ID: 977269844

View in Genome Browser
Species Human (GRCh38)
Location 4:94903680-94903702
Sequence GTGTCTTTAAGGAGGTGATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 781
Summary {0: 1, 1: 1, 2: 11, 3: 108, 4: 660}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977269838_977269844 26 Left 977269838 4:94903631-94903653 CCCTTATAATTTATACGTTGAAA 0: 1
1: 0
2: 10
3: 140
4: 993
Right 977269844 4:94903680-94903702 GTGTCTTTAAGGAGGTGATTGGG 0: 1
1: 1
2: 11
3: 108
4: 660
977269839_977269844 25 Left 977269839 4:94903632-94903654 CCTTATAATTTATACGTTGAAAT 0: 1
1: 0
2: 26
3: 229
4: 1447
Right 977269844 4:94903680-94903702 GTGTCTTTAAGGAGGTGATTGGG 0: 1
1: 1
2: 11
3: 108
4: 660

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977269844 Original CRISPR GTGTCTTTAAGGAGGTGATT GGG Intronic
901319098 1:8328912-8328934 GTGTCTTTCAGGAGGGGAGGAGG + Intronic
901358743 1:8676942-8676964 GTTTCTTGAAGGAGGAAATTGGG - Intronic
901987320 1:13086265-13086287 GTGTATTTAAGGTGGTGACAGGG + Intergenic
901994492 1:13140502-13140524 GTGTATTTAAGGTGGTGACAGGG - Intergenic
902038518 1:13475205-13475227 GGGGCTTTTGGGAGGTGATTAGG - Exonic
904061734 1:27716322-27716344 GGGTCATTTAAGAGGTGATTAGG + Intergenic
905776976 1:40674570-40674592 GGGACCTTCAGGAGGTGATTAGG + Intergenic
905784513 1:40743448-40743470 TTGTCTTTATGGAGGTGAGTTGG + Intronic
906388045 1:45389027-45389049 ATGGCTTTTAAGAGGTGATTGGG + Intronic
908051613 1:60238965-60238987 AGGTCTTTGTGGAGGTGATTAGG - Intergenic
908900679 1:68952914-68952936 GAGTCTTTTGGGAGGTGATTAGG + Intergenic
908927118 1:69269456-69269478 GGGTCCTTTGGGAGGTGATTAGG - Intergenic
908976040 1:69899713-69899735 GGGGCTTTTAAGAGGTGATTAGG + Intronic
909139615 1:71846867-71846889 GGGTCTTTTAGGAGGTGATTAGG - Intronic
909878848 1:80847569-80847591 GGGGCTTTTAAGAGGTGATTAGG - Intergenic
909943366 1:81635691-81635713 GGGCCTTTTGGGAGGTGATTAGG - Intronic
910159179 1:84255260-84255282 GGGTCCTTTGGGAGGTGATTAGG + Intergenic
910286262 1:85557707-85557729 GGGTCTTTAAAGAGGTAATTAGG + Intronic
910942957 1:92557045-92557067 CTTTTTTTAAGTAGGTGATTAGG - Intronic
911105148 1:94124025-94124047 GAGGCTTTGTGGAGGTGATTAGG - Intergenic
911269053 1:95778265-95778287 TTGTCCTTTGGGAGGTGATTGGG + Intergenic
911409404 1:97483672-97483694 GTGGCTTTTAAGAGGTGATTAGG + Intronic
911743909 1:101418253-101418275 GTGTATTGAAGGTGCTGATTTGG + Intergenic
911829224 1:102529772-102529794 TGGTCTTTGGGGAGGTGATTAGG - Intergenic
912204287 1:107493285-107493307 GGATCTTTAAAGAGGTAATTAGG + Intergenic
915482894 1:156199368-156199390 GGGCCTTTAAGCAGGTGAATGGG - Intronic
916574681 1:166056899-166056921 GGGGCTTTTGGGAGGTGATTAGG + Intergenic
917161889 1:172066562-172066584 GGGGCTTTTAAGAGGTGATTGGG - Intronic
917253285 1:173086561-173086583 GGGGCATTTAGGAGGTGATTAGG - Intergenic
917521483 1:175751527-175751549 TTGGCTTTTAGGAGATGATTAGG + Intergenic
917594625 1:176516515-176516537 GGGGCCTTTAGGAGGTGATTGGG + Intronic
918095159 1:181328324-181328346 GGGGCCTTTAGGAGGTGATTAGG - Intergenic
918220492 1:182432230-182432252 GTGTCTTTAAGGAAGTCTTTGGG - Intergenic
918440431 1:184561234-184561256 GTGTCTTTGAGGAGGGCAGTGGG - Intronic
918471146 1:184875871-184875893 GTTTTTTTAAGGAGTTGATAAGG + Intronic
918791306 1:188834134-188834156 GGGGCCTTTAGGAGGTGATTAGG + Intergenic
918850597 1:189683737-189683759 AGGACTTTTAGGAGGTGATTAGG + Intergenic
918905904 1:190493317-190493339 AGGCCTTTAAGTAGGTGATTAGG - Intergenic
919202028 1:194367331-194367353 GTTTCTTTTATGAGGTGAATAGG - Intergenic
919434365 1:197538814-197538836 GGGACTTTTAAGAGGTGATTGGG + Intronic
919662726 1:200263086-200263108 GGGACTTTAAGGAGGTAATTAGG + Intergenic
921739353 1:218666178-218666200 GGGGCCTTCAGGAGGTGATTAGG + Intergenic
921770260 1:219028364-219028386 GGGTCTTTAAAGGGGTAATTAGG - Intergenic
922360106 1:224813381-224813403 GGGCCTTCAGGGAGGTGATTAGG + Intergenic
922541201 1:226421324-226421346 GGGGCTTTTGGGAGGTGATTTGG - Intergenic
923189351 1:231605719-231605741 GGATCTTTAAGGAGGCAATTGGG - Intronic
923348493 1:233080707-233080729 GGGGCCTTCAGGAGGTGATTAGG - Intronic
923403409 1:233637274-233637296 GTGTTTTTGAGCAGGTGAATGGG + Intronic
923880534 1:238099365-238099387 GGGCCTTTTAGGAGGTGTTTAGG - Intergenic
1062917390 10:1251723-1251745 GGGGCCTTTAGGAGGTGATTAGG + Intronic
1063197106 10:3753598-3753620 GAGTCCTTAAGGATGGGATTAGG + Intergenic
1063541715 10:6940766-6940788 GTGTATTTACAGAGGTAATTAGG - Intergenic
1063600631 10:7477599-7477621 GAGGCTTTTGGGAGGTGATTAGG + Intergenic
1063760752 10:9072677-9072699 AAGTCTTTAAGGTGGTGATCGGG - Intergenic
1063813655 10:9744953-9744975 ATGTCTTTCAGAAGGTGAATAGG - Intergenic
1064874536 10:19977832-19977854 GTGGCCTTTGGGAGGTGATTAGG - Intronic
1064884746 10:20098495-20098517 GTGTTTTTGAAGATGTGATTAGG - Intronic
1065307068 10:24379458-24379480 GTGGCTTCAAGGAGATGACTGGG - Intronic
1066136286 10:32449767-32449789 GGGGCCTTTAGGAGGTGATTAGG + Intronic
1066548944 10:36533751-36533773 GTGTGTTTGAATAGGTGATTAGG - Intergenic
1066698924 10:38105632-38105654 ATGGCCTTTAGGAGGTGATTAGG - Intronic
1066993728 10:42542598-42542620 ATGGCCTTTAGGAGGTGATTAGG + Intergenic
1067364213 10:45610065-45610087 GGGGCTTTAGGGAAGTGATTAGG + Intergenic
1067707005 10:48613847-48613869 GAGTCTTTAAAGAGGTGATCAGG + Intronic
1067820785 10:49528026-49528048 GTGTCTTTAAAGAGCGTATTTGG - Intronic
1067838575 10:49657345-49657367 GGGACCTTCAGGAGGTGATTAGG - Intronic
1067968284 10:50939958-50939980 GGGAATTTTAGGAGGTGATTAGG + Intergenic
1068153108 10:53159928-53159950 GGGGCTTTTAGGAGGTGATTAGG + Intergenic
1068199121 10:53760262-53760284 GAGACTTTTAAGAGGTGATTAGG - Intergenic
1068249263 10:54415921-54415943 GTGAATTTAAGGAGGTGAATAGG + Intronic
1068623462 10:59211969-59211991 GGGACTTTTAAGAGGTGATTAGG + Intronic
1071765077 10:88654955-88654977 GAGTCTTTAAAGAGGTAATTAGG + Intergenic
1072230626 10:93411428-93411450 AGGCCTTTAGGGAGGTGATTAGG - Intronic
1072601101 10:96930718-96930740 GGGCCTTTTAAGAGGTGATTAGG + Intronic
1073020908 10:100442975-100442997 TTGTCTTGAAGGTGGTGGTTGGG - Intergenic
1073731534 10:106293985-106294007 GGGTCTGGTAGGAGGTGATTGGG + Intergenic
1075625237 10:123959396-123959418 GGGGCCTTTAGGAGGTGATTAGG + Intergenic
1075789725 10:125075318-125075340 GGGGCGTTAATGAGGTGATTAGG + Intronic
1075825385 10:125352941-125352963 GTGACTTTTAAGAGGTAATTAGG - Intergenic
1076350848 10:129814286-129814308 GGCCCTTTTAGGAGGTGATTAGG + Intergenic
1078710223 11:13783977-13783999 GGGCCTTTTGGGAGGTGATTAGG - Intergenic
1079881599 11:25934692-25934714 GGGTCTTTGAAGATGTGATTCGG + Intergenic
1080321375 11:31014087-31014109 GGGTCTTTAAGGAAGAAATTAGG + Intronic
1081015332 11:37871115-37871137 GGGACTTTTGGGAGGTGATTAGG + Intergenic
1081337072 11:41879969-41879991 GGGACATTTAGGAGGTGATTAGG + Intergenic
1081592292 11:44432774-44432796 GTGTCTTCAGAGAGGTCATTAGG - Intergenic
1083618623 11:64038151-64038173 CTGTTTCTAAGGAGGTGATGGGG + Intronic
1084377467 11:68787588-68787610 GGGTCTTTAATGAGGTCATTAGG + Intronic
