ID: 977270073

View in Genome Browser
Species Human (GRCh38)
Location 4:94907326-94907348
Sequence CATTGCCTATAACAGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977270073 Original CRISPR CATTGCCTATAACAGGTGAA AGG Intronic
905328920 1:37178388-37178410 CATTTACTAAAACAGGTGATGGG - Intergenic
908423498 1:63982263-63982285 CATTGCCTATAAAATGGGGATGG + Intronic
913141079 1:115942060-115942082 CACTGCCTACAACAGAGGAATGG + Intergenic
916532042 1:165666005-165666027 AAATGCCTGTAACAGATGAATGG + Intronic
919834488 1:201564310-201564332 CCTTACCTATTACAGGGGAATGG + Intergenic
921908874 1:220527231-220527253 CCTTGCTTATAAAAGGCGAATGG + Intergenic
923534874 1:234841367-234841389 CAAAGCCTATACCTGGTGAATGG - Intergenic
1069061712 10:63901682-63901704 CATTGCCTCTTAGAGCTGAAAGG - Intergenic
1069933477 10:71899572-71899594 CACTGCCTATGACAGTTCAAGGG + Intergenic
1071339141 10:84626653-84626675 CAAAGCCTATGACAGATGAAAGG - Intergenic
1074344319 10:112667537-112667559 AATTGCCTATAACAGTATAAGGG + Intronic
1075887658 10:125915490-125915512 CATACCATAAAACAGGTGAAAGG + Intronic
1077653644 11:3997557-3997579 CAGTGACTATAACATGGGAAAGG - Intronic
1078998101 11:16725111-16725133 AAATGCCTATAACTGATGAATGG + Intronic
1080703147 11:34662468-34662490 CATTGGTTAAAACAGGTCAAAGG - Intergenic
1082950122 11:58805649-58805671 CAGTGCCTATAACATGGTAATGG - Intergenic
1087582751 11:100079559-100079581 CATGGCCTATAAAATGTTAATGG - Intronic
1090755138 11:129783952-129783974 CATTTCCTTTAACAGTTGAGGGG - Intergenic
1091647774 12:2286818-2286840 CAATGCTCATAACAGGAGAAAGG + Intronic
1092995120 12:13942297-13942319 AATTGCCTAGAACAGTTGCAGGG - Intronic
1097479609 12:60105736-60105758 TATTGCCTTTAACAGATGAAGGG + Intergenic
1097807161 12:63978627-63978649 CATTGCTCATAATAGCTGAAAGG - Intronic
1098076717 12:66739453-66739475 CAATGCCTTTAACTGGTGCATGG - Intronic
1098281562 12:68867733-68867755 CACTGCCTCTCAGAGGTGAACGG + Intronic
1099928292 12:89044185-89044207 CATTGTATATGACAAGTGAATGG + Intergenic
1100193205 12:92215196-92215218 CATATCCTACAACAGATGAATGG - Intergenic
1101660717 12:106763147-106763169 TATTCCCTATAAGAGCTGAAAGG - Intronic
1102083794 12:110119599-110119621 CATTGCCTAGGTCAGGTGACAGG - Intergenic
1103218514 12:119223335-119223357 GATGTCCTTTAACAGGTGAACGG + Intergenic
1110264925 13:73526765-73526787 CATGTCCTACAGCAGGTGAATGG + Intergenic
1111245920 13:85540870-85540892 CATTGCATAGCAAAGGTGAAGGG + Intergenic
1111547728 13:89765101-89765123 AAGTCCCTATAACAGATGAATGG + Intergenic
1111913663 13:94338911-94338933 CATTGCCCATAGCTGGAGAAGGG + Intronic
1112248321 13:97754570-97754592 CAGAGGCTATAACAGGTGTATGG - Intergenic
1113483006 13:110635332-110635354 CATGGCCTTTAACAGGTGCCTGG + Intronic
1122822269 14:104353557-104353579 CATTGCAGATAATAAGTGAAGGG + Intergenic
1202870485 14_GL000225v1_random:158579-158601 CATACCATAAAACAGGTGAAAGG - Intergenic
