ID: 977269856

View in Genome Browser
Species Human (GRCh38)
Location 4:94903751-94903773
Sequence CCTTATAAGAAGAAGGTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 651
Summary {0: 1, 1: 0, 2: 10, 3: 91, 4: 549}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977269853_977269856 -7 Left 977269853 4:94903735-94903757 CCGGTATGACTGGTGTCCTTATA 0: 48
1: 396
2: 1159
3: 1893
4: 2338
Right 977269856 4:94903751-94903773 CCTTATAAGAAGAAGGTGTTAGG 0: 1
1: 0
2: 10
3: 91
4: 549
977269852_977269856 0 Left 977269852 4:94903728-94903750 CCTTAATCCGGTATGACTGGTGT 0: 2
1: 94
2: 517
3: 1319
4: 1980
Right 977269856 4:94903751-94903773 CCTTATAAGAAGAAGGTGTTAGG 0: 1
1: 0
2: 10
3: 91
4: 549

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977269856 Original CRISPR CCTTATAAGAAGAAGGTGTT AGG Intronic
900901714 1:5521158-5521180 CCTTATAAGAAGAGGAGATTTGG - Intergenic
901260217 1:7865549-7865571 CCTTATGAGAAGAAGCAATTAGG - Intergenic
901310485 1:8265769-8265791 CCTTAGAAAAAGACGGTGTGTGG + Intergenic
902057646 1:13615584-13615606 TCATATAAGAAAAAGGTTTTTGG - Intronic
902235545 1:15055110-15055132 GATTGTAAGAAAAAGGTGTTTGG - Intronic
902246701 1:15125334-15125356 CCTTATAAGAAGAGGCGATTTGG - Intergenic
902699973 1:18165401-18165423 CCTTATAAGAAGAAATAATTTGG - Intronic
904191910 1:28751739-28751761 CCTTAGAAGCAGAGGGTTTTAGG + Intronic
905136795 1:35806754-35806776 CCTTATAAGAAGAGGAAATTTGG + Intergenic
905272383 1:36795470-36795492 CCTTAGAATGAGAAGGTGCTGGG - Intergenic
906147158 1:43566968-43566990 CCTTACACGAGGAAGGTCTTTGG - Intronic
906630109 1:47359810-47359832 CCTTATAAGATAAAGGTTTCAGG - Intronic
907120511 1:52004203-52004225 CCTTATCAGAAGAGGAGGTTGGG - Intergenic
908878142 1:68700935-68700957 CCTTATAAGAAGAGAAAGTTTGG - Intergenic
910444758 1:87288775-87288797 CCTTATAAGAAAAGGAAGTTAGG + Intergenic
912226732 1:107742533-107742555 CCTTTTGAGATGCAGGTGTTTGG - Intronic
913284930 1:117217564-117217586 CCTTATAAAAAGAAAAAGTTCGG - Intergenic
914315636 1:146508910-146508932 CCTTATAAGAAGAGGAAATTTGG - Intergenic
914498719 1:148224451-148224473 CCTTATAAGAAGAGGAAATTTGG + Intergenic
914949973 1:152104703-152104725 CCTTATAAGAAGATGAAATTTGG - Intergenic
916655323 1:166870279-166870301 CCTTATAAGAAGAGGCAATTAGG + Intronic
916786956 1:168093269-168093291 CCTTACAAGCAGAAGGTATTTGG + Intronic
916885102 1:169059825-169059847 CCTTATAAGAAGAGGAAATTTGG + Intergenic
917491855 1:175504877-175504899 CCTTAGAAGAAGAAGAAATTTGG + Intronic
918459929 1:184765921-184765943 CTTAATAAGAAGAAGGTGATGGG - Intergenic
918617403 1:186561785-186561807 CCTTATAAGAAGAATATGATGGG - Intergenic
918706304 1:187667036-187667058 CCTTATAAGAAGAAGAAATTTGG - Intergenic
920225235 1:204433750-204433772 GATAATAAGAAGAAGGTATTCGG + Intronic
920236652 1:204511439-204511461 CCTCATAAGAAGAGGGGATTAGG + Intergenic
920282976 1:204858218-204858240 CCTTATAAGAAGAGGAGATTAGG - Intronic
920565596 1:206970164-206970186 CCTTATGAGATGCAGGTGTTTGG + Exonic
920818566 1:209358500-209358522 CCTTATAAGAAGAAGTTAGGAGG - Intergenic
921612754 1:217231650-217231672 CCTTGTAAGAAGAAGAGATTTGG + Intergenic
922109941 1:222547020-222547042 CTTTGTAGGAAGAGGGTGTTTGG - Intronic
922327892 1:224545998-224546020 CCTTATAAGAAGAGGAGCTTAGG - Intronic
922788698 1:228297605-228297627 CCTTATAAAAAGCAGATATTAGG - Intronic
923064192 1:230503217-230503239 CCTTACAAGAAGAAGAGATTAGG + Intergenic
923611825 1:235503100-235503122 CCTTATAAGTAGAAAGTATTCGG - Intronic
923889507 1:238196815-238196837 CCTTATAAGGAGAGGGGATTTGG + Intergenic
924111349 1:240702899-240702921 CTTTTTAAGAGGAAGTTGTTTGG - Intergenic
924513680 1:244749105-244749127 CCTTATAAGAAGAGGGGATTAGG + Intergenic
1063162310 10:3427903-3427925 CCTTATAAAAAGAAAAAGTTTGG + Intergenic
1063810369 10:9698030-9698052 CCTTATAAGAGGGAGGTATGTGG + Intergenic
1063967802 10:11360363-11360385 TCTCAAAAGAAGAAAGTGTTTGG + Intergenic
1065350902 10:24794970-24794992 CCTTATAAGAAGAAGAGATTAGG - Intergenic
1067201862 10:44179821-44179843 CCTTATAAGAAGAAGAGATTAGG + Intergenic
1067203503 10:44194808-44194830 CCTTATAAGAAGAGGATATTAGG - Intergenic
1067244048 10:44521460-44521482 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1067658796 10:48218146-48218168 CCTTATAAGAAGAAGAAATTTGG - Intronic
1068490773 10:57720974-57720996 CCTATTCAGAAGATGGTGTTGGG + Intergenic
1069591358 10:69644247-69644269 CCTGATAAGGGGAAGGTGATAGG + Intergenic
1069869524 10:71524688-71524710 CCTTATAAGAAGCAGGTAGGAGG + Intronic
1069963369 10:72092556-72092578 CTTTATAAGAAGAGGGAATTTGG - Intergenic
1072326896 10:94307685-94307707 CCTTATGAGAAGAGGGGATTAGG - Intronic
1072763533 10:98078153-98078175 CCTTATGAGAAGAGGAAGTTTGG + Intergenic
1072889515 10:99310120-99310142 TCTTATAAGAAGGAGCTGGTAGG - Intergenic
1073570326 10:104575880-104575902 CCTTATAAGAAGAGGATATTTGG + Intergenic
1074207054 10:111291932-111291954 CCTTATGAGCTGAAGGTGTTTGG + Intergenic
1074269147 10:111935840-111935862 CCTTATAAGAAGAAAAAATTTGG - Intergenic
1074297817 10:112207305-112207327 CCTTATCTGTAGAATGTGTTAGG - Intronic
1074381905 10:112988066-112988088 ACTTATCAGAGGAGGGTGTTTGG + Intronic
1074868636 10:117560147-117560169 CCTTACAAGAAGAGGAAGTTTGG + Intergenic
1074899907 10:117807031-117807053 CCTTTTAAGAAGAGGGTATTTGG - Intergenic
1076107041 10:127831913-127831935 CTTTATAAGAAGAAGAAATTAGG + Intergenic
1076327507 10:129637723-129637745 CCTTATAAGAAGAGGAGATTAGG + Intronic
1077795608 11:5488740-5488762 CCTGTTAAGAAGAAGGTGTCTGG - Exonic
1078254533 11:9646664-9646686 TCTCATTAGAAGAAGATGTTAGG + Intergenic
1078320894 11:10333571-10333593 CCTTATAAGAAGAGGAGATTAGG + Intronic
1078361386 11:10670746-10670768 CCTTATAAGAAGAGGAAATTTGG + Intronic
1078428178 11:11268018-11268040 CCTTAGAAGAAGAAGAGATTTGG + Intergenic
1078910333 11:15725129-15725151 CCTTATAGGAAGAGGATGTTAGG - Intergenic
1079072248 11:17357338-17357360 CCTTATAAGAAGAGGAAATTAGG - Intronic
1079182133 11:18203127-18203149 CCTTATAAGAAGAGGAGGTTAGG - Intronic