1086435813 11:86780330-86780352 GTGTCTTTAAGAAAGTAATTAGG - Intergenic
1086448154 11:86889607-86889629 GTGGCCTTTAGGAGCTGATTAGG - Intronic
1087044680 11:93834861-93834883 GGGGCTTTTAAGAGGTGATTGGG + Intronic
1087046509 11:93848027-93848049 GGGGATTTAGGGAGGTGATTTGG - Intronic
1087412556 11:97809773-97809795 GTGGCCTTCAGGAGGTAATTAGG + Intergenic
1087761360 11:102107370-102107392 GGGCCTTTAAGGAGGTGATTAGG - Intergenic
1087795949 11:102454681-102454703 GAGGCTTTCCGGAGGTGATTTGG + Intronic
1088181525 11:107118092-107118114 GGGACTTTTAGGAGGTGATTAGG + Intergenic
1088776168 11:113085539-113085561 CTGTGTTTAACTAGGTGATTGGG + Intronic
1089645970 11:119879295-119879317 GTGATTTTTGGGAGGTGATTAGG - Intergenic
1090543158 11:127731069-127731091 GGGTCTTTAAAGAGATGTTTAGG - Intergenic
1090558855 11:127907116-127907138 GGGGCTTTTAAGAGGTGATTAGG - Intergenic
1090703742 11:129317986-129318008 GGGGCCTTGAGGAGGTGATTAGG + Intergenic
1090886433 11:130880943-130880965 GGGCCTTTGGGGAGGTGATTAGG + Intronic
1090954467 11:131502195-131502217 GTGGTCTTTAGGAGGTGATTAGG + Intronic
1090980475 11:131716247-131716269 GGGTCTTTTGGGAGGTAATTAGG - Intronic
1091118320 11:133035704-133035726 GGACCTTTAAAGAGGTGATTAGG + Intronic
1091269920 11:134300837-134300859 GAGCCTTTAAAGAGGTAATTAGG - Intronic
1092549752 12:9485535-9485557 GTTTCTTTAATGAAGTCATTAGG + Intergenic
1092670004 12:10852146-10852168 TGGCCTTTAAAGAGGTGATTAGG - Intronic
1092928635 12:13294693-13294715 GGGGCCTTTAGGAGGTGATTAGG + Intergenic
1093129815 12:15376812-15376834 GGGGCTTTTGGGAGGTGATTAGG - Intronic
1093967729 12:25345126-25345148 GGGGCTTTTGGGAGGTGATTAGG + Intergenic
1094042542 12:26132957-26132979 GTTTCTTTTAGGGGGAGATTAGG + Intronic
1094430868 12:30367910-30367932 GTGTCTTTAAGGGGATCATAGGG + Intergenic
1095447794 12:42299862-42299884 GGGGCCTTAGGGAGGTGATTAGG - Intronic
1095522308 12:43082146-43082168 GGGACTTTTAGGAGGTAATTAGG - Intergenic
1095772672 12:45979079-45979101 GGGGCTTTTAGGAGGTGATTAGG + Intronic
1095772693 12:45979216-45979238 GGGGCTTTTAGGAGGTGATTAGG - Intronic
1097558369 12:61168547-61168569 CTGGCTTTCAAGAGGTGATTGGG + Intergenic
1097723065 12:63044778-63044800 GGGTCCTTCAAGAGGTGATTAGG + Intergenic
1097927130 12:65141229-65141251 GGGGCTTTTAGGAGGTGATTAGG - Intergenic
1098724017 12:73939308-73939330 GGGGCTTTTGGGAGGTGATTAGG + Intergenic
1099242381 12:80153359-80153381 GAGCCTTTGAGGGGGTGATTAGG - Intergenic
1099485334 12:83222867-83222889 GGGTTTTTCAGGAGGTGATTAGG - Intergenic
1099632916 12:85173755-85173777 CAGTCTTTAAGGAGGTAATTAGG - Intronic
1100042816 12:90341524-90341546 GTTTCTTTAAGAAGGTGTTTGGG + Intergenic
1100164747 12:91903648-91903670 GGGTCCTTTAAGAGGTGATTAGG - Intergenic
1100180017 12:92074832-92074854 GTGTTTTTAAGCAGCTGATTGGG + Intronic
1100346493 12:93736617-93736639 ATGTCTTTTAGGATGTGACTAGG + Intronic
1100442732 12:94631360-94631382 GGGACTTTAAAGAGGTAATTAGG + Intronic
1101469258 12:104981304-104981326 GGGACCTTTAGGAGGTGATTAGG + Intergenic
1102775810 12:115517955-115517977 GGGCCTTTGAGGAGGTCATTAGG + Intergenic
1102799444 12:115718681-115718703 GGGGCCTTCAGGAGGTGATTAGG - Intergenic
1102879479 12:116473415-116473437 GGTGCTTTTAGGAGGTGATTAGG + Intergenic
1103843490 12:123884626-123884648 TGGGCTTTTAGGAGGTGATTAGG - Intronic
1103963812 12:124625600-124625622 GAGTCTCTAAAGAGGTGATTAGG - Intergenic
1103966867 12:124645684-124645706 GAGGCTTTGGGGAGGTGATTGGG + Intergenic
1104167220 12:126244305-126244327 GGGGCTTTTAGGAGATGATTAGG - Intergenic
1104407034 12:128526456-128526478 GGGCCTTTTGGGAGGTGATTAGG - Intronic
1104874581 12:132024969-132024991 GTCTCTCTAAGGAGGTCAGTGGG - Intronic
1105822243 13:24090008-24090030 GGGGCCTTTAGGAGGTGATTAGG - Intronic
1105947389 13:25201674-25201696 GTATCTCTCAGGAGATGATTCGG - Intergenic
1106697416 13:32191815-32191837 GGGGCCTTTAGGAGGTGATTAGG - Intronic
1106749484 13:32745767-32745789 GAGCCTTTGGGGAGGTGATTAGG - Intronic
1106808138 13:33332399-33332421 GGGGCTTTTAGGAGGTAATTAGG + Intronic
1107834581 13:44403326-44403348 GTGTCTTAAAGGAGGTTGTTTGG + Intergenic
1108161450 13:47644616-47644638 GGGACTTTCAGGAGGTGTTTTGG + Intergenic
1108207778 13:48108086-48108108 GTTTCTTTGAAGAGGAGATTAGG + Intergenic
1108249304 13:48549160-48549182 GTGACTTTTGGGAGGTGTTTAGG + Intergenic
1108281449 13:48866208-48866230 GTGGCTTTAGGGAGGTAATTAGG + Intergenic
1108440078 13:50443342-50443364 GGGGCCTTTAGGAGGTGATTAGG + Intronic
1109995000 13:70111559-70111581 GGGGCATTTAGGAGGTGATTGGG - Intergenic
1110157053 13:72330029-72330051 GGGGCCTTAAAGAGGTGATTAGG - Intergenic
1110256202 13:73436555-73436577 GTGTCTATTAACAGGTGATTTGG - Intergenic
1110727306 13:78840105-78840127 GGGGCTTTGAGGAAGTGATTAGG - Intergenic
1111201118 13:84938227-84938249 GTGTCCTTCAGGTGGTGAATTGG - Intergenic
1111204865 13:84993738-84993760 GGGTCTTTGTGGAGATGATTAGG - Intergenic
1112263200 13:97897348-97897370 GGGACTTTTGGGAGGTGATTAGG - Intergenic
1112340601 13:98549830-98549852 GGGGCCTTTAGGAGGTGATTAGG - Intronic
1112884040 13:104147100-104147122 GGGCCTTTTGGGAGGTGATTAGG - Intergenic
1113038715 13:106080915-106080937 GTGTCATTTAGGGGGTGATAAGG - Intergenic
1114381228 14:22206474-22206496 AGGTCTTTGAGGAAGTGATTAGG + Intergenic
1115626604 14:35199441-35199463 GAGGCCTTTAGGAGGTGATTAGG + Intronic
1115712454 14:36065961-36065983 GGGCCTTTCGGGAGGTGATTGGG + Intergenic
1116053606 14:39835935-39835957 GGGTCTTTCAGAAGGTGATTAGG - Intergenic
1116760310 14:49004997-49005019 GTGTCTTTAAGAAGATGACCTGG - Intergenic
1117003339 14:51393956-51393978 GGGTCTTTATAGAGGTAATTAGG - Intergenic
1117200453 14:53384719-53384741 GTGTCGTGGAGGAGGTGATTGGG - Intergenic
1117211899 14:53509409-53509431 GGGTCTTGAAGGAGGTGGGTGGG + Intergenic
1117514429 14:56486426-56486448 GTGGCCTTTGGGAGGTGATTAGG - Intergenic
1117679193 14:58185733-58185755 GTACCTTTTGGGAGGTGATTAGG + Intronic
1117754566 14:58960255-58960277 GGGGCCTTACGGAGGTGATTGGG + Intergenic
1117807422 14:59508680-59508702 GTGGCCTTTGGGAGGTGATTAGG + Intronic
1118655184 14:67939783-67939805 GGGCCTTTAGGGAGGTAATTAGG - Intronic
1119533181 14:75377899-75377921 GGGACTTTTAAGAGGTGATTAGG + Intergenic
1121887253 14:97554896-97554918 GTCTCTTTAAGAAAGTGGTTGGG - Intergenic
1121990205 14:98549904-98549926 GAGGCCTTTAGGAGGTGATTAGG + Intergenic
1122039968 14:98980192-98980214 GGGGCTTTTGGGAGGTGATTAGG + Intergenic
1123508996 15:20977139-20977161 GTTACTTTTAGAAGGTGATTGGG - Intergenic
1123566219 15:21550886-21550908 GTTACTTTTAGAAGGTGATTGGG - Intergenic
1123602481 15:21988173-21988195 GTTACTTTTAGAAGGTGATTGGG - Intergenic
1123881615 15:24681487-24681509 GAGGCTTTGGGGAGGTGATTAGG + Exonic
1123978692 15:25578541-25578563 AGGGCTTTTAGGAGGTGATTAGG + Intergenic
1124028874 15:25991138-25991160 GTGTCTTTAATGAGGCAATGAGG - Intergenic
1124082984 15:26518278-26518300 TGGGCTTTTAGGAGGTGATTAGG + Intergenic
1124145009 15:27116686-27116708 GGGGCCTTAAGGAGGTGATTGGG + Intronic