1124132926 15:27005983-27006005 CTTTGCCTAGAACTGGTAAAAGG - Intronic
1124549595 15:30666979-30667001 TATTGCATATATCACGTGAAAGG - Intronic
1124718331 15:32088328-32088350 GATGTCTTATAACAGGTGAATGG - Intronic
1126262195 15:46706242-46706264 GATGACCTTTAACAGGTGAATGG + Intergenic
1126499969 15:49334781-49334803 CATTGCCTTTAAGGGGAGAAAGG - Intronic
1127029254 15:54843810-54843832 CTTTACCTATAACATGGGAATGG - Intergenic
1127580177 15:60331211-60331233 CATGTCCTTTAATAGGTGAATGG + Intergenic
1129135221 15:73543305-73543327 CATTGACAATAACAGGCAAATGG - Intronic
1131215509 15:90532102-90532124 GATTCCCTGTACCAGGTGAAGGG - Intronic
1131700394 15:94929289-94929311 CATTGCTTTTAGCTGGTGAAAGG + Intergenic
1133419532 16:5634105-5634127 CAGTGGCTATAAAAGGTAAAGGG - Intergenic
1133722298 16:8506449-8506471 AATTGACTAAAACAGGAGAAGGG + Intergenic
1135344490 16:21677099-21677121 CATATCCAATAACAGGTGAAAGG - Intergenic
1138352831 16:56355437-56355459 CATTTCTGAGAACAGGTGAATGG + Intronic
1147481993 17:40774709-40774731 CCTTCCCTATAACAAGAGAAGGG - Intergenic
1148507301 17:48138015-48138037 CTTTCCCTAGAACAGGTGAGAGG + Intronic
1148817058 17:50336225-50336247 AATGCCCAATAACAGGTGAATGG + Intergenic
1149489822 17:57076303-57076325 AATTTCCTTCAACAGGTGAATGG - Intergenic
1151329457 17:73398314-73398336 CATTACCTGTAGCAGGTGAAGGG + Exonic
1154972166 18:21420884-21420906 AAAAGTCTATAACAGGTGAATGG + Intronic
1155077865 18:22378078-22378100 AATGCCTTATAACAGGTGAATGG + Intergenic
1156173772 18:34517840-34517862 GATGTCCTTTAACAGGTGAATGG - Intronic
1158226884 18:55210682-55210704 CATTGCCTATGACAGGGGTAAGG + Intergenic
1159221366 18:65468255-65468277 CATTGCCTAGAACATGTTAATGG + Intergenic
1162860822 19:13505217-13505239 CATTGCCTTTAACCGCTGATTGG - Intronic
1168199308 19:54803540-54803562 CATTGACCACAACATGTGAAGGG - Intronic
925077705 2:1032081-1032103 CATTGCTTGTGACAGGTGGAAGG + Intronic
925225309 2:2179036-2179058 TATTGCCTGTAAGATGTGAATGG - Intronic
927001302 2:18796803-18796825 CCTTGCCTATCCCAGGTGTATGG + Intergenic
928161810 2:28934070-28934092 TATGTCCTTTAACAGGTGAATGG + Intronic
933284032 2:80365094-80365116 CATTTCCAATTACAGGGGAATGG - Intronic
935034331 2:99353922-99353944 CATGTCCTTTAATAGGTGAATGG - Intronic
936506389 2:113111075-113111097 CAATGCTTATTACACGTGAAAGG - Intronic
937799637 2:126067388-126067410 GATTGCATAGAACTGGTGAAAGG + Intergenic
937992454 2:127672257-127672279 CTTTGACTATCACAGCTGAAGGG - Intronic
938404599 2:131023858-131023880 CATATCCTTAAACAGGTGAATGG + Intronic
946144782 2:217722140-217722162 GATGTCCTTTAACAGGTGAATGG + Intronic
947655366 2:231822121-231822143 GATGTCCTTTAACAGGTGAATGG - Intergenic
947920824 2:233871465-233871487 CATATCCTTTAACAGGTGATAGG - Intergenic
947928900 2:233946229-233946251 CATTGCCTTTAGCATGTTAAAGG - Intronic