1079590299 11:22175359-22175381 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1079665637 11:23101901-23101923 CCTTATAATAAGAAGACTTTTGG - Intergenic
1080942723 11:36937954-36937976 CCTTATAAGGAGATGGCCTTGGG - Intergenic
1081370940 11:42302239-42302261 CCTTATAAAAAGAAGGAATTTGG + Intergenic
1081857949 11:46315900-46315922 GCTGATAAGAAGGAGCTGTTTGG - Intronic
1082781057 11:57287681-57287703 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1083396202 11:62393964-62393986 CCTCATAAGAAGAGGGGATTAGG - Intergenic
1084712725 11:70853900-70853922 CTTTATAAGAAGAAGGAGGGGGG - Intronic
1084997591 11:72997106-72997128 ACTTCTAAAAAGCAGGTGTTGGG + Intronic
1085192716 11:74642305-74642327 CCTTTTAAAAAGAAGGGTTTTGG - Exonic
1085491196 11:76919480-76919502 TATTATAAGGAGAATGTGTTTGG + Intronic
1086092960 11:83022126-83022148 CCTAATAAGAAGAAGCTCTTTGG - Intronic
1086184036 11:83991942-83991964 CCTTATAAGAAGAGGAAATTTGG + Intronic
1086573483 11:88311753-88311775 CCTTATAAGAAGAGGACATTAGG + Intronic
1086932074 11:92704576-92704598 CCTTATAAGAAGAGGAAATTTGG + Intronic
1087537921 11:99475214-99475236 CCTTATAAGATGGATGAGTTTGG + Intronic
1087608563 11:100406722-100406744 CCTTATAAGAAGAAGAAATGTGG + Intergenic
1087957603 11:104308046-104308068 TCTTATAAGAAGAAGAAATTTGG + Intergenic
1088363073 11:109011436-109011458 CCTTATAAGAAGAAGAAATTTGG + Intergenic
1088433093 11:109779918-109779940 CCTTATAAGAAGAAGAAATTTGG + Intergenic
1088755559 11:112882411-112882433 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1089013990 11:115152024-115152046 CCTTATAAGAAGAGGACATTTGG + Intergenic
1089576742 11:119449765-119449787 CCTTATAAGAAGAGGAGATTTGG + Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1090634412 11:128681697-128681719 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1090644443 11:128756368-128756390 TCTTATAAGAAGAGGGAATTTGG - Intronic
1090681080 11:129057851-129057873 CCTTACAAGAAGAAGGGATTAGG + Intronic
1091118332 11:133035774-133035796 CCTTATAAGAAGAGGACATTTGG + Intronic
1091160456 11:133415107-133415129 CCTTATAAAAAGCAGATTTTTGG + Intronic
1091269829 11:134300268-134300290 CCTTATAAGAAGAGGAGATTAGG - Intronic
1093945883 12:25109288-25109310 CCTGATAACAAGAAGGTATCAGG + Intronic
1093972603 12:25388928-25388950 CCTCATAAGAAGAAGAGCTTGGG + Intergenic
1094083288 12:26561105-26561127 CCTTATAAGAAGAAGGGATTAGG + Intronic
1095309806 12:40685241-40685263 CCTTATAAGAAGGAGGCAATGGG - Intergenic
1097350052 12:58538754-58538776 CCTTCTAAGAAGAAGGTAGTGGG + Intergenic
1097721642 12:63028332-63028354 CCTTATGATAAGAAGGCTTTTGG + Intergenic
1098019393 12:66136620-66136642 CCTCATAAGAAGAAGAAATTTGG + Intronic
1098036553 12:66308701-66308723 TCTTATAAGAAGAAGAGATTAGG - Intronic
1098591450 12:72218765-72218787 CCTTATAAGAAGAAGGGAGAGGG - Intronic
1098815798 12:75160181-75160203 CCTTATAAGAAGAAGAAATTTGG + Intronic
1098819646 12:75210498-75210520 CCTTATAAAAAGAGGATGTTTGG - Intergenic
1098938077 12:76503357-76503379 CCTTATAAGAAGAGGAAATTTGG - Intronic
1099230552 12:80019021-80019043 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1100216549 12:92455965-92455987 CCTTATAAGAAAAGGGAATTTGG - Intergenic
1100432146 12:94540558-94540580 CCTCATAACAAGAAGGTGCAGGG - Intergenic
1100606310 12:96154681-96154703 CCTTATAAGAAGAAAGAGAGAGG + Intergenic
1100755117 12:97742730-97742752 CCTTCTAAGAAGAAGAGGTTAGG - Intergenic
1101552378 12:105774688-105774710 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1102262380 12:111451486-111451508 CATTATAGGCAGAAGGTATTTGG + Exonic
1102598387 12:114010796-114010818 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1103130857 12:118467298-118467320 CCTTATAAGAAAAAGAAATTTGG - Intergenic
1103963759 12:124625227-124625249 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1104004588 12:124883040-124883062 CCTTATAAGAAGAGGGACATCGG + Intergenic
1105517121 13:21100853-21100875 CCTTATAAGAAGGGGATATTTGG + Intergenic
1106047764 13:26160890-26160912 CCTTATAAGAAGAGGATCTGAGG - Intronic
1106228129 13:27800360-27800382 CTTTATAAGAAGAAGAGTTTAGG + Intergenic
1106250943 13:27981067-27981089 CCTAACAAGAAAAAGGTGTGAGG + Intronic
1106423715 13:29605686-29605708 CCTTAGAAGAAGAAGAGATTAGG + Intergenic
1106454556 13:29915854-29915876 CCTTATAAGAAGAGGACATTTGG + Intergenic
1106490040 13:30212948-30212970 CCTTATAAGAAGAAGCGGTTAGG + Intronic
1106625781 13:31419459-31419481 CCTTATAAGAAGAGAGAATTTGG + Intergenic
1107247286 13:38311215-38311237 ACTTAGAAGAGGAAGGTTTTTGG - Intergenic
1107600626 13:42009146-42009168 CCTTATAAGAAGAGCATATTTGG + Intergenic
1107634632 13:42379850-42379872 CCTTATAAGAAGAAGAGATAAGG - Intergenic
1108064343 13:46562475-46562497 CCTTATAAGAAGAGGAAATTTGG - Intronic
1108529605 13:51316652-51316674 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1109142903 13:58737719-58737741 CCTTATAAAAAAGAGGAGTTTGG + Intergenic
1109974972 13:69819468-69819490 CCTAATAATAAGAATGTGGTGGG - Intronic
1111374205 13:87356171-87356193 CCCTTGAAGAAGATGGTGTTTGG - Intergenic
1111906363 13:94260521-94260543 CCTTATAAGAAGAAGAGATTAGG - Intronic
1112094594 13:96118266-96118288 CCTTATAAGAAGTAGAGATTAGG + Intronic
1113092755 13:106632316-106632338 CCTTATAAAAAGAAGAAATTTGG + Intergenic
1113114172 13:106857310-106857332 GCTTATCAGAAGAGGATGTTAGG - Intergenic
1113517187 13:110912833-110912855 CCTTCTGAGAAGAAGCCGTTAGG - Intronic
1113613505 13:111664698-111664720 CCTTATAAAAAGAGGGAGTTTGG + Intronic
1113672367 13:112183735-112183757 CCTTATAGGAAGAGGAGGTTAGG - Intergenic
1114478817 14:23018087-23018109 CCTTATAAGAAGAGGGAATTTGG + Intronic
1114573456 14:23692219-23692241 CCTTATAAGAAGAAGAGATTAGG - Intergenic
1116290304 14:43026879-43026901 CCTTATAAAAAAAAGTTGCTAGG + Intergenic
1116349410 14:43840963-43840985 CCTGATAAGAAGAAGAAATTTGG - Intergenic
