ID: 977272987

View in Genome Browser
Species Human (GRCh38)
Location 4:94940998-94941020
Sequence ATTGGGAATTTCAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977272987 Original CRISPR ATTGGGAATTTCAATGAGGA AGG Intronic
900803800 1:4754491-4754513 ATTGGGACTGTCAAGGAGGATGG - Intronic
901547724 1:9971637-9971659 ATTGGGAATGAGAATGTGGAAGG + Intronic
902057583 1:13615090-13615112 ATTAGGAGTTCCACTGAGGATGG + Intronic
905240858 1:36580667-36580689 ATTGGGAAGGACAATGAGGAGGG + Intergenic
909207848 1:72782343-72782365 ATTGGGAATTTTAATGTCTAAGG - Intergenic
911481846 1:98452811-98452833 AGTGGACATTTCAGTGAGGAGGG + Intergenic
912814654 1:112819402-112819424 ATTGTGAATTTCAAAGCCGAGGG + Intergenic
915023878 1:152807885-152807907 AGTGAGAATTCCAATGATGATGG - Intronic
915694507 1:157725659-157725681 TTTGGGAATATCAATGAACAAGG - Intergenic
915991522 1:160522052-160522074 ATTGGTAATTGGAATGAGAAAGG - Intronic
916975783 1:170075893-170075915 AATAGGAAGTCCAATGAGGAAGG - Intronic
917098435 1:171422921-171422943 CTTGGGAATCTAAAGGAGGAAGG + Intergenic
917519227 1:175734222-175734244 TTTGGGAATTTCAGGCAGGAAGG - Intronic
918840882 1:189537710-189537732 ATTGGGATTTTGATTGAGAATGG + Intergenic
919095513 1:193030102-193030124 TTTGGGAATTTAAATGAGGGTGG - Intronic
919356136 1:196524304-196524326 ATTGGGAGTTTGAATGAGAATGG + Intronic
921587715 1:216967174-216967196 GTGGGGAATATCAATGGGGAGGG - Intronic
924023692 1:239811124-239811146 ATTGGGATTTTGAGTCAGGACGG - Intronic
924670401 1:246118709-246118731 ATTGGGAGTCTCAAGGAAGAAGG - Intronic
924680927 1:246232363-246232385 AGTGTGAATTTCAATGAGGTGGG + Intronic
1062826349 10:571554-571576 ATGGGGAAGTGCAGTGAGGAAGG - Intronic
1063028412 10:2206917-2206939 ATTGTGAATATAAATTAGGAAGG + Intergenic
1063661124 10:8035784-8035806 ATTGAGAATTACACTGAGGGAGG + Intergenic
1067525119 10:47033868-47033890 TCTGGGAATGTCAATGAAGAAGG + Intergenic
1067917036 10:50411144-50411166 CTTTGGAATTTCAAGGAAGAAGG + Intronic
1067978788 10:51057538-51057560 ATTGGGAAATGGCATGAGGAAGG - Intronic
1069251192 10:66269241-66269263 AATGGGAATTTCCTTGAAGACGG + Intronic
1069384925 10:67875552-67875574 ATTGGGGCTCTAAATGAGGAAGG - Intergenic
1070262299 10:74869614-74869636 ATTGGGAAATTCAAAGAGGTGGG - Intronic
1071009835 10:80925064-80925086 ACAGAGATTTTCAATGAGGACGG + Intergenic
1071184572 10:83026663-83026685 ATTAGAAATTGCAATGAGGCTGG - Intergenic
1071298453 10:84239462-84239484 TTTGGGTATTGCAAGGAGGAAGG + Intronic
1072914055 10:99526505-99526527 AGTGGGGATTTCCATGGGGAGGG + Intergenic
1074372898 10:112914656-112914678 ATTGAGCATTTAAATGAGGCAGG + Intergenic
1074541070 10:114365576-114365598 ATGGGGAGTATCACTGAGGAAGG - Intronic
1076018866 10:127053479-127053501 ATAGGGTATTTCCGTGAGGAAGG + Intronic
1078526428 11:12104939-12104961 ATTGGGAATTGTAAAGAGCACGG + Intronic
1078836230 11:15032926-15032948 ATTGGGAACTTCTATTGGGATGG + Intronic
1080223400 11:29933496-29933518 ATGGGGAATTTCAAAAATGATGG - Intergenic
1085033751 11:73288033-73288055 CTTGGGAATGTGAATGAAGAGGG - Intronic