1124461452 15:29896044-29896066 GGGCCTTTTTGGAGGTGATTAGG - Intronic
1124626408 15:31310019-31310041 GTGGCCTTTGGGAGGTGATTAGG - Intergenic
1125249478 15:37683106-37683128 CTGTCTTTGAGGAGGTGACATGG + Intergenic
1125298247 15:38225951-38225973 GGGGCCTTTAGGAGGTGATTAGG + Intergenic
1126136675 15:45399401-45399423 GGGCCTTTTGGGAGGTGATTAGG + Intronic
1126341324 15:47644516-47644538 GGGCCTTCAAAGAGGTGATTAGG + Intronic
1126345126 15:47685589-47685611 GTGTCTTGAAGGGGGTCATGTGG - Intronic
1126363455 15:47870098-47870120 GGGACTTTTGGGAGGTGATTAGG + Intergenic
1126605914 15:50476008-50476030 TTTTCCTTAAGGAGGTGACTAGG + Intronic
1126607478 15:50493218-50493240 GGGCCTTTAAAGAGGTGATAAGG - Intronic
1127382856 15:58444707-58444729 GAGTCTTTAAAGAGGTGATTTGG - Intronic
1128218905 15:65953946-65953968 GGGTCTTTAGGGAGGATATTGGG - Intronic
1128220576 15:65965495-65965517 GTGGCCTTTGGGAGGTGATTAGG + Intronic
1128686699 15:69691627-69691649 GGGTCTTTTAAGAGGTGGTTAGG - Intergenic
1128912306 15:71527024-71527046 GGGTCCTTTAGGAGGTGATTAGG + Intronic
1129095222 15:73199944-73199966 GTGGCCTTTGGGAGGTGATTAGG - Intronic
1130050119 15:80477403-80477425 GGGGCCTTTAGGAGGTGATTAGG - Intronic
1130217162 15:81983275-81983297 AAGTCTTTAAGAAGTTGATTAGG + Intergenic
1130317272 15:82807500-82807522 GTGGCCTTTGGGAGGTGATTAGG + Intergenic
1130406002 15:83602561-83602583 GGGACCTTTAGGAGGTGATTAGG - Intronic
1130555504 15:84919730-84919752 ATGACCTTGAGGAGGTGATTAGG - Intronic
1131403142 15:92142511-92142533 GGGTTCTTCAGGAGGTGATTAGG - Intronic
1131599447 15:93831594-93831616 GTGACCTTTGGGAGGTGATTAGG - Intergenic
1131894488 15:97011442-97011464 GGGCCTTTGGGGAGGTGATTAGG - Intergenic
1131977089 15:97957774-97957796 GGGGCTTTGGGGAGGTGATTAGG - Intergenic
1131985221 15:98036481-98036503 GGGTCCTTTAGAAGGTGATTAGG - Intergenic
1202974586 15_KI270727v1_random:277975-277997 GTTACTTTTAGAAGGTGATTGGG - Intergenic
1133741745 16:8657024-8657046 GGGACTTTTAAGAGGTGATTAGG - Intergenic
1134023840 16:10940241-10940263 GCGGCCTTAGGGAGGTGATTAGG + Intronic
1134334839 16:13288884-13288906 GGGTCTTTAAGGAAGTAATTAGG - Intergenic
1134366155 16:13581243-13581265 CTGGCTGTAAGGAGGTGATGAGG - Intergenic
1134537177 16:15035343-15035365 GTGGCTGGAAGGAGGTTATTGGG + Intronic
1134600344 16:15528801-15528823 GGGGCTTTCAGGAGGTGATTAGG + Intronic
1134832363 16:17333929-17333951 GGGTCCTTTAGGAGGTGATCAGG + Intronic
1134887012 16:17802443-17802465 GTGTCTTTATGGAGGCCAATTGG - Intergenic
1135169195 16:20168241-20168263 GGGGCTTTTGGGAGGTGATTAGG + Intergenic
1137364063 16:47845422-47845444 GGGCCTTTAAAGAGGTAATTAGG - Intergenic
1137525765 16:49234940-49234962 GGGTCCTTTAGGAGGGGATTAGG - Intergenic
1137822381 16:51458457-51458479 GTGTGTCTAAAGAGGTGAATTGG + Intergenic
1137927802 16:52557873-52557895 GAGCCTTTAAAGAGGTGGTTAGG - Intergenic
1138377186 16:56572646-56572668 GGGGCTTTTAGGAGGTAATTAGG + Intergenic
1138716954 16:59034777-59034799 GCAGCTTTTAGGAGGTGATTAGG - Intergenic
1138941224 16:61793025-61793047 GGGGCTTTCAGGAGGTGATTAGG + Intronic
1139158570 16:64475239-64475261 TTGTCTTTGAGGAGGAGAATGGG + Intergenic
1139239446 16:65375901-65375923 GTGTCTTTAGGGAGGGGAAGAGG - Intergenic
1140199161 16:72880357-72880379 GGACTTTTAAGGAGGTGATTAGG + Intronic
1140609138 16:76577160-76577182 GTGACTTCCAGGAGGTGATGAGG + Intronic
1140835978 16:78794088-78794110 GGGTCTTTTGGGAGATGATTTGG + Intronic
1141632336 16:85295047-85295069 GGTGCTTTTAGGAGGTGATTTGG - Intergenic
1142145796 16:88492469-88492491 GTGGCTTTGGGGAGGTGACTGGG + Intronic
1142507168 17:371784-371806 GGGGCCTTTAGGAGGTGATTAGG + Intronic
1143847115 17:9780863-9780885 GTGTTTCTAGGGATGTGATTAGG - Intronic
1143908127 17:10226150-10226172 GGGGCCTTTAGGAGGTGATTAGG - Intergenic
1144671571 17:17135697-17135719 GGGGCCTTTAGGAGGTGATTAGG - Intronic
1144720779 17:17468442-17468464 GAGGCCTTTAGGAGGTGATTAGG - Intergenic
1145756610 17:27396424-27396446 GAGGCCTTTAGGAGGTGATTAGG + Intergenic
1146462460 17:33057025-33057047 GTGTGTTTAAGGAGGTGGGAAGG + Intronic
1148104089 17:45110129-45110151 GAGTCTTTAAGGAAGTGAACTGG - Exonic
1149554843 17:57566014-57566036 TTGTCTTTAAGGATGTCTTTGGG - Intronic
1151239217 17:72744774-72744796 GAGGCTTTGGGGAGGTGATTAGG - Intronic
1151377265 17:73698424-73698446 AGGTCTTTAAAGGGGTGATTAGG + Intergenic
1151871958 17:76842434-76842456 GGGTCTTTAAAGAGGTAATTAGG + Intergenic
1151901461 17:77018429-77018451 GGGCCTTTTGGGAGGTGATTAGG + Intergenic
1151901666 17:77020053-77020075 GGGGCCTTTAGGAGGTGATTAGG - Intergenic
1152328935 17:79659379-79659401 GTTGCTTTAAGGGGGTGACTTGG + Intergenic
1152918669 17:83054681-83054703 GGAGCTTTAAGGAGGTGACTGGG + Intergenic
1155086989 18:22468354-22468376 GGGGCTTTTAGGAGGTGATTAGG + Intergenic
1155319519 18:24605237-24605259 GGGCCTTTAAGGAGGTAATTAGG + Intergenic
1155553112 18:26987719-26987741 GGGTCTTTTGGGAGATGATTAGG + Intronic
1155701351 18:28747929-28747951 GGGGCTTAAAGGAGGTAATTAGG + Intergenic
1156137200 18:34056841-34056863 GTGTCTTCAAGGGGGGAATTAGG + Intronic
1156525413 18:37763102-37763124 GTGTCTCTGAGGATGAGATTGGG + Intergenic
1157436899 18:47677980-47678002 GGGGCCTTTAGGAGGTGATTAGG - Intergenic
1157946251 18:51984082-51984104 GAGACTTTTAAGAGGTGATTAGG - Intergenic
1158812555 18:61054344-61054366 GTGGCTTTAGAGAGATGATTAGG - Intergenic
1158888757 18:61853790-61853812 GGGACTTCAAGGAAGTGATTAGG - Intronic
1158992048 18:62879166-62879188 GGGACTTTAAAGAGGTGATTAGG + Intronic
1159297279 18:66510204-66510226 TTGTCTTTAAAAAGGTGATTTGG - Intronic
1159392058 18:67806292-67806314 GGGTCCTTTAAGAGGTGATTAGG + Intergenic
1159743232 18:72199628-72199650 GAGTCTTTGGGGACGTGATTAGG + Intergenic
1160128203 18:76198967-76198989 GGGGCTTTTAAGAGGTGATTGGG + Intergenic
1160539143 18:79610947-79610969 GTGTCCATAAGGAGGTGTGTGGG - Intergenic
1164439753 19:28265092-28265114 GTGTCTTAAAGAAGGTGAGGGGG - Intergenic
1164528716 19:29030764-29030786 GGGTCTGTTAGGAGGTGATTAGG + Intergenic
1164549908 19:29201273-29201295 GGGGCCTTAAAGAGGTGATTAGG + Intergenic
1165302983 19:34983833-34983855 GGGACTTTTAAGAGGTGATTTGG + Intergenic
1165528263 19:36375260-36375282 GGGTCTTTATGGAGGTAACTGGG - Intronic
1166151638 19:40879559-40879581 GTGTGTTTAAGGTGTTGGTTAGG + Intronic
1166907722 19:46124836-46124858 GTTTCTTTAAGGAGGAGACTGGG + Intergenic
1167664666 19:50817227-50817249 GTGACTTTGGGGAGGTGAGTAGG + Intergenic
1168476270 19:56677660-56677682 GAGGTTTTGAGGAGGTGATTTGG - Intergenic
1168490735 19:56806725-56806747 GGGGCCTTTAGGAGGTGATTAGG + Intronic
1168725778 19:58581139-58581161 CTCTCTTTAAGGAGCAGATTCGG - Intergenic
925305184 2:2843265-2843287 GTGTCCTTAGGGAGGTGATTAGG + Intergenic
925643139 2:6006510-6006532 GGGGCTTTTAGAAGGTGATTAGG + Intergenic
925687543 2:6488763-6488785 GGGGCTTTTGGGAGGTGATTAGG + Intergenic
925690006 2:6512078-6512100 GTGGCCTTTGGGAGGTGATTAGG + Intergenic
925739244 2:6991070-6991092 CTGTCTTTCAGTAGGTGAATGGG - Intronic
926060938 2:9804368-9804390 GGGGCCTTCAGGAGGTGATTAGG + Intergenic