1117868244 14:60171479-60171501 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1118387492 14:65268383-65268405 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1118926289 14:70192696-70192718 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1118949490 14:70421257-70421279 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1119881980 14:78106839-78106861 CCTTATAAGAAGAAGAGATTTGG + Intergenic
1120181323 14:81345333-81345355 CTTTATAAGAAGAGGATGTTAGG + Intronic
1120219822 14:81719547-81719569 CCTTATAAGAGGAAGGCGGGTGG - Intergenic
1120236288 14:81894899-81894921 ACTTTTAAAAAGAATGTGTTGGG - Intergenic
1121561958 14:94882501-94882523 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1122837806 14:104438607-104438629 CCTTATAAAAAGAAGGAATTTGG + Intergenic
1122907731 14:104809862-104809884 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1124242365 15:28039732-28039754 CCTTATAAGAAGAGGAAGTTTGG + Intronic
1124513924 15:30350218-30350240 CCTTATAAGAAGATGAGGTTAGG - Intergenic
1124728997 15:32180547-32180569 CCTTATAAGAAGATGAGGTTAGG + Intergenic
1125408995 15:39385010-39385032 CCTTATAAGAAGAAGGGACTAGG + Intergenic
1125427941 15:39568329-39568351 CCTTATAAGATGAGGGGATTTGG - Intergenic
1126176650 15:45742187-45742209 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1126632472 15:50751673-50751695 CCTGGTGAGAAGAAGCTGTTGGG - Intronic
1127344738 15:58083149-58083171 CCTTATAAGAAGAAGAAATCTGG - Intronic
1127754039 15:62073314-62073336 CATTAGAAGAAGAATGTCTTGGG - Intergenic
1127818503 15:62633986-62634008 CCTTATAAGAAGGAGAAATTTGG - Intronic
1127963470 15:63907192-63907214 CCTTATAAGAAGGGGAGGTTAGG - Exonic
1128106278 15:65047509-65047531 CCCTAGAAGAAGACTGTGTTTGG + Intronic
1130643482 15:85701943-85701965 TCTTATAAAAAGAAGGGGGTAGG + Intronic
1130905524 15:88238033-88238055 CCTTATAAGAAGAGGAGATTAGG + Intronic
1132179792 15:99743656-99743678 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1132331420 15:101014708-101014730 CCTTATAAGAAGAGGAGATTAGG - Intronic
1132345773 15:101107894-101107916 CCTTATAAGAAGAAGAGATTAGG + Intergenic
1133846815 16:9462328-9462350 CCTTAAAAGAAGAGGTGGTTAGG - Intergenic
1133856106 16:9550719-9550741 CCTTATAAGAAGAAGAAATTTGG - Intergenic
1134299951 16:12981805-12981827 CCTTATAAGAAGAGGAGATTAGG + Intronic
1134325035 16:13199768-13199790 CATTATAAGAAGGAGGTATTGGG + Intronic
1134527583 16:14956308-14956330 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1134775853 16:16852823-16852845 CCTTATAAGAAGAGGATATTTGG + Intergenic
1135060932 16:19270814-19270836 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1136077589 16:27827663-27827685 CTTCATCAGAAGAAGGTGTCTGG + Intronic
1136659246 16:31741051-31741073 ACTTATAAGAACATGGTCTTTGG + Intronic
1137286338 16:47018975-47018997 ACTTACAATAAGATGGTGTTGGG + Intergenic
1137801422 16:51265652-51265674 CCTTATAAGAGAAAGGTGGAGGG - Intergenic
1139010144 16:62622035-62622057 CCTTATAATAAAAAGCTGTTTGG - Intergenic
1140600924 16:76474053-76474075 CCTTATAAAATCAAAGTGTTAGG - Intronic
1140753072 16:78043755-78043777 TCACATAAGAATAAGGTGTTGGG + Intronic
1141276580 16:82593848-82593870 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1143310594 17:5985381-5985403 CCTTATAAGAAGAGGAAATTTGG + Intronic
1143327192 17:6107160-6107182 CCTTACAAGAAGAGGAGGTTAGG - Intronic
1143366983 17:6414852-6414874 CCTTATAAAAAGAAGGAGTTTGG + Intronic
1143896911 17:10143628-10143650 CCTTATAAGAAGAGGAAATTAGG + Intronic
1144003383 17:11076333-11076355 CCTTATAAGAAGAAAATATATGG - Intergenic
1144132921 17:12265588-12265610 CCTTATAAAAAGAAGAAATTGGG - Intergenic
1144169038 17:12640920-12640942 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1144751140 17:17648768-17648790 CCTAATAAGAAGCAGGAATTTGG + Intergenic
1145923972 17:28632373-28632395 CCTTGAAAGAAGAGGGAGTTGGG - Intronic
1146315042 17:31800215-31800237 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1146959914 17:36965386-36965408 CCTTATAAGAGGAAGGCAATAGG - Intronic
1147893741 17:43736644-43736666 ACTAATGAGAAGAATGTGTTTGG + Intergenic
1150943741 17:69722089-69722111 TCTTATTAGCAGAAGGGGTTGGG - Intergenic
1150943756 17:69722289-69722311 CCTTATTAGCAGAAGGGGTTGGG - Intergenic
1151385302 17:73751685-73751707 CCTTATAAGAAGAGGATATGTGG - Intergenic
1151541620 17:74767652-74767674 CCTTGAAAGAAGAAGGTGGATGG - Intronic
1153356859 18:4146534-4146556 CATTATAAAAAGAAGGGTTTAGG - Intronic
1153663717 18:7349589-7349611 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1154129608 18:11725276-11725298 CCTTATAAGAAGAGGAGATTAGG + Intronic
1154394537 18:13974958-13974980 CCTTATAAGAAGAAGAGATTAGG + Intergenic
1155337373 18:24778443-24778465 ATTTATAAGAATAAGGAGTTGGG - Intergenic
1155347473 18:24872930-24872952 CCTTATAAAAAGAAGAGATTAGG - Intergenic
1155505029 18:26525076-26525098 CCTCATCAAAGGAAGGTGTTGGG - Intronic
1155529780 18:26755134-26755156 CCTCATAAGAAGAGGAGGTTAGG + Intergenic
1155918595 18:31580102-31580124 CCCTGTAAGAAGAAGGGGTGGGG + Intergenic
1157053800 18:44200387-44200409 CCTTATAAGCAGAAGAGATTGGG + Intergenic
1157151248 18:45220961-45220983 CCTTAACAGAAGAAGAAGTTTGG - Intronic
1158129173 18:54133684-54133706 CCTTATAAGAAGCAGAAATTTGG + Intergenic
1158625670 18:59069698-59069720 CCTTATAATAAGCAGAAGTTTGG + Intergenic
1158839401 18:61367936-61367958 CCTTATAAGAAGAGGACATTTGG - Intronic
1159150538 18:64517641-64517663 CCTCATAAGAAGAGGGGATTGGG - Intergenic
1159880506 18:73854421-73854443 CCTTATAAGAAGGAGAAATTTGG + Intergenic
1160261695 18:77300218-77300240 ACATATGAGAAGAAGTTGTTGGG + Intergenic
1162037677 19:7950892-7950914 CCTTATAAGAAGCAGAGATTGGG + Intergenic
1162456991 19:10791386-10791408 CCTTATAAAAAGGGGGAGTTGGG - Intronic
1166320752 19:42017489-42017511 TGTTATAAAAAGAGGGTGTTGGG + Intronic
1166657009 19:44619744-44619766 CCTTATAAGAAGAGGAAGTTTGG - Intronic
1166919050 19:46216031-46216053 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1166922024 19:46235185-46235207 CCCTATAAGAAGAGGATATTAGG + Intergenic