1168987368 20:2061562-2061584 CATTTCCAATGACAGATGAATGG + Intergenic
1176954543 21:15086127-15086149 TATTGCCTATCACATGGGAATGG + Intergenic
1177226809 21:18267849-18267871 CATGGACTATAACAGCTGCAAGG + Intergenic
1177254446 21:18642663-18642685 AATGGCCTTCAACAGGTGAATGG - Intergenic
1178948130 21:36965401-36965423 CATTTCCAAAAACAGCTGAATGG + Intronic
1182244165 22:28942139-28942161 TATTTCCTAAAACAGGTGAGAGG - Intronic
1182311335 22:29410160-29410182 CTTTGCCTACAATAGGAGAAAGG - Intronic
1182997730 22:34829907-34829929 CACAGCCTTTCACAGGTGAAAGG + Intergenic
1183161851 22:36119336-36119358 CAAAGCCTTTAACAGGTGAATGG + Intergenic
950502159 3:13371467-13371489 CCTTGCCTGTCACAGGTGAGAGG + Intronic
950910895 3:16590630-16590652 CAATGTCTTTAACAGATGAATGG + Intronic
962484561 3:135829918-135829940 CATTGCCTTTTACAGGTTGATGG - Intergenic
969328201 4:6456040-6456062 GATTGTCTATAACAGGTGTGTGG - Intronic
970694053 4:18655004-18655026 CATTGCTTATAATAGGAAAAGGG + Intergenic
974306226 4:60144183-60144205 GATTGACTATTTCAGGTGAAGGG + Intergenic
974955654 4:68638306-68638328 CATTGCCAATAACACTTGAGAGG - Intronic
977270073 4:94907326-94907348 CATTGCCTATAACAGGTGAAAGG + Intronic
979329734 4:119410908-119410930 TATTCATTATAACAGGTGAACGG + Intergenic
979468446 4:121069225-121069247 CATTGCCAATACCAGGTCGATGG - Intronic
980133396 4:128837229-128837251 CATTCCTTATCACAGGTGATGGG - Intronic
982106392 4:152015336-152015358 CATTTCCTAAAACAAGTGCAGGG - Intergenic
983915429 4:173286803-173286825 CATTTCCTTTAACAGTTGAGGGG - Intronic
986147454 5:5091985-5092007 CATTCCATATAACAAATGAATGG + Intergenic
986466761 5:8033945-8033967 CATTATCTCTAACAGGTGAGTGG + Intergenic
989792089 5:45417527-45417549 CATTGCCTCCAGCAGGTGACTGG + Intronic
991220552 5:64210768-64210790 CATCCCCTATACCAGGAGAAAGG - Intronic
991312696 5:65262110-65262132 CCATGCCCATTACAGGTGAACGG - Intronic
993749389 5:91648549-91648571 CTTGGCATATAACAGGTGTAAGG - Intergenic
995129846 5:108618710-108618732 CATTGGATACCACAGGTGAAGGG - Intergenic
995691180 5:114827817-114827839 CATTGCCAAGAACAAGGGAATGG - Intergenic
996634867 5:125677439-125677461 TATTGTCTATCCCAGGTGAATGG - Intergenic
998049031 5:139015851-139015873 CATTTCCTAGAACTGGGGAAGGG + Intronic
999280759 5:150364009-150364031 CATTGCCTTTAAGAGCTGGAAGG + Intronic
1000285028 5:159819553-159819575 CATTGCCTATAATATCTGCAGGG + Intergenic
1005368250 6:25101622-25101644 AATAGCCTTCAACAGGTGAATGG - Intergenic
1005659109 6:27976456-27976478 AAATGCCTATAATAGGTTAATGG + Intergenic
1008303077 6:49866555-49866577 AAATGCCTATAACAGATCAAGGG + Intronic
1009403733 6:63287791-63287813 CATCTCCTATAAAAGGAGAAAGG + Intronic
1010290943 6:74136745-74136767 GATTTCCTACAACAGGTGACTGG + Intergenic
1013642363 6:112098262-112098284 CATTGGCCATAGCAAGTGAAGGG + Intronic
1014391269 6:120868607-120868629 CTTTTCTTATAACAGGTGAATGG + Intergenic