926149059 2:10414568-10414590 CAGTCTTTAAAGAGGTCATTAGG - Intronic
926591079 2:14740953-14740975 GTTCCTTTAAGGAGGTAATAGGG - Intergenic
927050525 2:19323731-19323753 GGGGCTTTTGGGAGGTGATTAGG - Intergenic
927878884 2:26676507-26676529 GGGGCCTTTAGGAGGTGATTAGG + Intergenic
928467659 2:31537778-31537800 GGGCCTTTTAGGAGGTGTTTAGG + Intronic
929166603 2:38887982-38888004 GAGGCCTTTAGGAGGTGATTAGG + Intronic
929991432 2:46792544-46792566 GTGGCTTTTAGGAGGTGATTAGG + Intergenic
930363166 2:50407548-50407570 GGGGCTTTTAAGAGGTGATTGGG + Intronic
930402551 2:50908744-50908766 GGGTCCTTTAGGAGGTAATTAGG + Intronic
930476405 2:51888088-51888110 GGGACCTTAAGGAAGTGATTAGG - Intergenic
930547348 2:52785450-52785472 GGGCCTTTCGGGAGGTGATTAGG + Intergenic
931008136 2:57876353-57876375 GTGACTTTAAGCAAGTTATTTGG + Intergenic
931047653 2:58374232-58374254 GAGCCTTTAAGGAGGTAATTAGG - Intergenic
931117315 2:59178956-59178978 GGGACCTTTAGGAGGTGATTAGG - Intergenic
931627632 2:64271182-64271204 GGGCCTTTAGGGAAGTGATTAGG + Intergenic
931669046 2:64630514-64630536 GGGTCTTTATAGAGGTAATTAGG - Intergenic
932211913 2:69938417-69938439 CTGTTTTCAAGGAGGTGCTTAGG + Exonic
932600882 2:73124637-73124659 TAGTCTTTAAAGAGGTGATTAGG - Intronic
932709989 2:74055702-74055724 GTGGCCTTTAAGAGGTGATTGGG + Intronic
933133240 2:78699482-78699504 GGGCCTGTAAGGAGGTGTTTGGG + Intergenic
933939483 2:87233496-87233518 GGGACCTTCAGGAGGTGATTAGG + Intergenic
934836394 2:97593268-97593290 GGGCCTTTTGGGAGGTGATTAGG + Intergenic
935281060 2:101518287-101518309 GGGTCTTAAAGGATGAGATTTGG - Intergenic
935448439 2:103181468-103181490 GGGGCTTTTAGGAGGTGATTAGG - Intergenic
935613243 2:105048021-105048043 GTGTCTTTATGGAGAGGATGTGG - Intronic
935628969 2:105196415-105196437 GGGATTTTAGGGAGGTGATTAGG - Intergenic
936353652 2:111732277-111732299 GGGACCTTCAGGAGGTGATTAGG - Intergenic
936659491 2:114526779-114526801 GGGGCTTTGGGGAGGTGATTAGG - Intronic
936777105 2:115986846-115986868 GGGCCTATAAGGAGGTAATTAGG - Intergenic
937438462 2:121897863-121897885 GGGTCTTTAAGGAGGTAACAGGG - Intergenic
937621806 2:123997042-123997064 GGGTATTTTAGGAGGTAATTAGG + Intergenic
937635431 2:124150762-124150784 GGGACCTTTAGGAGGTGATTAGG - Intronic
937665374 2:124481243-124481265 AGGCCTTTCAGGAGGTGATTAGG - Intronic
937901581 2:127023762-127023784 GGGGCCTTCAGGAGGTGATTGGG - Intergenic
937933938 2:127227379-127227401 GGGTCCTTTAGGAGGTGATTAGG - Intergenic
937933973 2:127227559-127227581 GGGTCCTTTAGGAGGTGATTAGG - Intergenic
938174918 2:129117019-129117041 ATCTCTTTAAAAAGGTGATTGGG - Intergenic
938204536 2:129407757-129407779 GGGTCCTTTAAGAGGTGATTAGG - Intergenic
938211017 2:129465616-129465638 GAGGCCTTCAGGAGGTGATTAGG + Intergenic
938601372 2:132844384-132844406 GTATCTTTAAGGAAGGGAATAGG - Intronic
938803642 2:134786381-134786403 GGGGCTTTTGGGAGGTGATTAGG + Intergenic
938851785 2:135267867-135267889 GGGGCTTTTGGGAGGTGATTGGG + Intronic
938997851 2:136699640-136699662 GTGGCCTTTAGGAGGTGATTAGG - Intergenic
939280225 2:140054427-140054449 GTTTGCTTAAGGAAGTGATTTGG - Intergenic
939988221 2:148853160-148853182 GGGGCCTTTAGGAGGTGATTAGG - Intergenic
940069503 2:149669787-149669809 GGGACTTTTAGGAGGTGATTAGG + Intergenic
940636232 2:156300410-156300432 GGGGCCTTTAGGAGGTGATTAGG + Intergenic
940646570 2:156398560-156398582 GGGTCTTGTGGGAGGTGATTGGG - Intergenic
941635064 2:167927353-167927375 GGGCTTTTAAGGAGGTGATTGGG - Intergenic
941714892 2:168753829-168753851 GTGTGTGTGAGGATGTGATTTGG - Intronic
941833942 2:169995526-169995548 GTGACTTTAAGCAGATGATGTGG - Intronic
942174401 2:173318011-173318033 GGGTCATTAAGGAAGTAATTAGG - Intergenic
942458316 2:176152416-176152438 GTGTGTTTGAGGAGGTGGGTGGG + Intronic
942812717 2:180017541-180017563 GGGTCTTTTGAGAGGTGATTAGG + Intergenic
942815649 2:180050775-180050797 GAGGCTTTTAGGAGGTGATAGGG + Intergenic
943009903 2:182434597-182434619 GGGACTTTTAAGAGGTGATTAGG - Intronic
943370858 2:187014063-187014085 GTGGCCTTTAGGAGATGATTAGG + Intergenic
943572701 2:189592530-189592552 CTGTCTTTAAGGAAGTGGTATGG + Intergenic
943616194 2:190095398-190095420 GGGACTTTTGGGAGGTGATTAGG + Intronic
944005748 2:194903217-194903239 GTGGCCTCTAGGAGGTGATTGGG + Intergenic
944640427 2:201719240-201719262 GGGTCTTTTGGGAAGTGATTAGG + Intronic
945126464 2:206516649-206516671 GGGGCTTTTAGGAGGTAATTAGG - Intronic
945555381 2:211269392-211269414 GGGTCCTTTAAGAGGTGATTTGG + Intergenic
945607743 2:211957199-211957221 GGGTTTTTAAAGAGGTAATTAGG + Intronic
945635937 2:212351105-212351127 GAGCCTTTAAAGAGGTGATTAGG + Intronic
945684804 2:212956360-212956382 GTGTCTTTATGGGAATGATTAGG + Intergenic
946049114 2:216846948-216846970 AAGCCTTTCAGGAGGTGATTAGG - Intergenic
946280634 2:218663369-218663391 GAGTCTCTGAGGAGGTGATCAGG + Exonic
946565890 2:220965431-220965453 GTGTCTGTAAGGAGATGAGGAGG + Intergenic
946652734 2:221911243-221911265 GGGACTTTAGGGAGGTGGTTAGG - Intergenic
947682627 2:232049407-232049429 GGGTCTTTTGGGAGGTGTTTAGG + Intronic
947916604 2:233836234-233836256 GGGGCTTTCTGGAGGTGATTAGG + Intronic
947977094 2:234376139-234376161 GAGACCTTTAGGAGGTGATTAGG - Intergenic
948398238 2:237663352-237663374 GGAGCTTTTAGGAGGTGATTAGG + Intronic
948789157 2:240368431-240368453 GAGGCCTTTAGGAGGTGATTAGG + Intergenic
1169678039 20:8177169-8177191 GAGTCTTTTGGGAAGTGATTAGG + Intronic
1169953769 20:11078418-11078440 GTGCCCTTTAAGAGGTGATTGGG - Intergenic
1170184524 20:13573293-13573315 GGGCCTTTTGGGAGGTGATTAGG + Intronic
1170538530 20:17365330-17365352 GGGGCCTTTAGGAGGTGATTAGG - Intronic
1172278872 20:33696535-33696557 GTGTCCTAAAGGAGCTGATGTGG + Intergenic
1172942594 20:38664649-38664671 GGACCTTTAAGGAGGTAATTAGG - Intergenic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1173542922 20:43868166-43868188 GGGCCTTTAAGGAGGTAATTAGG + Intergenic
1173881289 20:46414443-46414465 GGGGCTTTTAGGATGTGATTAGG - Intronic
1173938400 20:46888969-46888991 GAGTCCTTGAAGAGGTGATTAGG - Intergenic
1174697257 20:52572711-52572733 GGGCCTATTAGGAGGTGATTAGG + Intergenic
1174706544 20:52662158-52662180 GGGTCTTTCAGGAGGTGATTTGG - Intergenic
1175060168 20:56234770-56234792 GTGTTTTTAAGGAGCTGTTGTGG - Intergenic
1175189977 20:57204912-57204934 GGGCCCTTTAGGAGGTGATTAGG + Intronic
1175630960 20:60536057-60536079 GTGGCCTTTAGGAGGTGATTAGG + Intergenic
1177001697 21:15621146-15621168 GGGTCTTTTGGGAGGTGATTAGG - Intergenic
1177095496 21:16826821-16826843 GAGCCTTTTAGAAGGTGATTAGG + Intergenic
1177375689 21:20268399-20268421 GGTTCTTTAAAGAGGTAATTAGG + Intergenic
1177394858 21:20520538-20520560 GTGGCCTTTGGGAGGTGATTAGG - Intergenic
1177535689 21:22423919-22423941 GGGTCCTTTGGGAGGTGATTAGG + Intergenic
1177568643 21:22857493-22857515 ATGTCCTTAAGAAGGTGAGTAGG - Intergenic
1177686446 21:24443252-24443274 GATGCTTTAAAGAGGTGATTAGG + Intergenic
1177781240 21:25624563-25624585 GGGACCTTAGGGAGGTGATTAGG + Intergenic
1177790035 21:25713117-25713139 GGGGCCTTTAGGAGGTGATTAGG - Intronic