1168265012 19:55218052-55218074 CCTTATCAGAAGAGGAGGTTAGG - Intergenic
1168498907 19:56876918-56876940 TCTTATTAGAAGAAGAGGTTAGG + Intergenic
1168514750 19:57002023-57002045 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1168675777 19:58277161-58277183 CCTGAGAAGGAGCAGGTGTTAGG - Intronic
926273432 2:11385487-11385509 CCTTAGAAGAAGAAGCCATTAGG - Intergenic
926689602 2:15724381-15724403 CCTTATAAGAAGAGGAAATTTGG - Intronic
926736567 2:16077964-16077986 TCTTATAAGAAGAAGAGATTAGG + Intergenic
927245888 2:20956919-20956941 CCTTATAAGAAGAGCCAGTTAGG + Intergenic
927454905 2:23241022-23241044 CTTTATAAGAAGAAGAGATTAGG - Intergenic
927460916 2:23297606-23297628 CCTTATAAGCAGAGGGGATTAGG - Intergenic
927896607 2:26786511-26786533 CCTAACAAGAAGACGGCGTTAGG - Intronic
928669342 2:33585033-33585055 CTGTATATGAAGAAGATGTTTGG + Exonic
929007408 2:37409604-37409626 CCTTATAAGAAGACGAAATTTGG - Intergenic
929911813 2:46096531-46096553 CCTTATAAGAAGAGGAGGTTAGG + Intronic
930134657 2:47889591-47889613 ATTTCTAAGAAGAATGTGTTTGG - Intronic
930956758 2:57211997-57212019 GCTTATAAAATGAGGGTGTTAGG + Intergenic
931766694 2:65463207-65463229 CCTTATAAGAAGAAGTGACTAGG + Intergenic
932689579 2:73900917-73900939 CTTTATAAGAAGAGGGAATTAGG - Intronic
932808256 2:74801339-74801361 CCTTATAAGAAGAGGAAATTTGG + Intergenic
933216630 2:79637349-79637371 CCTTATTAGAAGATGGGGCTTGG - Intronic
933597925 2:84301332-84301354 CCTTATAAGAAGAAGAGATTAGG + Intergenic
934122556 2:88854206-88854228 CCTTATAAGAAGAAGGAGATTGG - Intergenic
934149730 2:89134859-89134881 CTGTATAAGATGAAGATGTTGGG - Intergenic
934164581 2:89282534-89282556 CCTTATAAAAAGAAGAAGGTGGG - Intergenic
934202693 2:89899990-89900012 CCTTATAAAAAGAAGAAGGTGGG + Intergenic
934217566 2:90047172-90047194 CTGTATAAGATGAAGATGTTGGG + Intergenic
934688441 2:96338602-96338624 CCTTGTAAGAGGAAGGTCGTCGG + Intronic
935405036 2:102699891-102699913 ACTTATAAAAAGAAGAGGTTTGG - Intronic
935503072 2:103865984-103866006 CCTTAAATGAAGAGGGGGTTAGG + Intergenic
935609502 2:105006314-105006336 CCTTATAAGAAGAGGAGATTAGG - Intergenic
937086664 2:119176360-119176382 CCTTATAAGAAGAGGTGATTAGG - Intergenic
937256490 2:120559799-120559821 CCTTATAAGAAGAGGACATTTGG - Intergenic
937666145 2:124489391-124489413 CCTTATAAGAAAATGATATTAGG - Intronic
938945698 2:136210274-136210296 CCTTATTAAAAGAATGTTTTCGG + Intergenic
938982210 2:136537620-136537642 TCTTATAAGAGGAAGAGGTTAGG + Intergenic
939042708 2:137209939-137209961 CCTTATAAAAAGAGGAAGTTGGG + Intronic
939843408 2:147215695-147215717 CCTTATAAAAAGAGGGAATTTGG + Intergenic
940073661 2:149717446-149717468 CCTTATAAGAAGATGAAATTAGG - Intergenic
940112283 2:150168096-150168118 CCTTAGAAGGGGAAGGTGTAGGG + Intergenic
940991260 2:160098943-160098965 CCTTATAAGAAGAGGAGATTAGG - Intergenic
941007321 2:160261423-160261445 CCTTATAAGAAGAGGAAATTTGG - Intronic
941956390 2:171209711-171209733 CCTTATAAGAAGAGGAAATTTGG + Intronic
941984814 2:171499968-171499990 CCTTATAAGAAGAGGAGATTGGG - Intergenic
942068030 2:172290250-172290272 CCTTATAAGAAGAGGAAATTTGG - Intergenic
942078280 2:172377449-172377471 TCCTATAAGAAGAAAGTGCTTGG + Intergenic
942270063 2:174265595-174265617 CCTTATAAGAAGAGGAAATTTGG - Intergenic
942270439 2:174268872-174268894 CCTTATAAGAAGAGGAGATTAGG + Intergenic
942389415 2:175476667-175476689 CCTTATAAGAAGAGGCGATTAGG - Intergenic
942934708 2:181541185-181541207 CCTTATAAGAAGAGGAAATTTGG + Intronic
943103473 2:183513701-183513723 GCTTAAAAAAGGAAGGTGTTAGG - Intergenic
943573524 2:189602818-189602840 CCTTTAAAGAAGAAGGAGTTGGG + Intergenic
943723829 2:191232775-191232797 CCTTTTATGAAGATGATGTTGGG - Intergenic
944215460 2:197250316-197250338 CCTTATAAGAAACAGGTGCAGGG - Intronic
944311946 2:198243429-198243451 CCTTATAAGAAGAGGAAATTAGG - Intronic
944399998 2:199314903-199314925 CTTTTTAAGAAGAAGTTGTTGGG + Intronic
945029208 2:205648203-205648225 CCTTATAAAAAGAAGAGATTAGG - Intergenic
945364768 2:208938556-208938578 CCTTATAAGAAGAAAATATTAGG - Intergenic
945635950 2:212351175-212351197 CCTTATAAGGAGAAGAAATTAGG + Intronic
946136080 2:217648288-217648310 CCTTATAAGAAGAGGAAATTTGG - Intronic
947260834 2:228220185-228220207 CCTTATAAGAAGAAGAGATTAGG + Intergenic
947280654 2:228450021-228450043 CTTTATAAGAAGAAGAAATTTGG + Intergenic
947521093 2:230846654-230846676 CCTTATAAGAAGAGGAGATTCGG - Intergenic
947944537 2:234090311-234090333 CCTTATAAGAAGATGAGATTAGG + Intergenic
947955307 2:234184724-234184746 CCTTACAAGAAGAAGGAAATTGG + Intergenic
1168848949 20:963657-963679 CCTTTTAATAAGAAGGATTTGGG - Intronic
1168937442 20:1678208-1678230 CCTTATAAGAAGGAGGAGGCAGG - Intergenic
1169078965 20:2782998-2783020 CCTTATAAGAAGAGGAGGTCGGG - Intergenic
1169330093 20:4709565-4709587 CCTTGTAAGAAGAGGGGCTTAGG - Intergenic
1170099549 20:12683820-12683842 CCTTAAAATAAGAAGGTGATAGG - Intergenic
1170167031 20:13370744-13370766 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1170534092 20:17323252-17323274 CCTTATAAGAAGAGGAGATTAGG + Intronic
1170753174 20:19170805-19170827 CCTTATAAGAAGAGGAAATTAGG + Intergenic
1172219973 20:33267243-33267265 CCTTATGAGAAGAGGAGGTTAGG - Intergenic
1172821908 20:37743441-37743463 CCTTTTAAAAAAAAGGTATTGGG + Intronic
1173252096 20:41369275-41369297 CCTTATAAGAAGAGGAGGCTGGG - Intergenic
1173435360 20:43027527-43027549 CCTTATGAGAAGAAGAAATTTGG + Intronic
1174825129 20:53761926-53761948 CCTTGTAAGGAGAAGGTTCTCGG - Intergenic
1174921969 20:54713028-54713050 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1175287732 20:57848977-57848999 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1175518549 20:59584862-59584884 CCTTATATGAAGAAGAGATTTGG - Intronic
1176961083 21:15159441-15159463 AATTATAAGTAGAAAGTGTTTGG - Intergenic
1177064820 21:16417291-16417313 CCTTATAAGAAGAGGAGGTTAGG - Intergenic
1177210638 21:18066803-18066825 CCTTATAAGAAGACGAAATTTGG + Intronic
1177423997 21:20898803-20898825 CTTTATAAGAAGGAGATATTAGG + Intergenic
