Intergenic
1125453753 15:39836179-39836201 GATGACAGTGGCCAAGACCCTGG - Intronic
1126381350 15:48050734-48050756 GACAATAGTGGCTCAGAACCAGG + Intergenic
1132347175 15:101115354-101115376 GAAAAGAGTGGGCAAGACTCAGG - Intergenic
1144066776 17:11631361-11631383 AATCTTAGTTGGCCAGACCCAGG + Intronic
1146599949 17:34205515-34205537 GATAATAGTCGGCCACCTCCAGG + Intergenic
1146810585 17:35899863-35899885 GAACACAGTGGGCCAGATCCTGG + Intergenic
1148725787 17:49789000-49789022 GAAAAATGTGGGCCCGACCCTGG + Intronic
1151252221 17:72845054-72845076 GATGATAGTGGTGCAGACCAAGG - Intronic
1152737787 17:82005742-82005764 GAGAATTGGGGGCCAGACCACGG + Intronic
1154472897 18:14722122-14722144 GATGATAGTGGTCCTGACCAGGG + Intergenic
1155231519 18:23779348-23779370 GATGATGGTGGTTCAGACCCAGG + Intronic
1156030102 18:32703195-32703217 CATAGTACTGGGCCAGACTCTGG + Intronic
1156445715 18:37235374-37235396 GCAAAGAGTGGGCCAGGCCCAGG + Intergenic
1159133305 18:64306305-64306327 GATCATGGTGGCCCAGACCAAGG + Intergenic
1166321889 19:42023766-42023788 GATACCAGTGGCCCAGGCCCGGG - Intronic
1168294535 19:55372448-55372470 GCTCACAGTGGGCCAGCCCCAGG + Intergenic
925613019 2:5718984-5719006 GGAAATAGTTGGCCAGAACCAGG + Intergenic
927011070 2:18904825-18904847 GATTATATTGGGCCCAACCCAGG - Intergenic
927107023 2:19836548-19836570 GATAATTGTTAGCCAGATCCTGG - Intergenic
928519448 2:32074447-32074469 GATAGTAGTAGGCCAGCTCCTGG + Intronic
934562252 2:95319477-95319499 GACACTGGTGGGCCAGGCCCAGG + Intronic
936678377 2:114741523-114741545 TATAATAGGGGGCTAGACTCCGG - Intronic
937228035 2:120381007-120381029 GCTAAAATTGGGACAGACCCAGG - Intergenic
937304125 2:120860728-120860750 GTTAACAATGGGCCAGGCCCAGG - Intronic
946131395 2:217609768-217609790 GAGCAGAGTGGGCGAGACCCTGG - Intronic
1169650158 20:7858126-7858148 GATGATAGTGGATCAGACCAGGG + Intergenic
1172639588 20:36432689-36432711 GGTAATGGTAGGCTAGACCCTGG - Exonic
1173701995 20:45080509-45080531 GATAAGAATGGGCCACACCAGGG - Intergenic
1175967005 20:62664786-62664808 GGTCAGAGTGGGCCAGACCCAGG - Intronic
1176801587 21:13435727-13435749 GATGATAGTGGTCCTGACCAGGG - Intergenic
950029425 3:9842455-9842477 GATGATAGGGAGCCAGACCTGGG - Intronic
952665170 3:35895383-35895405 GACAATAGTGGCTCAGAGCCAGG - Intergenic
954708623 3:52494119-52494141 GACAGGAGTGGGCCAGAGCCCGG - Intergenic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
966776754 3:183549325-183549347 GAAAATATAGGGCCTGACCCTGG - Intronic
968662398 4:1804147-1804169 GAGTCTAGAGGGCCAGACCCTGG - Intronic
972963740 4:44485596-44485618 GATAATAGTGGCTCAGAGCTAGG - Intergenic
972964089 4:44487603-44487625 GATGATAGTGGCTCAGAGCCAGG - Intergenic