1178181022 21:30161743-30161765 GGGTCTTTATAGAGGTAATTAGG - Intergenic
1178402180 21:32296229-32296251 GGATCTTTAAGGAGATAATTAGG - Intronic
1178903242 21:36614641-36614663 GAGTCCTTAAGAAGGGGATTAGG - Intergenic
1179087230 21:38228478-38228500 ATGTATTTAAGGTGGTGACTGGG - Intronic
1179222364 21:39419630-39419652 GGGCCTTTTGGGAGGTGATTAGG + Intronic
1179400647 21:41080057-41080079 GGGGCCTTCAGGAGGTGATTAGG - Intergenic
1179433308 21:41340531-41340553 GGGACATTTAGGAGGTGATTAGG - Intronic
1181886337 22:26025059-26025081 GGGGCTTTTGGGAGGTGATTAGG - Intronic
1182108365 22:27705129-27705151 GGGTCCTTTGGGAGGTGATTAGG - Intergenic
1183022285 22:35037040-35037062 GGGGCCTTTAGGAGGTGATTAGG - Intergenic
1183292198 22:37009782-37009804 GAGTCTTGAAGGAGGTGAAGAGG - Intergenic
1184743298 22:46441713-46441735 GGGTGCTTTAGGAGGTGATTAGG - Intronic
1185092712 22:48784997-48785019 GGGCCTGTGAGGAGGTGATTAGG + Intronic
949214650 3:1551446-1551468 TTGACTTTAAGGAGGTCATTTGG + Intergenic
949399185 3:3647799-3647821 GGGCCTTGAAGGAGGTAATTAGG - Intergenic
949758587 3:7442583-7442605 GTGTGCTTAAGGAGGTGAAGGGG + Intronic
950166803 3:10807037-10807059 GGACCTTTAAAGAGGTGATTAGG - Intergenic
950816037 3:15703410-15703432 GGGGCCTTTAGGAGGTGATTAGG + Intronic
950869934 3:16219721-16219743 GCCTCTTGAAGGAGGTGCTTTGG - Intronic
951108223 3:18770376-18770398 GGGGCCTTTAGGAGGTGATTAGG - Intergenic
951890477 3:27563639-27563661 GGGTCTTTGGGGAGGTGATTAGG - Intergenic
951891121 3:27569034-27569056 GGGACTTTTAAGAGGTGATTAGG + Intergenic
951979491 3:28549796-28549818 GGGTCTTTAAAGAGGTAATTAGG - Intergenic
952690633 3:36201032-36201054 GGACCTTTAAGGAGGTCATTAGG - Intergenic
952985917 3:38783134-38783156 GGGCCTCTAAGGAGGTGATTGGG - Intronic
953239554 3:41136605-41136627 GGGCCTTTGGGGAGGTGATTAGG + Intergenic
953549573 3:43891017-43891039 GGGGCCTTCAGGAGGTGATTTGG + Intergenic
954233169 3:49234548-49234570 GGGTCCTTAAGGAGGTAATGAGG - Intronic
955123148 3:56082215-56082237 GGGGCCTTTAGGAGGTGATTAGG + Intronic
955298821 3:57757443-57757465 GCGTTTTAAAGGAGGTGATGGGG + Exonic
955454699 3:59106980-59107002 GGGTCCTTTAGGAGGTGATGAGG - Intergenic
955478690 3:59366846-59366868 GTGGCCTTTTGGAGGTGATTAGG + Intergenic
955792831 3:62606282-62606304 GGGGCTTTTAAGAGGTGATTGGG + Intronic
955847511 3:63181568-63181590 GTGGCCTTTAGGAGGTGATGGGG - Intergenic
955952668 3:64257851-64257873 GGGGCTTTTGGGAGGTGATTAGG + Intronic
956500448 3:69877746-69877768 CTGTCTTTAAGGAGCTCATGAGG + Intronic
957195635 3:77063415-77063437 GTGTGTTTAGGGAGATAATTAGG + Intronic
957258326 3:77867542-77867564 GTGGCCTTTAAGAGGTGATTAGG - Intergenic
957587408 3:82149837-82149859 GGGCCTTTAGGGGGGTGATTAGG - Intergenic
957805921 3:85149241-85149263 GAGACTTTTAAGAGGTGATTAGG + Intronic
958781091 3:98543324-98543346 GGGACCTTTAGGAGGTGATTGGG + Intronic
959167596 3:102799737-102799759 GGGTCTTTAAGGAGGTAATTAGG - Intergenic
959524344 3:107359962-107359984 GGGCCTTTGGGGAGGTGATTAGG + Intergenic
959569303 3:107866307-107866329 GGGGCTTTTAGGAAGTGATTAGG + Intergenic
960121274 3:113950521-113950543 GAGACCTTAAGGAGGTGATTAGG - Intronic
960697732 3:120412316-120412338 GAGGCCTTTAGGAGGTGATTAGG + Intronic
960772086 3:121205450-121205472 GAGACTTTTAAGAGGTGATTAGG - Intronic
960825725 3:121781984-121782006 GTGTGTATAAGGAGGGGAATGGG + Intronic
961697361 3:128714749-128714771 GTGCCCTTTGGGAGGTGATTAGG + Intergenic
961938164 3:130608095-130608117 GGGGCCTTTAGGAGGTGATTAGG - Intronic
961950153 3:130741160-130741182 GAGCCTTTAAGGAGTTAATTAGG + Intronic
961993172 3:131213885-131213907 GAGGCCTTTAGGAGGTGATTTGG + Intronic
962203826 3:133419210-133419232 GGGTCTTTAAAGAGGTAATTCGG - Intronic
963269378 3:143270540-143270562 ATGTCTTTATGGAGGTGAGGTGG + Intronic
963461620 3:145621204-145621226 GTGTCTTAAAGGAGGAGAGTTGG + Intergenic
963577453 3:147078725-147078747 GTGTCCTTTAGGAGTTAATTAGG + Intergenic
963989378 3:151635506-151635528 GGGTTTTTGGGGAGGTGATTAGG - Intergenic
964094009 3:152910526-152910548 GGGCCTTTATGGAGGTGATTAGG - Intergenic
964100200 3:152979737-152979759 GGGTCTTTAAAAAGGTAATTAGG - Intergenic
964274789 3:154998281-154998303 GGGGCTTTTAGGAGGTAATTAGG - Intergenic
964438401 3:156676758-156676780 GTCTCTTTCAGTAGTTGATTAGG + Intronic
964628877 3:158787386-158787408 GTAGCTTTTAGGAGGTCATTAGG + Intronic
965359457 3:167720053-167720075 CTGTGTTTAATGAGGTGAGTTGG - Exonic
965431743 3:168597316-168597338 GGGTCTTTTAGGAGGTGGTTGGG + Intergenic
965632693 3:170749534-170749556 GTGTGTTTAAAGAGATGATGGGG - Intronic
965649178 3:170915816-170915838 GAGGCTTTTAAGAGGTGATTGGG + Intergenic
966544694 3:181132557-181132579 GGGACTGTTAGGAGGTGATTAGG - Intergenic
966608748 3:181847544-181847566 AGGTCTTGAAGGAGGTGATCTGG - Intergenic
966640864 3:182188054-182188076 GGGGCTTTTTGGAGGTGATTGGG - Intergenic
966684619 3:182680456-182680478 AAGTCTTTAAAGAGGTCATTAGG + Intergenic
966739367 3:183217872-183217894 GTGACATTTAGGATGTGATTGGG + Intronic
966822486 3:183936066-183936088 GGGGCTGTAAGGAGGAGATTAGG + Intronic
967078636 3:186028052-186028074 GGGGCCTTCAGGAGGTGATTAGG + Intergenic
967209823 3:187158517-187158539 GGGGCTTTTAGGAGGTGATTAGG - Intronic
967425514 3:189322758-189322780 GTGTCCTTTAGAAGGTCATTTGG - Exonic
967595800 3:191325760-191325782 GGGTCTTTAAGGAAGACATTTGG + Intronic
967775316 3:193380461-193380483 GTGTATTTAATGTGGTGTTTAGG - Intergenic
968256785 3:197281396-197281418 GGGACCTTTAGGAGGTGATTAGG - Intronic
968258747 3:197301471-197301493 GAGGCTTTTGGGAGGTGATTAGG - Intergenic
969887789 4:10231680-10231702 GGATCCTTTAGGAGGTGATTAGG - Intergenic
969991826 4:11272181-11272203 GTGCCTTTAAAGAGGTAACTAGG - Intergenic
970012864 4:11479866-11479888 GGGAATTTTAGGAGGTGATTAGG - Intergenic
970083596 4:12319586-12319608 GAGGCTTTGAGGAGGTGATTAGG - Intergenic
970209888 4:13698173-13698195 TGGCCTTTAGGGAGGTGATTAGG - Intergenic
970571908 4:17391768-17391790 GGGCCTTTAAAGAGATGATTAGG + Intergenic
970900508 4:21153086-21153108 ATGTGTTTAAGGAGTTAATTAGG - Intronic
971098132 4:23431599-23431621 GGGACTTTTAGGAGGTGATTAGG - Intergenic
971646097 4:29205708-29205730 GTTTCTTTTAGGAGGTTCTTGGG + Intergenic
972088856 4:35255555-35255577 GTGGCCTTTAGGAAGTGATTAGG + Intergenic
972341133 4:38153673-38153695 GGGTCTTTTGGGAGGTAATTAGG - Intergenic
972803724 4:42506089-42506111 TAGTCTTTAAGGAGGTAATTAGG + Intronic
973033415 4:45373290-45373312 GGGACCTTAGGGAGGTGATTAGG + Intergenic
973766440 4:54167589-54167611 GGGGCTTTGGGGAGGTGATTAGG - Intronic
974010999 4:56607166-56607188 GGGGCTTTCAGGAGGTGATTGGG + Intergenic
974092251 4:57323298-57323320 GGGGGTTTTAGGAGGTGATTCGG - Intergenic
974095751 4:57362066-57362088 GGGTCTTTAAGGAGGTAATAAGG - Intergenic
974308810 4:60176473-60176495 GGGGCCTTAAGGAGGTCATTAGG + Intergenic
975364226 4:73509884-73509906 GTGCCTTTGGGGAGGTGATTAGG - Intergenic
975723995 4:77274653-77274675 TTGTCTGGAAGGAGATGATTAGG - Intronic
976129233 4:81867129-81867151 GAGACCTTTAGGAGGTGATTAGG - Intronic