1177683134 21:24401428-24401450 CCTTATAAGAAGGAGAAATTTGG + Intergenic
1177853528 21:26376875-26376897 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1177952855 21:27560535-27560557 CTTTATATGAAGAAGGAATTTGG + Intergenic
1178316286 21:31569355-31569377 CCTTATAAGAAGAGGAAGTTTGG - Intergenic
1178387312 21:32163439-32163461 CCTTCTAAGAACCAGGTGTGAGG - Intergenic
1178401820 21:32293076-32293098 CCTTATAAGAAGAGGAGCTTTGG + Exonic
1178417734 21:32417408-32417430 CCTTGTAAGAAGAGGAGGTTAGG - Intronic
1178484661 21:33011093-33011115 CCTTATAAGAGGAAGAGATTAGG - Intergenic
1178637340 21:34315805-34315827 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1178805548 21:35836239-35836261 CCTTATAAGAAGAAAAAATTTGG - Intronic
1178898343 21:36579136-36579158 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1179019881 21:37629538-37629560 CCTTATAAGAAGAGGAAATTAGG + Intronic
1179186597 21:39089706-39089728 CCTTATAAGAAGAGGGGATTAGG + Intergenic
1179221006 21:39407444-39407466 CGTTCTAAGAAGAAGTTGTTAGG - Intronic
1179272868 21:39865248-39865270 CCTTATAAGAAGAATAGATTAGG - Intergenic
1179279021 21:39917924-39917946 CCTTATAAGAAGAAGAGATGAGG + Intronic
1179363132 21:40731635-40731657 CCTTATAAGAAGAGGAAATTAGG - Intronic
1179364096 21:40739546-40739568 CCTTATAAGAAGAGGAGATTAGG - Intronic
1179502777 21:41820471-41820493 CCTTATAAGAAGATGAGATTGGG + Intronic
1179593669 21:42428044-42428066 CCTTATAAGAAGAGGGGATGAGG + Intronic
1180937227 22:19633678-19633700 TCTTATAAGAAGAAGAGATTAGG + Intergenic
1181385250 22:22540321-22540343 CCTTATAAGAAGAAAAAATTAGG - Intergenic
1182046775 22:27280949-27280971 ACTTGTAAGTGGAAGGTGTTGGG - Intergenic
1182192217 22:28473807-28473829 CTTTATAAGAAGAAGAGATTAGG + Intronic
1182478657 22:30591802-30591824 CTTGAGAAGAAGAAGGTGATTGG - Exonic
1182878016 22:33708989-33709011 CCCTATAAGAAGAAGAGATTAGG - Intronic
1182922483 22:34092859-34092881 CCTTATAAGAAGAAGAGATGAGG + Intergenic
1183922476 22:41180347-41180369 CCCTGTAAGATGAAGGTGATTGG - Intergenic
1184592281 22:45493123-45493145 GATTATAAGAAGAGGGGGTTGGG - Intergenic
1184832912 22:47001326-47001348 CTTTATTTGAAAAAGGTGTTTGG - Intronic
1185357785 22:50385042-50385064 CTTTATAAAAAGAAGAGGTTAGG - Intronic
949306415 3:2646818-2646840 CCTTATAAGAAGAGGAAATTTGG - Intronic
949840483 3:8314658-8314680 CCTTACAAGAAGAGGGAATTTGG + Intergenic
949870920 3:8587811-8587833 CCTTACTAGAAGAAGATATTAGG - Intergenic
950749373 3:15116808-15116830 CCTTATAGGAAGAGGGAATTAGG - Intergenic
951531027 3:23698227-23698249 CCTTATAAGAAGAGGAAATTTGG + Intergenic
951927155 3:27921013-27921035 CCTTATAAGAAGAAAAGATTAGG + Intergenic
952656478 3:35792509-35792531 CCTGATAAGAAGACATTGTTGGG - Exonic
953236697 3:41113306-41113328 CCTTATAAGAAGAGGAGATTAGG + Intergenic
953744567 3:45564492-45564514 CCTCATAAGATGATGGTGGTTGG - Intronic
954839694 3:53499501-53499523 CCTTATCAGAAGGAATTGTTAGG + Intronic
955167802 3:56531635-56531657 CCTTATAAGAAGAGGAAATTTGG - Intergenic
955360171 3:58267367-58267389 TCTTATAAGAAAAGGGAGTTGGG + Intronic
955688287 3:61565450-61565472 CTTTAAAATAATAAGGTGTTGGG - Intronic
956654331 3:71534550-71534572 GCTTATAAGAGGAAGATATTGGG - Intronic
956733342 3:72216848-72216870 CCTGATAAAAAGAATGAGTTTGG - Intergenic
956932749 3:74064042-74064064 CCTTATAAGAAGAGGAAGATTGG - Intergenic
957618575 3:82566179-82566201 ATTTATCAGGAGAAGGTGTTTGG - Intergenic
958114008 3:89190840-89190862 CCTTATAAGAAGAGGAAATTTGG - Intronic
958979570 3:100705668-100705690 CCTTATAAGAAGAGGAGATTAGG - Intergenic
959236776 3:103733550-103733572 CCTTAGAAGAAGAGGATATTTGG - Intergenic
959653505 3:108774764-108774786 CCTTACAAGAAGATGAGGTTAGG - Intergenic
959811494 3:110625435-110625457 CCTTATGAGAAGAAAGTCTAGGG + Intergenic
960151135 3:114249968-114249990 CCTTGTAAGAAGAGGAGGTTAGG + Intergenic
960307661 3:116081622-116081644 CCTTATAAGACCAACATGTTTGG - Intronic
960725189 3:120662943-120662965 CCTTATAAGAAGAGGAAATTTGG + Intronic
960908563 3:122625626-122625648 CCTTATAAGAAGAGGACATTAGG + Intronic
960996224 3:123342368-123342390 CCTTAAAAGTGGGAGGTGTTGGG + Intronic
961015577 3:123465682-123465704 CCTTATAAGAAGAGGAAATTTGG + Intergenic
961352539 3:126313135-126313157 GCTTGTAAGAAGAGGGGGTTGGG + Intergenic
961738012 3:129014486-129014508 CCTTCTAAGAAGAGGGGATTAGG - Intronic
962215440 3:133516929-133516951 CCTTATAAGAAGAGGAGATTAGG - Intergenic
962282417 3:134061910-134061932 CCTTATAAGAAGAGGAATTTTGG - Intergenic
962975995 3:140446340-140446362 ACTTATAATAAGAGGATGTTTGG - Intronic
963728957 3:148952356-148952378 CCTTATAAGAAGAGGCAATTAGG - Intergenic
965465041 3:169018696-169018718 CCTGATAAAAAGAATGAGTTTGG + Intergenic
965811885 3:172599898-172599920 CCTTATAAGGAGCAGGTGGAGGG - Intergenic
966069749 3:175861245-175861267 CCTTATAAGAAGAGGACATTAGG + Intergenic
966733169 3:183167560-183167582 CCTTATAAGAAGAGGAGATTAGG - Intergenic
967264805 3:187681031-187681053 ATATTTAAGAAGAAGGTGTTTGG - Intergenic
967708528 3:192679734-192679756 CTTTAGAATAATAAGGTGTTTGG - Intronic
967964305 3:194949022-194949044 CCTTATAAGAAGAGGAAATTTGG + Intergenic
967964437 3:194949932-194949954 CCTTATAAGAAGAGGAAATTTGG - Intergenic
967968231 3:194979465-194979487 CCTTAAAAGAAGAAGAAATTTGG - Intergenic
969089416 4:4682554-4682576 CCTTATAAGGAGAGGATTTTGGG - Intergenic
969322714 4:6422674-6422696 CCTTATAAGAAGAGGAGATTAGG - Intronic
969894789 4:10293278-10293300 CCGTATGAGCAGAAGGTGTTAGG - Intergenic
970248776 4:14092527-14092549 CCTTATAAGAAAAGGATATTAGG - Intergenic
971526866 4:27630572-27630594 CCTTATAAGAATAAGGGATAAGG - Intergenic
971701062 4:29977214-29977236 CCTTATAAAAAGAAGAGATTAGG - Intergenic
971893803 4:32563159-32563181 CTTTATAAGAGGAAGGTAGTGGG - Intergenic
972296540 4:37744542-37744564 ACTTATAAGAAAGAGGTGTCGGG + Intergenic
972380072 4:38511313-38511335 CCTTATAAGAAGAGGAAATTTGG - Intergenic
972554973 4:40172492-40172514 CCTTATAAAAAGGAGGAATTTGG + Intergenic