1015333438 6:132007613-132007635 CATTGCATAATACAGATGAAAGG + Intergenic
1016208094 6:141494827-141494849 GATGTCCTTTAACAGGTGAATGG - Intergenic
1016397440 6:143640552-143640574 CAATGCCTACAAAAGGTCAATGG + Intronic
1020524526 7:9241906-9241928 CATTGCCTGTAAGAGTTGAATGG - Intergenic
1021838153 7:24701012-24701034 CATTTCCAAGAACTGGTGAAAGG - Intronic
1023017708 7:35983652-35983674 CCTGGCCTAAAAGAGGTGAATGG - Intergenic
1023470754 7:40515708-40515730 AAATGCCTATAACAGATAAATGG - Intronic
1024693701 7:51833029-51833051 TATTGCCTATAGGATGTGAATGG - Intergenic
1026362582 7:69616379-69616401 CATTGCTTCTAAGAGGGGAAAGG - Intronic
1027525843 7:79267622-79267644 AATTGGCTATATCAGGTGTAGGG + Intronic
1030016672 7:105229592-105229614 CAGTGCCCACAACAGATGAAGGG + Intronic
1030104412 7:105974866-105974888 CATTGCCTGTAGCAGGTAAGAGG - Exonic
1030304695 7:108005970-108005992 CATTGCCTAGAGCAGGAGTATGG - Intergenic
1036489246 8:9209751-9209773 CTTTTCCTATAACAAGTCAAAGG + Intergenic
1036790978 8:11719819-11719841 CACTGTCAATAACAGCTGAATGG + Intronic
1039663459 8:39493934-39493956 GATAGCCTTTAACAGGTGAATGG - Intergenic
1042846143 8:73171243-73171265 CATTGAGTATAAAAGGTGCATGG + Intergenic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1045568132 8:103342323-103342345 CATTTCCTATAACATGATAATGG + Intergenic
1048574798 8:135682077-135682099 CATTGACAAAAACAGGTGGAGGG + Intergenic
1048914511 8:139168846-139168868 CATTGCCTAGAACAGGTCAGTGG + Intergenic
1050693764 9:8257445-8257467 CATTGCATATCAAAGGTGGAGGG - Intergenic
1051476978 9:17518677-17518699 CATTGCCTAAAACAAGTCACAGG - Intergenic
1052797504 9:32936946-32936968 CATTGCCTAGGACAGAGGAAGGG + Intergenic
1053282111 9:36827126-36827148 CATTTCCTGAAACAGGGGAAAGG - Intergenic
1055194880 9:73577854-73577876 CATTGTCTTTGACAGGTAAATGG + Intergenic
1057463314 9:95287474-95287496 CATTGCCTCTGACAGCTGGAAGG - Intronic
1058099668 9:100905143-100905165 CATTGCCTAAAACAGGTTATGGG + Intergenic
1203733972 Un_GL000216v2:118003-118025 CATACCATAAAACAGGTGAAAGG + Intergenic
1187029030 X:15466658-15466680 CCTGGCCCATAACAGGTGATGGG + Intronic
1189094087 X:38119572-38119594 GATTTCCTTCAACAGGTGAATGG - Intronic
1189196966 X:39161231-39161253 CATTGCCTGTCAAAGGGGAAGGG - Intergenic
1190104478 X:47549457-47549479 CATCGCCTATAAAATGTCAAAGG + Intergenic
1191127927 X:56977688-56977710 TATGGCCTTTAACAGGTGATTGG + Intronic
1192421621 X:71037534-71037556 CATTGATTTTAACAGGTGCATGG - Intergenic
1193139276 X:78009087-78009109 CTTTGTCTTTAACAGGTGAGGGG + Exonic
1193204618 X:78733864-78733886 CATTGCAGATAACAGATAAATGG + Intergenic
1195068598 X:101259001-101259023 CATTGCCTCTCAGAGATGAAAGG - Intronic
1195431519 X:104794818-104794840 TATAGCTTAAAACAGGTGAAGGG + Intronic
1196068101 X:111488043-111488065 CATTTCTCATAACCGGTGAAGGG - Intergenic
1202627039 Y:56870406-56870428 CATACCATAAAACAGGTGAAAGG - Intergenic