976539874 4:86262157-86262179 GGGACTTTTAAGAGGTGATTAGG + Intronic
976843790 4:89463515-89463537 GTGACCTTTAGGAGGTGATTAGG + Intergenic
977089666 4:92654331-92654353 GTGGCTTTGGGGAGGTAATTTGG - Intronic
977127373 4:93187099-93187121 GGGGCTTTTGGGAGGTGATTAGG - Intronic
977269844 4:94903680-94903702 GTGTCTTTAAGGAGGTGATTGGG + Intronic
977465080 4:97373646-97373668 GGGACTTTTAGAAGGTGATTGGG + Intronic
977675959 4:99747258-99747280 GGGGCCTTTAGGAGGTGATTAGG - Intergenic
979057647 4:116016283-116016305 ATGTATTTAAGGTGGTGACTGGG + Intergenic
979435739 4:120687706-120687728 GGGACTTTTAGAAGGTGATTAGG + Intronic
980070921 4:128242361-128242383 GGGGCTATAAGGAGGTGATTAGG - Intergenic
980119403 4:128712241-128712263 GGGGCTTTTAGGAGATGATTAGG - Intergenic
980145566 4:128979328-128979350 GGGCCTTTTGGGAGGTGATTAGG + Intronic
980274848 4:130636523-130636545 GAGCCATTAAGGAGGTAATTAGG + Intergenic
981181982 4:141756647-141756669 GTTTCTTGAAGGAGGTGAGAAGG + Intergenic
981422491 4:144567234-144567256 GGGCCTTTTAGGAGATGATTAGG + Intergenic
981506704 4:145508913-145508935 GAGTCCTTTGGGAGGTGATTAGG - Intronic
981686524 4:147460636-147460658 GCGCCTTTTGGGAGGTGATTAGG + Intergenic
981849365 4:149210582-149210604 GGGGCTTTTAAGAGGTGATTGGG - Intergenic
981909995 4:149967890-149967912 GGGACTTTTAAGAGGTGATTAGG + Intergenic
982450255 4:155544224-155544246 GGGGCATTTAGGAGGTGATTAGG - Intergenic
982590978 4:157309944-157309966 ATGTCTTTAAGAAGGTGACAAGG + Intronic
983187214 4:164713804-164713826 GGGACTTTTAAGAGGTGATTAGG - Intergenic
984578937 4:181487589-181487611 GTGACTTTGGGGAGGTGATTAGG - Intergenic
984808488 4:183773017-183773039 GGGGCTTTTGGGAGGTGATTAGG - Intergenic
985902173 5:2805159-2805181 GGGGCTTTTGGGAGGTGATTAGG + Intergenic
986214519 5:5706979-5707001 GAGGCTTTGGGGAGGTGATTGGG + Intergenic
986406099 5:7426540-7426562 GGGGCCTTTAGGAGGTGATTAGG - Intronic
986461004 5:7972239-7972261 GGGTCTGGTAGGAGGTGATTGGG + Intergenic
986573330 5:9188083-9188105 GGGGCTTTAGGGAGGTGATTAGG + Intronic
986691141 5:10314905-10314927 GGGGCCTTTAGGAGGTGATTGGG + Intergenic
986828894 5:11552607-11552629 GTGCCTTTAAGGTAGTCATTTGG - Intronic
987102944 5:14608476-14608498 GTGTCCTTTGGGACGTGATTAGG - Intronic
987466070 5:18273447-18273469 GGGGCTTTTAGGAGGTCATTAGG - Intergenic
988273213 5:29044866-29044888 GGGGCTTTGGGGAGGTGATTAGG + Intergenic
988411321 5:30889288-30889310 GGGTCTTTAAAGAGGTAATTTGG - Intergenic
988420541 5:31000366-31000388 GCCTCATTAAGGAGGTGTTTGGG + Intergenic
988652933 5:33173405-33173427 GGGTCTTTAGGGAAGTGATTAGG + Intergenic
988833914 5:35013262-35013284 GTGCGTTTAAGTAGGTAATTAGG + Intronic
989206899 5:38818648-38818670 CTGTATTTTAGGAGGAGATTTGG - Intergenic
989311092 5:40018747-40018769 GAGAATTTAAGGAGGTAATTAGG + Intergenic
989312751 5:40039521-40039543 GGGCTTTTAAAGAGGTGATTAGG - Intergenic
990245030 5:53856100-53856122 GTGTCTTTGCAGATGTGATTAGG - Intergenic
990553433 5:56907624-56907646 GTTTCTTAAAGTAGGTTATTAGG - Intergenic
990949661 5:61286192-61286214 GGGGCCTTTAGGAGGTGATTAGG - Intergenic
990985333 5:61636377-61636399 TGGTCTTACAGGAGGTGATTAGG + Intergenic
991574038 5:68084133-68084155 GGGGCTTTTAGAAGGTGATTAGG + Intergenic
991597429 5:68320032-68320054 GCAACTTTTAGGAGGTGATTAGG - Intergenic
991654409 5:68889321-68889343 GGGGCCTTCAGGAGGTGATTAGG + Intergenic
992810449 5:80382483-80382505 GAGGCCTTCAGGAGGTGATTAGG - Intergenic
993072477 5:83182688-83182710 GTGGCTCTTGGGAGGTGATTCGG + Intronic
993223201 5:85130424-85130446 GAGTCTTTAGCAAGGTGATTAGG - Intergenic
993313241 5:86364699-86364721 GTGCCTTTAATAAGCTGATTTGG - Intergenic
993491887 5:88561772-88561794 GGGGCTTTTAGGAGGTAATTAGG + Intergenic
994309901 5:98257893-98257915 TTGTCTTTAAGGAGGAGACAGGG - Intergenic
994615661 5:102100958-102100980 GGGGCCTTTAGGAGGTGATTAGG - Intergenic
994741415 5:103624333-103624355 GTTTTTTTAAGGAGAGGATTTGG - Intergenic
994801106 5:104377790-104377812 GGGCCTTTAAAGAGGTGATTAGG + Intergenic
994932716 5:106209372-106209394 ATGGCATTTAGGAGGTGATTAGG - Intergenic
995053450 5:107732725-107732747 GTGTCTTTCAGTAGGGGAATAGG - Intergenic
995364071 5:111334985-111335007 GTGTCTTTGCTGAGGTTATTAGG - Intronic
995803717 5:116028044-116028066 GGGACTTTTAAGAGGTGATTAGG - Intronic
995835071 5:116392527-116392549 GGGACGTTTAGGAGGTGATTAGG - Intronic
996311902 5:122116112-122116134 GGGCCTTTGGGGAGGTGATTAGG - Intergenic
996611320 5:125383346-125383368 GTGGCCTTTAGGAGGTGATTGGG + Intergenic
997439428 5:133898872-133898894 GTGTCTCTAAGGATGTCATCCGG + Intergenic
998971291 5:147595300-147595322 GAGGCTTTTAGGAGGTTATTAGG + Intronic
999121114 5:149210093-149210115 GAGTCTTTGAGGAGGACATTTGG - Intronic
999805341 5:155075871-155075893 TTGACTTTAAGGAGGTGCTAAGG - Intergenic
1000041273 5:157486863-157486885 AGGTCTTTAAAGAGGTGATTAGG + Intronic
1000164007 5:158629493-158629515 GTGCCTTCAAGGAGGTCATTTGG - Intergenic
1000292574 5:159884318-159884340 GGGACTTTTAAGAGGTGATTAGG + Intergenic
1000690063 5:164306538-164306560 GGGCCTTTAAAGAGGTAATTAGG + Intergenic
1000697615 5:164407436-164407458 GAGCCTTTAAAGAGGTAATTAGG + Intergenic
1000943318 5:167390161-167390183 ATGTATTTACGGAGTTGATTTGG + Intronic
1002328754 5:178427520-178427542 ATGTCTTTCAGTAGGTGAGTGGG + Intronic
1002573986 5:180161309-180161331 GTGTCTTTTGGGAGGTGAGTGGG + Intronic
1003251393 6:4431884-4431906 GGGCCTTTGTGGAGGTGATTCGG - Intergenic
1003420591 6:5954269-5954291 TTGTCTTTAGGGAGGTGAACTGG + Intergenic
1003420612 6:5954608-5954630 TTGTCTTTAGGGAGGTGAACTGG + Intergenic
1003449875 6:6220591-6220613 GTGTTTTTAAGGAAGAGATATGG + Intronic
1003617491 6:7668770-7668792 GGGTCTTTAAAGAGGTAATTAGG + Intergenic
1003668373 6:8132486-8132508 GAGCCTTTAAAGAGGTGATTAGG - Intergenic
1003903182 6:10674229-10674251 GGGTCTTTAGGGAGATGATTAGG - Intronic
1004135507 6:12962225-12962247 GTGTCTTTATAGAAGAGATTAGG - Intronic
1004184043 6:13406752-13406774 GTGTCTGACAGTAGGTGATTGGG + Intronic
1004308547 6:14523181-14523203 GTGTGTTTGTGAAGGTGATTCGG - Intergenic
1004904123 6:20220378-20220400 GGGGCTTTTGGGAGGTGATTAGG - Intergenic
1005240799 6:23823024-23823046 GAGGCTTTGGGGAGGTGATTAGG - Intergenic
1006761245 6:36463594-36463616 GAGGCCTTTAGGAGGTGATTAGG + Intronic
1006810197 6:36815421-36815443 GAGGCTTTGGGGAGGTGATTAGG + Intronic
1007008844 6:38395070-38395092 GGGGCTTTGGGGAGGTGATTAGG + Intronic
1007364336 6:41380554-41380576 GGGCCTTTTAGGAGGCGATTAGG - Intergenic
1007367490 6:41405305-41405327 GGGGCCTTTAGGAGGTGATTAGG - Intergenic
1007421629 6:41723319-41723341 GTGTCTTTGGGGAGGTGGGTGGG - Intronic
1007468008 6:42068763-42068785 GTGTCTCTAAGCAGGAGATTGGG - Intronic
1007589650 6:43013634-43013656 GTGTCTTTTAGGAGGTGGCAGGG - Intronic
1007888179 6:45256473-45256495 GGGGCTTTTAGGAGGTGATTAGG - Intronic
1008135317 6:47769546-47769568 GGGGCCTTAAAGAGGTGATTAGG + Intergenic
1008397160 6:51022355-51022377 GTGCCTTTGAGGAGGTGATTAGG - Intergenic
1008863956 6:56187337-56187359 GGGTCCTTTAAGAGGTGATTGGG - Intronic