972662157 4:41126791-41126813 CCTTATAAGAAGAAGAAATTAGG - Intronic
972922379 4:43959896-43959918 CCTTGGAAGGAGAAGGTGTTAGG + Intergenic
973838588 4:54837343-54837365 CCTTATAAGAAGAGGAGATTAGG + Intergenic
973839511 4:54846593-54846615 CCTTATAAGAAGAGGAGATTAGG - Intergenic
974523801 4:63021097-63021119 CCTTATAAAAAGAAGATATTTGG - Intergenic
975982067 4:80172323-80172345 CCTTTTTACAAGAAAGTGTTGGG + Intergenic
976270728 4:83227933-83227955 CCTTATAATAAGAAGAAATTTGG + Intergenic
976351779 4:84067972-84067994 ACTTGAAAGTAGAAGGTGTTTGG - Intergenic
976496313 4:85733751-85733773 CCTTATAAGAAGAAGAAATTAGG - Intronic
976574007 4:86647749-86647771 CCTTATAAGAAGAGGAAATTAGG + Intronic
976663846 4:87569107-87569129 CCTTATAAGAAGAGGAGATTAGG - Intergenic
976888656 4:90016773-90016795 CCTTATAAGAAGAGGAGATTTGG + Intergenic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
977269856 4:94903751-94903773 CCTTATAAGAAGAAGGTGTTAGG + Intronic
977303885 4:95299193-95299215 CCTTATAAGAAGAAGAAATTTGG + Intronic
977988908 4:103418028-103418050 CCTTATAAGATGAGGATATTAGG - Intergenic
979601750 4:122593070-122593092 CCTTATAAGAAGGAGAAATTTGG - Intergenic
979682430 4:123476668-123476690 CCTTATAAGAAGAGGAGATTAGG - Intergenic
979796257 4:124850357-124850379 CCTTATAAGAGGAAGACATTTGG - Intergenic
980343851 4:131585981-131586003 CCTTATAAGAAGAGGAGTTTAGG + Intergenic
980548434 4:134301580-134301602 CCTTATAAGAAGAAGAGATTAGG - Intergenic
980765323 4:137295724-137295746 CATTATGAGAAGAAGGATTTTGG - Intergenic
982100033 4:151958671-151958693 CCTTACAAGAAGAGGGAATTTGG - Intergenic
982116912 4:152105581-152105603 CCTTATAAGAAGGAGAACTTGGG + Intergenic
982801861 4:159715769-159715791 CCTTATAAAAAGAAGAAATTTGG + Intergenic
983018435 4:162643761-162643783 GAGTATAAGAAGAAGGTTTTAGG + Intergenic
984024667 4:174528882-174528904 CCTTATAAGAAGAGGAAATTTGG - Intergenic
984049050 4:174841360-174841382 CCTTATAAGAAGAGGAGATTAGG - Intronic
984146413 4:176066267-176066289 CCTTGTAAGAATCAGGTGTGTGG - Intronic
984587291 4:181578771-181578793 CCTTATAAGAAGAAGAGATTAGG - Intergenic
984589528 4:181601526-181601548 CCTTATAAGAAGAGGACATTAGG - Intergenic
984599140 4:181706203-181706225 CCTTATAAGAAGAGGAGATTTGG - Intergenic
984892418 4:184505452-184505474 CCTTATAAGAAGAGGAGGCTAGG + Intergenic
985010813 4:185580412-185580434 CCTTATAAAAAGAAGTGATTGGG - Intergenic
985771537 5:1814940-1814962 CCTTATAAGAAGAGGGGATGAGG - Intronic
986051980 5:4098705-4098727 CCTTATAAGAAGAAGAGATTAGG + Intergenic
986113514 5:4746092-4746114 CTTTATAAGAAGAGGGGATTAGG - Intergenic
986219259 5:5752645-5752667 TGTAATAAGAATAAGGTGTTAGG - Intergenic
986274427 5:6261097-6261119 CCTTAAAAGAGGAGGATGTTAGG - Intergenic
986445296 5:7816022-7816044 CCTTTTAAGAAGAGGCAGTTAGG - Intronic
986977710 5:13411830-13411852 CCTTATAAGAAGAGGAAATTAGG + Intergenic
987244379 5:16033704-16033726 CCTTATAAGAAGAGGAAATTAGG + Intergenic
987253404 5:16123296-16123318 CCTTATAAGAAGAGGAGATTAGG + Intronic
987783566 5:22469480-22469502 ACCTATAAGAAGAGGGTATTCGG - Intronic
988258579 5:28852213-28852235 CTTTATAAGAAGGAGAAGTTGGG + Intergenic
988998902 5:36740997-36741019 CCTTATAAGAAGAAGAAATTAGG - Intergenic
990079598 5:51897138-51897160 CTTTATAAGAAGAGGAGGTTTGG - Intergenic
990724335 5:58736655-58736677 CCTTATAAAAAGAAGAAATTTGG - Intronic
991525431 5:67551829-67551851 CCTTATAAGAAGAGGATATTAGG - Intergenic
991893624 5:71366660-71366682 CCTTATAACTAGAAGGTATCTGG + Intergenic
992092051 5:73326107-73326129 CCTTATAAGAAGGAGAGATTAGG - Intergenic
992202438 5:74397663-74397685 CCTTATAAGAAGAGGGAATTTGG - Intergenic
994184440 5:96802819-96802841 CCTTATAAGAAGATGGAGACTGG + Intronic
994195544 5:96918882-96918904 CCTTAAAAGAAGGAGGTGGGGGG - Exonic
994282501 5:97922279-97922301 CCTTATAAGAAGAGGAAATTTGG - Intergenic
995119866 5:108524557-108524579 CATTATAAGAAAAATGAGTTTGG - Intergenic
995424162 5:112001384-112001406 CCTTATAAGAAGAGGAAATTTGG - Intergenic
995837060 5:116409574-116409596 CCTTATAAGAAGAGGGGATTAGG + Intronic
996076914 5:119206664-119206686 CCTTATAAGAAGCATGTGTGAGG - Intronic
996509127 5:124299372-124299394 CCTTATAAGAAGAGGAGGTTAGG - Intergenic
996567416 5:124894097-124894119 CCTTATAAGAAGAGGAAATTTGG - Intergenic
996771598 5:127092368-127092390 CCTTATAAGAAGAGGAAATTTGG + Intergenic
998798296 5:145841878-145841900 CCTTATCAGAAGAAGAGCTTAGG + Intergenic
999021300 5:148168506-148168528 CCTTCTAAGAAGCATGTATTAGG - Intergenic
999081590 5:148849305-148849327 CCTCATAAGAAGAGGATATTAGG - Intergenic
999198085 5:149796415-149796437 CCTTATAAGCCACAGGTGTTTGG + Intronic
999743481 5:154574467-154574489 CCTTATAAGAAGGGGAAGTTTGG - Intergenic
999862634 5:155664982-155665004 ACCTGTAAGATGAAGGTGTTAGG + Intergenic
1000973362 5:167738811-167738833 CCTTATAAGAAGAGGAAATTTGG - Intronic
1001179181 5:169502725-169502747 CCTTATAAGAAGAGGTGATTAGG + Intergenic
1001581688 5:172802829-172802851 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1002769615 6:279918-279940 CCTTACAAGAAGAAGAGGTGGGG - Intergenic
1002769933 6:282136-282158 CCTTACAAGAAGAAGAGGTGGGG - Intergenic
1003368125 6:5496668-5496690 CCTTACAAGAAGAAGAGATTAGG - Intronic
1004088991 6:12480131-12480153 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1004350993 6:14890352-14890374 CCTTATAAAAAGAGGAAGTTTGG - Intergenic
1005146376 6:22695212-22695234 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1005805099 6:29467383-29467405 CCTTATAAGAAGACGAGATTAGG + Intergenic
1007350922 6:41272910-41272932 CCCCAAAAGAAAAAGGTGTTTGG - Intronic
1010437692 6:75853610-75853632 CCTTACAATAATAAGATGTTGGG - Intronic
1010729960 6:79380831-79380853 CCTTATAAGAAGAGGGGGTTAGG - Intergenic
1011726825 6:90218278-90218300 GTTTAAAAGAAGAAGGTGTTGGG - Intronic
1012848727 6:104422346-104422368 CCTTATAAGAAGAAGAGATTAGG + Intergenic
1013174815 6:107668215-107668237 CCTCATAAGAAAAAGGCTTTAGG + Intergenic
1013261115 6:108443487-108443509 CATTGTAAGAAGAACATGTTGGG + Intronic