974403073 4:61428261-61428283 GACAATAGTGGCTCAGAGCCAGG + Intronic
977265137 4:94844901-94844923 GATAATAGTGGGCCAGACCCTGG + Intronic
977407775 4:96621715-96621737 GAGAATAGTGGGCCATTTCCTGG + Intergenic
981680207 4:147388903-147388925 GATAATAGTGGCTCAGAACAAGG + Intergenic
985726516 5:1518771-1518793 GACGATAGGGGGCCGGACCCAGG + Intronic
995988656 5:118209699-118209721 GAAAAACGTGGGCCAGGCCCAGG + Intergenic
999703054 5:154245763-154245785 GATAAAAGTGGGCCTGGCCAGGG + Intronic
1001894040 5:175363567-175363589 GACAATAGTGGCTCAGAGCCAGG - Intergenic
1001894211 5:175364546-175364568 GATAATAGTGGCTCAGAGCCAGG - Intergenic
1005122465 6:22404707-22404729 GATAAAACTGGGACAGTCCCAGG - Intergenic
1005600265 6:27419770-27419792 GATAACAGTGGCCCAGACAGAGG - Intergenic
1007615330 6:43176447-43176469 GAGACCAGTGTGCCAGACCCTGG + Intronic
1011826033 6:91306674-91306696 GTTGATAGTGGGCTAGAGCCTGG + Intergenic
1013012873 6:106135644-106135666 GAAATGAGTGGGGCAGACCCAGG - Intergenic
1015111400 6:129595992-129596014 GATAATGGTGGTTCAGACCAGGG - Intronic
1015903810 6:138095818-138095840 GGGAATAGTGGTCCAGACACAGG - Intronic
1017077471 6:150632231-150632253 GACAATCGTGGCCCATACCCTGG - Intronic
1018855126 6:167669451-167669473 CAGAAAAGTGGGGCAGACCCTGG + Intergenic
1022131826 7:27411760-27411782 GATGATGGTGGCTCAGACCCAGG - Intergenic
1022412495 7:30149821-30149843 GTTTATCGTGGGCCAGCCCCAGG + Intronic
1022777181 7:33539304-33539326 GACAATAGTGGCTCAGAGCCAGG + Intronic
1023149868 7:37192193-37192215 GTAAAAAGTGGGCCAGAGCCAGG + Intronic
1024301278 7:47889519-47889541 GATAAGAGTGGGCCATGCCATGG - Intronic
1024655986 7:51451749-51451771 GATAATAATGGGACAGATCCTGG + Intergenic
1025185570 7:56855756-56855778 GATGATAGTGGTCCTGACCAGGG - Intergenic
1025686359 7:63721194-63721216 GATGATAGTGGTCCTGACCAGGG + Intergenic
1026841539 7:73671955-73671977 GGTGAGAGTGGGCCATACCCAGG + Exonic
1034884089 7:154784279-154784301 GACAAGAGTGAGCCAGACCTCGG + Intronic
1042195303 8:66227083-66227105 TATAATAGTGGGACAGGCCTAGG + Intergenic
1045914220 8:107447116-107447138 GATCATAGTGGCTCAGACCAGGG - Intronic
1053020159 9:34689062-34689084 GAGAAGAGTGTGCCAGACCAAGG + Intergenic
1053269505 9:36740353-36740375 GAGACTTGTGGGCTAGACCCTGG - Intergenic
1057110445 9:92464987-92465009 GATAATAATGGGATAGAGCCAGG - Exonic
1190433874 X:50404394-50404416 AATAATAGAGGGGCAGACCCTGG + Intronic
1191167358 X:57404779-57404801 GAAAGTCGTGGTCCAGACCCAGG + Intronic
1198602100 X:138295018-138295040 TAGAACAGTGGGCCAGGCCCAGG + Intergenic
1199552313 X:149073737-149073759 GACAATAGTGGCTCAGAGCCAGG - Intergenic
1199553343 X:149080086-149080108 GACAATAGTGGCTCAGAGCCAGG - Intergenic