1008868103 6:56239810-56239832 GAGGCCTTTAGGAGGTGATTAGG + Intronic
1009338698 6:62526828-62526850 GAGACTTTTGGGAGGTGATTAGG + Intergenic
1010015822 6:71104176-71104198 GGGGCCTTTAGGAGGTGATTAGG - Intergenic
1010249360 6:73692212-73692234 CTGTCTTTAAGGTGTTGATATGG - Intergenic
1010687706 6:78871625-78871647 GAGGCTTTTAGGAGGTGATTGGG + Intronic
1010729972 6:79380901-79380923 GGGTCTTTAAAGATGTAATTAGG - Intergenic
1010778741 6:79918309-79918331 GTGTGTATAAGGGTGTGATTGGG + Intronic
1011248859 6:85349111-85349133 TTGTCTTTTAGAAGGTGATGTGG + Intergenic
1011255859 6:85420163-85420185 GGGGCCTTTAGGAGGTGATTTGG - Intergenic
1011709968 6:90043273-90043295 GGGACCTTTAGGAGGTGATTGGG + Intronic
1011800379 6:91006477-91006499 GGATCTTCAAGGAGATGATTAGG + Intergenic
1012181198 6:96155370-96155392 AGGTCTTTAAAGAAGTGATTAGG + Intronic
1012411367 6:98961798-98961820 GGGACTTTTAAGAGGTGATTAGG + Intergenic
1012519478 6:100103679-100103701 GAGTCTTTGGGTAGGTGATTGGG - Intergenic
1012828816 6:104180901-104180923 GTAACTTTTAAGAGGTGATTAGG - Intergenic
1012984041 6:105856108-105856130 TTGTCTATAAGGAGATGATGTGG + Intergenic
1013066877 6:106692771-106692793 GGGCCTTTAAAGAGGTAATTAGG + Intergenic
1013415252 6:109918961-109918983 GAGTCTTTAAGGAGGTAATTAGG - Intergenic
1013454458 6:110317665-110317687 CTGTCATTATGGAGGTGTTTAGG - Intronic
1013721713 6:113038445-113038467 GTGTCCTTAAAGAGGAGATTAGG + Intergenic
1013898048 6:115116017-115116039 GGGGCTTTTGGGAGGTGATTAGG - Intergenic
1014022774 6:116610154-116610176 GTGTTTTTATGGAGGAGAGTGGG - Intergenic
1014403736 6:121022992-121023014 GGGTCTTTAAGGGGGTAATTAGG + Intergenic
1014850721 6:126336861-126336883 GAGACCTTTAGGAGGTGATTGGG - Intergenic
1014976009 6:127885011-127885033 GGGCCTCTAAGGAAGTGATTAGG - Intronic
1015358074 6:132304125-132304147 GGGGCCTTGAGGAGGTGATTAGG + Intronic
1015494782 6:133869147-133869169 GGGGCTTTTAGGAGGTGGTTAGG + Intergenic
1016149586 6:140723019-140723041 GGGTCTTTAAAGGGGTGATTAGG - Intergenic
1016906263 6:149153362-149153384 GGGACTTTTAAGAGGTGATTAGG + Intergenic
1017381544 6:153837332-153837354 GTGACTTTAAGGTGCTAATTGGG + Intergenic
1018361961 6:163079633-163079655 GATTATTTAAGCAGGTGATTCGG - Intronic
1018504078 6:164444657-164444679 GGGACATTTAGGAGGTGATTAGG + Intergenic
1018856868 6:167681139-167681161 GGGGCATTTAGGAGGTGATTAGG + Intergenic
1019477544 7:1251286-1251308 GGGCCTTTAAAGAGATGATTCGG + Intergenic
1020731867 7:11891171-11891193 GAGCCTGTTAGGAGGTGATTCGG + Intergenic
1021263308 7:18486163-18486185 GAGACCTTTAGGAGGTGATTAGG - Intronic
1021477678 7:21080847-21080869 GGGACTTTCAAGAGGTGATTAGG - Intergenic
1021830661 7:24604767-24604789 GAGTCTTTGGGGAGGTGATTAGG - Intronic
1022082297 7:27034855-27034877 GGGGCTTTGGGGAGGTGATTAGG - Intergenic
1022640755 7:32180440-32180462 GTGGCCTTTGGGAGGTGATTGGG + Intronic
1022841097 7:34164549-34164571 GTGGCCTTTAGGAAGTGATTCGG + Intergenic
1022995848 7:35754731-35754753 CTGTCTTGAAGGAGGGCATTTGG + Intergenic
1023359182 7:39398604-39398626 GTGGCTCTAAGGAGGTGATCTGG + Intronic
1023416073 7:39934018-39934040 CTGGCTTTTGGGAGGTGATTAGG + Intergenic
1024180688 7:46891061-46891083 AGGTCTTTTAGGAAGTGATTAGG + Intergenic
1024196982 7:47068935-47068957 GAGGCTTTTGGGAGGTGATTAGG + Intergenic
1024248472 7:47488598-47488620 AGGTCTTTAAAGAGGTAATTAGG - Intronic
1024519106 7:50287139-50287161 ATGTCTTTCAGTAGGTGAATAGG - Intergenic
1024662008 7:51505163-51505185 GGGGCTTTTAGGAAGTGATTAGG + Intergenic
1024777876 7:52809223-52809245 GTGTCTTTTAGGATGAGATGTGG + Intergenic
1025824334 7:64998389-64998411 GTGTATTTAAGGTGGTGACTGGG - Intronic
1025975534 7:66366574-66366596 GTGTGTTTAATGAGGTGTTTTGG + Intronic
1026153359 7:67807138-67807160 GGGTCTTTAAAGAGGTAATTAGG + Intergenic
1026658305 7:72276437-72276459 AGGTCTTTCAGGAGGTGATTAGG + Intronic
1026818557 7:73531126-73531148 GGGGCTTTTAAGAGGTGATTAGG - Intergenic
1028264165 7:88702851-88702873 AGGACTTTTAGGAGGTGATTAGG - Intergenic
1028777081 7:94689430-94689452 GGGACCTTTAGGAGGTGATTAGG - Intergenic
1029408793 7:100395258-100395280 GTGTGTTTTGGGAGGTGCTTAGG + Intronic
1030865988 7:114702355-114702377 GGGCCTTTGGGGAGGTGATTAGG + Intergenic
1031300988 7:120060572-120060594 ATGTATTTAAGGTGGTGACTTGG - Intergenic
1031409623 7:121425799-121425821 GGGGCCTTGAGGAGGTGATTAGG + Intergenic
1031570627 7:123354940-123354962 GGGGCTTTAGGGAGGTTATTAGG - Intergenic
1032651743 7:133886035-133886057 GTGTCCTTAAGCATGTCATTGGG + Intronic
1032699719 7:134368808-134368830 GTGTCTTACTAGAGGTGATTTGG - Intergenic
1032837311 7:135686176-135686198 GTGTTTTTAAGGAGATGAACAGG + Intronic
1032852347 7:135805754-135805776 GGGGCCTTGAGGAGGTGATTAGG - Intergenic
1032892440 7:136212996-136213018 GGGCCCTTTAGGAGGTGATTAGG - Intergenic
1032907046 7:136380451-136380473 GGGGCTTTGGGGAGGTGATTAGG + Intergenic
1032910930 7:136429198-136429220 GTGACTTCTGGGAGGTGATTAGG + Intergenic
1033090356 7:138379855-138379877 GGGGCTTTTAAGAGGTGATTAGG - Intergenic
1033109924 7:138564682-138564704 ATGTATTTAAGGTGGTGATTGGG - Intronic
1033138923 7:138807992-138808014 GGGGCCTTTAGGAGGTGATTAGG - Intronic
1033366532 7:140676292-140676314 GGGGCCTTTAGGAGGTGATTAGG - Intronic
1033730626 7:144175469-144175491 GGGGCTTTTAGGATGTGATTAGG + Intergenic
1034825907 7:154262310-154262332 GGGCCTTTAAAGAGGTAATTAGG + Intronic
1036161483 8:6392960-6392982 GGGACTTTAGGAAGGTGATTAGG + Intergenic
1036201986 8:6777696-6777718 GGGTCCTTTGGGAGGTGATTAGG + Intergenic
1036216399 8:6883362-6883384 GGATATTTAAGGAGGTAATTAGG + Intergenic
1036439219 8:8765564-8765586 GAGACATTTAGGAGGTGATTAGG - Intergenic
1036656890 8:10682626-10682648 GGGTCTTTATAGAGGCGATTAGG - Intronic
1036956420 8:13192683-13192705 AGGTCTTTAAAGAGGTGAGTGGG + Intronic
1037266755 8:17071479-17071501 CTTTCTTTAAAGAGGTAATTAGG - Intronic
1037943220 8:22970349-22970371 GGGGCCTTTAGGAGGTGATTAGG - Intronic
1038441334 8:27572787-27572809 GTGTCTTTAAAGAGGTGATTAGG - Intergenic
1038470033 8:27807818-27807840 GTGTCTTTAGGAAGGTGAATGGG + Intronic
1038496762 8:28008735-28008757 GTGCCTTTGAAGAGGTAATTAGG + Intergenic
1038546232 8:28427624-28427646 GAGTCTTTAAAGAGATGGTTAGG + Intronic
1038954583 8:32453594-32453616 ATGTCTTTCAGGAGGTGGGTAGG + Intronic
1039155760 8:34554733-34554755 GAGGCTTTTAGGAGGTAATTAGG + Intergenic
1039384325 8:37118974-37118996 GGGTCTTTGGCGAGGTGATTAGG - Intergenic
1039441162 8:37596197-37596219 GGGTCTCTAAAGAGGTAATTAGG - Intergenic
1039943887 8:42113957-42113979 GGGGCCTTTAGGAGGTGATTAGG - Intergenic
1040586861 8:48751886-48751908 GGGGCTTTTAGAAGGTGATTAGG + Intergenic
1040939040 8:52813879-52813901 ACGTCTTTTGGGAGGTGATTAGG + Intergenic
1041211241 8:55553209-55553231 GGGGCCTTAGGGAGGTGATTAGG - Intergenic
1041257639 8:55992894-55992916 GGGGCCTTTAGGAGGTGATTGGG - Intronic
1041373156 8:57185489-57185511 GAGTCCTTTTGGAGGTGATTAGG - Intergenic
1041994570 8:64038400-64038422 GGGCCTTTTAAGAGGTGATTAGG + Intergenic
1042100697 8:65272369-65272391 GGGCCTTAAAAGAGGTGATTTGG - Intergenic