1086881095 11:92154353-92154375 ATAGGGAATTTGAATGAGAATGG - Intergenic
1088612559 11:111591879-111591901 AATGAGAATTTCAAGGTGGAAGG - Intergenic
1092077989 12:5689153-5689175 AGTGGGAATTTCAAGAAGAATGG + Intronic
1092254719 12:6920280-6920302 ATTTGGATTAGCAATGAGGAAGG + Intronic
1092669255 12:10843864-10843886 CATTGGAATTTAAATGAGGAAGG + Intronic
1095652660 12:44631049-44631071 GGTAGGAAATTCAATGAGGATGG - Intronic
1096107575 12:49005881-49005903 ATTGGGAGTTTTTATGTGGAAGG - Intronic
1101348107 12:103904929-103904951 CTGGGGAATCTCATTGAGGAAGG - Intergenic
1108162084 13:47651387-47651409 ATTTGGAATTTTGATGAGGATGG - Intergenic
1108576638 13:51796863-51796885 ACTGGGGATTTCCATGAGAAAGG + Intronic
1108798995 13:54069868-54069890 ATTAGGGATTTCAAAGGGGAAGG + Intergenic
1109250504 13:60014202-60014224 ATTGGAAATTTCATTGGTGATGG - Intronic
1112720562 13:102239527-102239549 CTTTGGAATTTGAATGAGGCTGG + Intronic
1112878697 13:104079555-104079577 ATTGGGAATTACTAGGGGGAAGG + Intergenic
1113268830 13:108649761-108649783 ATTAAGACTTGCAATGAGGAGGG + Intronic
1113393320 13:109918728-109918750 ATTGGGAATATTAATGTGGTCGG + Intergenic
1113777179 13:112954476-112954498 ATAGTGAAGTTAAATGAGGAGGG - Intronic
1115472046 14:33778019-33778041 ATTGGGTATTTCCATGAAAAAGG - Intronic
1116751549 14:48892083-48892105 TCTGGGAATTACAATGAGGTTGG + Intergenic
1119919850 14:78436535-78436557 AGTGGAAATTTCAGTGATGATGG + Intronic
1120080361 14:80209637-80209659 ATTGTGCATGTCAGTGAGGACGG - Intronic
1120856048 14:89213308-89213330 CTTGGGGCTTTCAATGAGTAAGG - Intronic
1121682017 14:95801580-95801602 GTTGGGAATATCAACGAGGAAGG + Intergenic
1123400076 15:19975243-19975265 ATGGGGAATTTAAATGAGCCTGG - Intergenic
1125324448 15:38522726-38522748 ATTGAGAAGTTCAGTGAGGAAGG + Intronic
1126518201 15:49558466-49558488 AGTGGGCCTTTCACTGAGGAGGG - Intronic
1130751392 15:86716813-86716835 ATTGGGAATCCAAATGAGGTGGG + Intronic
1131289053 15:91089211-91089233 AGTGGGAATGGAAATGAGGAGGG + Intergenic
1131307924 15:91261810-91261832 AATGGTAATTTCTATGAAGATGG + Intronic
1131646180 15:94347614-94347636 ATTGGGAATTTCATTTAATAGGG + Intronic
1132512388 16:350678-350700 ATTGAGAATTTCAGTGATGGGGG - Intronic
1135502484 16:23008724-23008746 ATTGGGAATTCCATTGGTGATGG + Intergenic
1135833401 16:25799217-25799239 AATGGGAATTTGAATGTGGGTGG - Intronic
1136444284 16:30303374-30303396 ATAGAGTATTTCAATAAGGACGG + Intergenic
1138458324 16:57133659-57133681 CCAGGGATTTTCAATGAGGAGGG - Intronic
1143844147 17:9759928-9759950 ATTAGAAATTTCTATGAAGATGG + Intergenic
1144965496 17:19074968-19074990 AGTGGGAATGACAAGGAGGAAGG - Intergenic
1144968339 17:19091632-19091654 GCTGGGAGTTACAATGAGGAAGG - Intergenic
1144979578 17:19160431-19160453 GCTGGGAGTTACAATGAGGAAGG + Intergenic
1144982471 17:19177215-19177237 AGTGGGAATGACAAGGAGGAAGG + Intergenic
1144985752 17:19201024-19201046 AGTGGGAATGACAAGGAGGAAGG - Intergenic
1144988644 17:19217801-19217823 GCTGGGAGTTACAATGAGGAAGG - Intronic
1148926021 17:51086333-51086355 ATTAGCATTTTAAATGAGGATGG - Intronic
1149987036 17:61355022-61355044 CTTGGGAATTTCAAAGAGCAGGG - Intronic