1013346235 6:109263330-109263352 CCTTATAAGAAGAGGAAATTCGG + Intergenic
1013635547 6:112026127-112026149 CCTTATAACAAGGAGGAATTTGG - Intergenic
1013940152 6:115651414-115651436 CCTTATAAAAAGAGGAGGTTAGG - Intergenic
1014577260 6:123089018-123089040 CCTTATAAGAAGAACTTATAAGG - Intergenic
1014660013 6:124158251-124158273 CCTTATAAGAAGAGGTGATTAGG - Intronic
1014961683 6:127694664-127694686 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1015136013 6:129871652-129871674 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1015287050 6:131497715-131497737 CCTTTTAAGAAGAAGAGATTAGG - Intergenic
1015450519 6:133362089-133362111 CCTTAGAAGATGAAGGTGTGGGG + Intronic
1016231438 6:141810022-141810044 CCTTATAAAAAGGAGGAATTTGG + Intergenic
1016240882 6:141929127-141929149 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1016516387 6:144897157-144897179 CCTTATAAGAAGAAGAAATTTGG - Intergenic
1016615960 6:146048684-146048706 CCTTATAAAAAGAAGAAATTTGG + Intronic
1016740997 6:147528436-147528458 CCTTATAAGAAGAGGAGATTAGG - Intronic
1018436283 6:163762160-163762182 CCTTATAGGAAGAGGAGGTTAGG - Intergenic
1020108594 7:5434910-5434932 CCTTATAAGAAGAGGAGATTAGG - Intronic
1020361892 7:7335651-7335673 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1020428516 7:8095809-8095831 CCTTGGAAGCAGAAGGGGTTGGG + Intergenic
1020833484 7:13120718-13120740 CCTTATAAAAGTAATGTGTTTGG - Intergenic
1020913721 7:14166211-14166233 ACTTATAAGATTAAGGTTTTAGG - Intronic
1021172151 7:17412332-17412354 CCTTATGTGAAGGAGGAGTTGGG + Intergenic
1021535511 7:21700202-21700224 AATTACAAGAGGAAGGTGTTGGG + Intronic
1021551082 7:21871786-21871808 CTTTATGAGAAGAAGGGATTAGG - Intronic
1022445777 7:30469625-30469647 CCTGACCAGAAGAAGATGTTTGG - Intronic
1022657702 7:32335619-32335641 CCTTATGAGAAGAAGAGATTAGG - Intergenic
1023378768 7:39585362-39585384 CCTTATAAGAAGAGGAAATTTGG + Intronic
1023568250 7:41545977-41545999 CCTTTTAATAAGAATGTCTTTGG + Intergenic
1023743856 7:43303962-43303984 TCAAATAAGAAGAAAGTGTTGGG - Intronic
1024281468 7:47722817-47722839 CCTTATAAGAAGAGGAGATTAGG - Intronic
1024347109 7:48324295-48324317 CCTTATAAAAAGAGGATATTAGG - Intronic
1024811025 7:53212499-53212521 CCTTATAAGAAGATGATATTAGG + Intergenic
1025189732 7:56887400-56887422 CTTTATAAAAAGAAGGGCTTGGG + Intergenic
1025682206 7:63689521-63689543 CTTTATAAAAAGAAGGGCTTGGG - Intergenic
1026154692 7:67816864-67816886 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1027545071 7:79517365-79517387 CCTTATATCAAGAAGGTGAAGGG - Intergenic
1027946873 7:84758471-84758493 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1027979116 7:85194871-85194893 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1028603114 7:92624362-92624384 CCTTGTAAGAAGAAGCCATTTGG + Intronic
1029182254 7:98711471-98711493 CCTTATAAGAAGAAAAGATTAGG + Intergenic
1029665592 7:101993027-101993049 CTTTATAAAAAGAAGGGCTTGGG + Intronic
1030286388 7:107831275-107831297 CCTTATAAGAAGGAGGTGGAAGG + Intergenic
1030980417 7:116179558-116179580 CCTTATGAGAAGAAGAAATTTGG - Intergenic
1031415137 7:121486486-121486508 CCTTATAAGAACAAGAAATTTGG - Intergenic
1032172757 7:129599577-129599599 CCTTATAAGAAGAGGAAATTAGG + Intergenic
1032508639 7:132454703-132454725 CCTTATAAGAAGAGGAAATTTGG + Intronic
1033211458 7:139463062-139463084 CCTTTTAAGAAGAAATTGCTGGG - Intronic
1033342285 7:140501536-140501558 CCTTAGAAGAAGAAGAGATTAGG + Intergenic
1035116769 7:156531471-156531493 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1036217703 8:6894438-6894460 GCTTTTAGGAAGAAAGTGTTTGG + Intergenic
1036574573 8:10014817-10014839 CCTTATAAGAAGAGGCGATTAGG - Intergenic
1036781426 8:11650564-11650586 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1037671366 8:21017964-21017986 CCTTATAAGAAAAAAGGATTTGG + Intergenic
1038276729 8:26127527-26127549 CTTTATAAGAAGAGGAAGTTTGG - Intergenic
1038340124 8:26679181-26679203 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1038349255 8:26761506-26761528 CCTTATAAGAAGAAGAAATTGGG + Intronic
1038620656 8:29139761-29139783 TCTTATAAAAAGAAGGTGCTGGG - Intronic
1039146736 8:34455675-34455697 CCTTATAAGAAGAAGAAATATGG + Intergenic
1039191251 8:34978318-34978340 CCTTTTAAAAAGAAGGATTTAGG + Intergenic
1039348411 8:36733853-36733875 CCTTATAAGAAAAGGATATTAGG + Intergenic
1039370895 8:36982896-36982918 CCTTACAAGAAGAGGGAATTAGG + Intergenic
1039440033 8:37588669-37588691 CCTTATAAGAAGAGGAAATTAGG - Intergenic
1039558117 8:38491447-38491469 CCTTATAAGAAGAGGATGTTAGG - Intergenic
1039565927 8:38552687-38552709 CTTTAGAAGCAGAAGGTGTTAGG - Intergenic
1039720785 8:40162018-40162040 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1040485151 8:47864140-47864162 CCTTGTAAGAAGGATGTGTAGGG + Intronic
1040618192 8:49061275-49061297 CCTCATAAGAAGAGGGAATTTGG + Intronic
1040870768 8:52098364-52098386 CCTTATAAGAAGAAAAGATTAGG + Intergenic
1040978085 8:53215970-53215992 CCTTATAAAAAGAGGGCATTAGG - Intergenic
1041644249 8:60235303-60235325 CCTTATAAGAAGAGGAAATTTGG - Intronic
1041684503 8:60630709-60630731 CCTTATAAGAAGGGGATATTTGG - Intergenic
1041754679 8:61300916-61300938 GTTTATAAGAAGAAAGTGGTAGG - Intronic
1041769766 8:61459973-61459995 CCTTATAAGAAAAGGAGGTTAGG - Intronic
1041777069 8:61535037-61535059 CCTTATAAGAAGAGGAACTTTGG - Intronic
1042000056 8:64112054-64112076 CCTTATAAGAAGAGGGGATTAGG - Intergenic
1042172788 8:66008664-66008686 CCTTATAAGGAGAAGTGGTTTGG + Intergenic
1042192218 8:66198509-66198531 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1042929029 8:73995402-73995424 CCTTATAAGAAGAGGAAATTTGG - Intronic
1043194979 8:77280714-77280736 CTTTGTAAGAAGAAGCAGTTTGG - Intergenic
1043534139 8:81182427-81182449 CCTTATAAGAAGAGGATACTAGG - Intergenic
1043846815 8:85173142-85173164 GATTACAAGAAGAAGGTATTAGG + Intergenic
1044071667 8:87768217-87768239 CCTTATAAGAAGAAAACATTAGG - Intergenic
1044429512 8:92092191-92092213 CCTTATAACAAGAAAGTGAATGG - Intronic