1042632824 8:70839227-70839249 GTGTCTTGAAGGACTGGATTTGG + Intergenic
1042730771 8:71931737-71931759 GAGTCGTCAATGAGGTGATTTGG - Intronic
1043169078 8:76941413-76941435 GGGGCTTTTATGAGGTGATTGGG - Intergenic
1043481362 8:80656036-80656058 GGGCCTTTAAGGAGGTCATAAGG + Intronic
1043556847 8:81439886-81439908 GGACCTTTAGGGAGGTGATTAGG + Intergenic
1044091543 8:88008479-88008501 GGGGCTTTTAGGAGGCGATTAGG - Intergenic
1044515792 8:93136922-93136944 GGGTCTGGTAGGAGGTGATTGGG - Intronic
1044707329 8:95021268-95021290 GTATCTTCAAGGAGGCCATTTGG - Intronic
1044727299 8:95204006-95204028 GTGGCCTTTGGGAGGTGATTAGG - Intergenic
1044771981 8:95645726-95645748 GAGTCTTTAAAGGGGTAATTAGG - Intergenic
1045490673 8:102666602-102666624 GGGCCTTTTGGGAGGTGATTAGG - Intergenic
1045636974 8:104202737-104202759 TAGTATTTAAAGAGGTGATTAGG - Intronic
1045719609 8:105092916-105092938 GGGGCTTTGGGGAGGTGATTAGG + Intronic
1047000202 8:120565849-120565871 GGACCTTTAAGGAGGTGACTAGG + Intronic
1047173932 8:122522518-122522540 GGGTCCTTTAAGAGGTGATTAGG + Intergenic
1047176483 8:122545746-122545768 GGGCCTTTCAGGGGGTGATTAGG + Intergenic
1047906350 8:129477045-129477067 GGGACCTTTAGGAGGTGATTAGG + Intergenic
1047935226 8:129769682-129769704 GGGGCTTTTAAGAGGTGATTGGG - Intronic
1048130878 8:131695467-131695489 GGGCCTTTTAGGAGGTGTTTGGG - Intergenic
1048206567 8:132420216-132420238 GGGGCTTTGGGGAGGTGATTAGG - Intronic
1048601904 8:135927512-135927534 GGGTCTTTTAAGAGGTGATTAGG + Intergenic
1049491108 8:142903161-142903183 GAGCCTTTAAGAAGGTAATTAGG - Intronic
1049502788 8:142976520-142976542 GGGTCTTTGGGGAGGTGATTAGG + Intergenic
1049994911 9:1025582-1025604 GTTTTTTTAAGGAAGTAATTGGG - Intergenic
1050605370 9:7295751-7295773 GGGTCTTTTAGGAAGTGTTTAGG + Intergenic
1051853154 9:21532424-21532446 GGGCCTCTAAGGAAGTGATTAGG + Intergenic
1051903127 9:22064193-22064215 GTGTCTTGAAGAATGTGATCAGG + Intergenic
1052078144 9:24170555-24170577 GGGTCATTTAGGAGGTGATTAGG - Intergenic
1052110141 9:24572011-24572033 GGGGCTTTTAGTAGGTGATTAGG - Intergenic
1052228163 9:26114992-26115014 GTGTCTTTGAGGAGCTTAATGGG + Intronic
1053253289 9:36593323-36593345 GGCCCTTTAAGGAGGTGATTAGG + Intronic
1055573905 9:77644102-77644124 ATGTCTTTAAAGAGGTGATTAGG + Intronic
1055578225 9:77681042-77681064 GTGGCTTTTGGGAGGTGATTGGG + Intergenic
1056100275 9:83294112-83294134 GGGGCCTTCAGGAGGTGATTAGG + Intronic
1056222942 9:84467948-84467970 GGGGCCTTCAGGAGGTGATTAGG + Intergenic
1056535293 9:87521827-87521849 GAGGCTTTTAAGAGGTGATTGGG + Intronic
1056875052 9:90320274-90320296 GGGGCCTTTAGGAGGTGATTAGG + Intergenic
1057260896 9:93582784-93582806 GTGTCTTGAAGGAAGCAATTTGG + Intronic
1057871111 9:98718479-98718501 GGGCCCTTTAGGAGGTGATTGGG - Intergenic
1058417801 9:104806214-104806236 GTCACTTTCAGGGGGTGATTGGG - Intronic
1058740380 9:107936774-107936796 GAGGCTTTCTGGAGGTGATTAGG + Intergenic
1059264644 9:113015241-113015263 GGGACTTTAAAGAGGTGGTTAGG + Intergenic
1060079275 9:120626582-120626604 GAGTCTTTAAAAAGGTAATTTGG - Intronic
1060758856 9:126232124-126232146 AGGTCTTTAAAGAGGTGATAAGG + Intergenic
1061008270 9:127940775-127940797 CTGTCTTTAGGGAGGTGATAAGG - Exonic
1061238188 9:129354014-129354036 GGGTCTTGAAGGAGGGGAGTTGG + Intergenic
1185770346 X:2761164-2761186 GGGTCTTTAAAGAGGTGAGAAGG + Intronic
1185822121 X:3215648-3215670 GAGCCTTTAAGGGGATGATTGGG - Intergenic
1185822380 X:3217972-3217994 GAGCCTTCAGGGAGGTGATTGGG - Intergenic
1185829187 X:3283030-3283052 GAGTCTTTTGGGAGGTGTTTAGG + Intronic
1185876346 X:3705334-3705356 GGGGCTTTTAGGAGGTGATGGGG - Intronic
1185885663 X:3780363-3780385 GTGGCTTTTAGGAGGTGATTAGG + Intergenic
1186162599 X:6793367-6793389 GGGGCCTTTAGGAGGTGATTAGG - Intergenic
1186409843 X:9337031-9337053 GCCTCTTTATGGAGGTCATTGGG - Intergenic
1186877052 X:13827197-13827219 GTGCCTTTCAGGAGGGGACTTGG - Intronic
1186877201 X:13828230-13828252 GAGTCCTTTAAGAGGTGATTGGG + Intronic
1186988157 X:15038648-15038670 GGGGCCTTTAGGAGGTGATTGGG + Intergenic
1187108076 X:16265799-16265821 GGGGCCTTGAGGAGGTGATTAGG - Intergenic
1188309640 X:28600481-28600503 TTGAGTTTAAGGAGGGGATTTGG + Intronic
1188411066 X:29872503-29872525 GAGACCTTTAGGAGGTGATTAGG + Intronic
1188508239 X:30906493-30906515 GGGACTTTTAAGAGGTGATTAGG - Intronic
1188576363 X:31655598-31655620 GTGACCTTGAAGAGGTGATTAGG + Intronic
1188901577 X:35739205-35739227 GGGCCTTTTGGGAGGTGATTAGG - Intergenic
1189712378 X:43826831-43826853 GGGACTTTTAAGAGGTGATTAGG - Intronic
1191126816 X:56964827-56964849 ATGACTTTTGGGAGGTGATTAGG + Intergenic
1192481468 X:71489941-71489963 GGGTCTTTTAAGAGGTGATTAGG + Intronic
1192840320 X:74848774-74848796 GGGTCCTTTGGGAGGTGATTAGG + Intronic
1192964863 X:76166539-76166561 GTGGCCTTTGGGAGGTGATTGGG - Intergenic
1193043899 X:77032212-77032234 CTGTCTTTAAGATGGTGAATAGG - Intergenic
1193310024 X:79996072-79996094 ATCCCTTTTAGGAGGTGATTAGG + Intergenic
1193939945 X:87670165-87670187 GTGTGTTAAGGGAGGGGATTAGG - Intergenic
1195464279 X:105162895-105162917 CGGCCTTTGAGGAGGTGATTAGG - Intronic
1195934598 X:110112858-110112880 GGGCCTTCAAAGAGGTGATTAGG - Intronic
1196209665 X:112981777-112981799 GGAACTTTTAGGAGGTGATTAGG + Intergenic
1196417031 X:115482033-115482055 GGGGCCTTTAGGAGGTGATTAGG + Intergenic
1197128982 X:122981786-122981808 GAGTCCTTTGGGAGGTGATTAGG + Intergenic
1197270170 X:124416807-124416829 GAGGCCTTTAGGAGGTGATTAGG + Intronic
1197506730 X:127314563-127314585 GGGTCTTTTGGCAGGTGATTAGG + Intergenic
1197699110 X:129583834-129583856 GGGCCTTTGAGGAGGGGATTGGG + Intronic
1198120724 X:133589982-133590004 GGGGCTTTTAGGAGGTGATTAGG + Intronic
1198180647 X:134205132-134205154 GGGGCTTTTTGGAGGTGATTAGG - Intergenic
1198299498 X:135321246-135321268 GTGGCCTTTGGGAGGTGATTAGG - Intronic
1198615021 X:138447696-138447718 GTGTCTTGAAGGTGGGCATTAGG - Intergenic
1199155300 X:144539589-144539611 ATGGCTTTGGGGAGGTGATTTGG + Intergenic
1199535252 X:148895427-148895449 GTGTGTTTAAGGTGGTGGGTGGG - Intronic
1199551792 X:149069017-149069039 GAATCTTAAGGGAGGTGATTTGG - Intergenic
1199658153 X:150018724-150018746 GGGACTTTTAGGAGGTGATTAGG - Intergenic
1199814239 X:151383633-151383655 GGGGCCTTTAGGAGGTGATTTGG + Intergenic
1200645357 Y:5776416-5776438 GAGCCTTTTGGGAGGTGATTAGG - Intergenic
1200900291 Y:8424670-8424692 GTCTCTTTATGTAGGTGTTTTGG - Intergenic
1201299911 Y:12496563-12496585 GGGTCTTTAAAGAGGTGAGAAGG - Intergenic
1201557064 Y:15273881-15273903 GGGGCTTTTAGGAGGTGATTAGG - Intergenic
1201626280 Y:16018216-16018238 GTGTCCTTTGGGAGGTGATGAGG - Intergenic
1201646638 Y:16240617-16240639 GAATCTTTAAAGAGGTGATTAGG - Intergenic
1201647633 Y:16252953-16252975 TGGTCTTTAAAGAGGTGATTAGG - Intergenic
1201650934 Y:16284977-16284999 GTGTCTTTGAAAAGGTGATTAGG - Intergenic
1201655178 Y:16332348-16332370 TGGTCTTTAAAGAGGTGATTAGG + Intergenic
1201656175 Y:16344700-16344722 GAATCTTTAAAGAGGTGATTAGG + Intergenic
1202587128 Y:26442825-26442847 GTGTCTTTATTCAGGGGATTAGG + Intergenic