1150503145 17:65670376-65670398 CTTGAGAATTTCAATTATGAGGG - Intronic
1150924589 17:69519363-69519385 TTTGGATATTTCCATGAGGACGG + Exonic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152958292 18:59128-59150 ATTGGGAATTACATTTGGGAGGG + Intronic
1156351932 18:36309344-36309366 AATGGGAAATTCCAAGAGGAAGG + Intronic
1156901732 18:42308411-42308433 ATTGGAAATTTCCCTGAGGAGGG - Intergenic
1157531130 18:48421749-48421771 ATTAGGAATTTCAAAGTGGAGGG - Intergenic
1158028457 18:52932490-52932512 AGTGGGAACTTTACTGAGGATGG + Intronic
1158631676 18:59120688-59120710 ATGGTGAATTTCAGTGAGGGTGG - Intergenic
1159775990 18:72603226-72603248 ATTGGAGATTTAAATGAGAAAGG - Intronic
1163136395 19:15314529-15314551 ATTGGGCATCTCCAGGAGGATGG - Intronic
1168056233 19:53866677-53866699 ACTCAGAATTTTAATGAGGATGG - Intronic
929420198 2:41782565-41782587 ATTGGGATTTTTCAGGAGGATGG - Intergenic
932090105 2:68798915-68798937 ATTGGGGATTTCAAGGAAAAAGG + Intronic
932186261 2:69698851-69698873 AGTTGTAATTTCAATGAAGAGGG + Intronic
932806529 2:74789048-74789070 GTTAAGAATTTCAATTAGGATGG + Intergenic
939031634 2:137083148-137083170 ATTGAGAATTTTAAAGAGAAAGG + Intronic
941985926 2:171511724-171511746 AGTGGGAATTTCCAAGTGGATGG + Intergenic
941998148 2:171621057-171621079 ATGGGGAATTTGAAAGGGGATGG + Intergenic
942511569 2:176708479-176708501 ATTGGGAATTACATTTAGGCAGG + Intergenic
943174927 2:184459471-184459493 ATTAGGAATATAAATTAGGATGG + Intergenic
945848562 2:214978372-214978394 ATTGGGAATTCCAATGCCAATGG - Exonic
946064262 2:216973268-216973290 AATGAGCATATCAATGAGGAAGG + Intergenic
948173812 2:235927971-235927993 ATTGGGCATTGCAGTGTGGAAGG + Intronic
948666995 2:239542342-239542364 ACTGGGAATTCCAGGGAGGAAGG - Intergenic
1169599368 20:7239920-7239942 AGAGGGAATTTCAGAGAGGAGGG + Intergenic
1171005264 20:21458627-21458649 ATTTGGAATTTCAATCTGGTTGG + Intergenic
1171061533 20:21968060-21968082 ATTTGGCAGATCAATGAGGAAGG + Intergenic
1172695747 20:36821806-36821828 ATAGGGAATTTCTGTGTGGATGG - Intronic
1172768855 20:37365504-37365526 AATGTGAATTTCAATAATGATGG + Intronic
1173757422 20:45529586-45529608 AATGGTAATTACAAGGAGGATGG - Intergenic
1174691439 20:52510389-52510411 ATTGGGAAATTGACTCAGGATGG - Intergenic
1175800608 20:61799233-61799255 ATTGGGAATTGCAAAGAGGTAGG + Intronic
1176260659 20:64177829-64177851 CTTGGAAATTTCCATGAAGAAGG - Intronic
1178082989 21:29084737-29084759 ATCAGGAATCTCAATGAAGAAGG + Intronic
1184480909 22:44746341-44746363 ATGGAGAATTTCAAGGAGGAGGG - Intronic
950876684 3:16281649-16281671 AATGTAAAATTCAATGAGGAAGG - Intronic
952269682 3:31818729-31818751 AGTGGGAATTCCACTCAGGAGGG - Intronic
952740214 3:36727383-36727405 ATTGGGGGCTTCCATGAGGAAGG - Intronic
953746816 3:45581008-45581030 ATTGGGTATATCAATGAGAAGGG - Intronic
959598233 3:108151007-108151029 ATGGGAAATTCCAATGAGAATGG + Intergenic
960551004 3:118976445-118976467 TTTGGGCACTTCAATGATGATGG - Intronic
963319300 3:143795809-143795831 ATTGGGACTGGCAATGAGGAAGG + Intronic
965386330 3:168050465-168050487 TTTGAGAATTTCACTGAGGTGGG + Intronic