1044872110 8:96629539-96629561 CCGTAGAAGAAGAAGGGGTTGGG + Intergenic
1045003683 8:97899596-97899618 CCTTATAAGAAGAGGAAGTCTGG - Intronic
1045219708 8:100186843-100186865 CCTTATAAGAAGAAGATATTTGG - Intronic
1045646934 8:104308400-104308422 CCATATAAGAAGAAGACATTTGG + Intergenic
1045704704 8:104908277-104908299 CCTTATAAGAAGAGGAAATTAGG + Intronic
1046213751 8:111115128-111115150 CCTTATAAGTACAGGGGGTTAGG - Intergenic
1046490744 8:114950630-114950652 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1046839395 8:118840605-118840627 CCTTATAAAAAGGAGGAATTTGG + Intergenic
1047031150 8:120882499-120882521 CCTCTCAGGAAGAAGGTGTTTGG - Intergenic
1047521838 8:125600944-125600966 CCTTGTAAGAAGAGGATATTAGG + Intergenic
1048270113 8:133021711-133021733 CCTTATAAGAAGAGGGGGTCAGG - Intronic
1048499206 8:134960510-134960532 CCCTGTAAGAAGAGGGTGTGTGG - Intergenic
1048544365 8:135372632-135372654 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1048852871 8:138661391-138661413 CCTTATAGGACAAAGGTGTCTGG - Intronic
1049210255 8:141383099-141383121 CCTGACACGTAGAAGGTGTTTGG + Intergenic
1050043917 9:1523929-1523951 CCTTATAAGAAGGAGAGATTAGG + Intergenic
1050185230 9:2965949-2965971 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1051022914 9:12567358-12567380 ACTTATAAGAAGCAGGTGCCAGG - Intergenic
1051202429 9:14642597-14642619 CCTTATAAGAAGAGGAAATTTGG + Intronic
1051650443 9:19318734-19318756 CCTTGTAAGAAGAGGATATTTGG - Intronic
1052161229 9:25262390-25262412 CCTTTTAAGAGGAAGGTGTGAGG + Intergenic
1053035597 9:34824580-34824602 TCTTAGATGAGGAAGGTGTTAGG + Intergenic
1053338209 9:37297619-37297641 CCTTATAAGAAGGAGCTATATGG + Intronic
1053339932 9:37316623-37316645 TCTTATAAGAATAAGGTTCTTGG - Intronic
1054983501 9:71234627-71234649 TCTTATAAGAAGAAGAGATTAGG - Intronic
1055664311 9:78538324-78538346 TCTTATAAGAAGAGGAGGTTAGG + Intergenic
1055797479 9:79990707-79990729 CCTCATAAGAAGAAGGCAATGGG + Intergenic
1056048248 9:82741407-82741429 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1056938986 9:90938925-90938947 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1057008068 9:91578135-91578157 CCTTATAAGAAGAGGAAATTAGG + Intronic
1057168277 9:92945204-92945226 CCTTGTAAGAACAAGGGGTCTGG + Intergenic
1058109049 9:101010511-101010533 CCTTATAAGAAGAAAAGATTAGG + Intergenic
1058179153 9:101776125-101776147 ACATATAATAAGAAGGTATTAGG - Intergenic
1058590144 9:106556823-106556845 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1058629680 9:106973849-106973871 ATTTTTAAGAATAAGGTGTTTGG + Intronic
1059214578 9:112548866-112548888 CCTTATAAGAAGTAGAAATTTGG + Intronic
1059251770 9:112892321-112892343 CCTCATAGGATCAAGGTGTTTGG - Intergenic
1059607882 9:115855796-115855818 CCTTATAATAGGGAGGTGTAGGG + Intergenic
1059726636 9:117014756-117014778 CCTTATAAGAAGAGGATATTGGG + Intronic
1059856218 9:118400453-118400475 CCTTATAAGAAGACGAGATTAGG + Intergenic
1060162337 9:121375827-121375849 CCTTCTAAGAAGAAGAAATTTGG - Intergenic
1060303099 9:122387541-122387563 ACTTATAAGAAGAAGAGATTAGG + Intronic
1061277090 9:129575376-129575398 CCTTATAAGAAGAGGAAATTAGG + Intergenic
1061671974 9:132193965-132193987 CCTTGGAAGAAGAAGAAGTTTGG - Intronic
1061755751 9:132811325-132811347 CCTTATAAGAAGGAGGTAAGAGG + Intronic
1185758708 X:2673036-2673058 CCTTATAAGAAGAAGATATTGGG - Intergenic
1185791837 X:2933057-2933079 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1185921971 X:4103482-4103504 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1185943607 X:4349138-4349160 CCTTATAAGAAGAGGAGATTCGG + Intergenic
1186063660 X:5738552-5738574 CCTTATAAGAAGAAGATATTAGG - Intergenic
1186371686 X:8953357-8953379 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1186612696 X:11153709-11153731 ACTTAGGAGAAGAAAGTGTTTGG - Intronic
1187597454 X:20788798-20788820 CCTTATAAGAAGAGGATATTAGG + Intergenic
1188032884 X:25284106-25284128 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1188384942 X:29544933-29544955 CCTTATAAGAAGATGAAATTAGG + Intronic
1188548532 X:31336780-31336802 AACTATAAGTAGAAGGTGTTAGG + Intronic
1188909912 X:35834170-35834192 CCTTTTCAGCAGAAGGTTTTAGG - Intergenic
1189060934 X:37753077-37753099 CCTTATAAGAGGAGGAAGTTGGG + Intronic
1189211818 X:39290277-39290299 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1189249243 X:39587318-39587340 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1190444492 X:50509892-50509914 CCTTATAAGAAGAGGGGATTTGG + Intergenic
1192016442 X:67336548-67336570 ACTTATAAAAAGAAGGAGTTGGG + Intergenic
1192491502 X:71579857-71579879 CCTGATAGGAGGAAGGAGTTGGG + Intronic
1194458318 X:94132492-94132514 CCTTATAAGAAGAGGCAATTAGG + Intergenic
1196717019 X:118822013-118822035 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1196965470 X:121049746-121049768 ACATTTAAGAAGAAGGTGTGTGG + Exonic
1197340853 X:125265227-125265249 CCTTGTAAGAATAAGATATTAGG - Intergenic
1197968131 X:132086537-132086559 CCTTATAAGAAGAAGAAATTTGG + Intronic
1198263113 X:134984159-134984181 TCTTCTAAGAAGAAGGGATTAGG - Intergenic
1198640931 X:138755968-138755990 CCTTATAAGAAGAAGATATTAGG + Intronic
1198959298 X:142167364-142167386 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1199055278 X:143286731-143286753 CATTATAAGCTGAAGGTTTTGGG + Intergenic
1199412137 X:147536372-147536394 CCTTATAAAAAGAGGGAATTTGG + Intergenic
1199444236 X:147902278-147902300 CCATTTAAGAAGAAGTTGATAGG + Intergenic
1199523359 X:148763402-148763424 CCTTCAAAGTAGAAAGTGTTTGG - Intronic
1199845758 X:151692173-151692195 CCTTATAAGAAGAGGAAATTAGG - Intergenic
1199948757 X:152688640-152688662 CCTTATAAGAAGAGGACATTAGG + Intergenic
1199960919 X:152779809-152779831 CCTTATAAGAAGAGGACATTAGG - Intergenic
1201144297 Y:11054871-11054893 CCTTATGAGAAGAAGAGGTGAGG - Intergenic
1201483642 Y:14468806-14468828 CCTTATAAAAAGGGGGAGTTTGG + Intergenic
1201625064 Y:16005829-16005851 CCTTATAAGAGGAAGGCAGTAGG + Intergenic