967467254 3:189822191-189822213 AATGGTAATTTCTATTAGGATGG + Intronic
967468068 3:189830791-189830813 TTTGGGACTTTGAAGGAGGAAGG + Intronic
970253296 4:14139964-14139986 ATTGGGAAAGTAAATGAGGCAGG + Intergenic
970456521 4:16227918-16227940 ATAGAGAATTTCATGGAGGATGG - Intergenic
971987635 4:33846773-33846795 ATGAGGAAATTCAAAGAGGAGGG + Intergenic
973251972 4:48070205-48070227 AAAGGGAATTTCACTGAGAAGGG + Intronic
976318146 4:83681587-83681609 ATTTGGAATTTCAGTGGAGAAGG + Intergenic
976518967 4:86004458-86004480 ATTGTCAATTTCAGTGATGATGG + Intergenic
977103725 4:92852668-92852690 ATGGGGACTTTCAAGAAGGAGGG - Intronic
977272987 4:94940998-94941020 ATTGGGAATTTCAATGAGGAAGG + Intronic
977506625 4:97911269-97911291 CCTGGGAATTCCAATGAGGCAGG + Intronic
980012411 4:127611888-127611910 TTTGGGAATTTTAATGACTATGG - Intergenic
982291045 4:153783006-153783028 AATGGGAATTTGACTGAGTATGG + Intronic
982814319 4:159867283-159867305 AGTGGTAATTTCAATGAAGAAGG + Intergenic
984859671 4:184226706-184226728 ACTGAAAATTTCAATGAGCAAGG + Intergenic
985022973 4:185711643-185711665 GTTGGGAATTTGGATGGGGAAGG - Intronic
986409791 5:7465833-7465855 CTTGGGAGTTTCATTGAAGAGGG + Intronic
986768008 5:10945649-10945671 ATAGTGAATTTCAATGATGAAGG - Intergenic
988298573 5:29394222-29394244 TTTGGGATTTTCAATAAAGAGGG - Intergenic
988830038 5:34978234-34978256 AGAGGGAATTTCAATAAGGAAGG + Intergenic
989196621 5:38722977-38722999 ATTAGGTATTTCAAGCAGGAGGG + Intergenic
992377130 5:76198984-76199006 CTTGGGAATCTCAAAGAGGAGGG + Intronic
993294825 5:86123298-86123320 AGTGGAAATTTCATTCAGGAGGG - Intergenic
994929107 5:106157184-106157206 ATTGTGAATTTCTATCAGGCTGG + Intergenic
997920923 5:137978658-137978680 GTTGGGAATGTCAAAGAGGATGG - Intronic
999690645 5:154143255-154143277 ATGTGGAATTTCAATGAGGCTGG - Intronic
1002947591 6:1778002-1778024 AATGGAAATTTCAATAAAGAGGG + Intronic
1003704979 6:8515888-8515910 AATGGGAATTTTAATTAGGTTGG + Intergenic
1003997276 6:11555637-11555659 ATTGGGAATTTCAGTAGAGATGG - Intronic
1004100684 6:12607284-12607306 ATTGGGAAATTGAATGGGGATGG - Intergenic
1005258496 6:24031103-24031125 ATGGAGAATTTAAATGAGAATGG - Intergenic
1006236283 6:32636146-32636168 ATTTGGAATTTTAATGGGGTAGG + Intronic
1007538716 6:42621158-42621180 ATTGGGAATTTAAATGGGAAAGG - Intronic
1008113818 6:47523308-47523330 ATTGGGAATTGTAATGAAAATGG + Intronic
1008745440 6:54664457-54664479 GTTGGGTACTTCCATGAGGATGG + Intergenic
1010452869 6:76022149-76022171 ATCGAGAATTTCATTGAGGAGGG + Exonic
1010598638 6:77796787-77796809 CTTTGGAATTTTAATGTGGATGG - Intronic
1011568084 6:88701541-88701563 ATTGAGAATTTCAATATGCAAGG + Intronic
1012216471 6:96591912-96591934 TTAGGGATTTTCAATGGGGAGGG + Intronic
1013007056 6:106083502-106083524 ATTGGGAATTGCAATGTTGGTGG - Intergenic
1013018196 6:106180520-106180542 CTTGGAAATTGCAATGAGAAAGG - Intergenic
1014750531 6:125250620-125250642 ATTGGGAAAAACAATGAGCAGGG - Intronic
1014996534 6:128152529-128152551 ATTGGGTTTTGCAATGAGGCTGG + Intronic
1015180803 6:130360478-130360500 TTAGGGACTTTCAAAGAGGAGGG + Intronic
1015195389 6:130520159-130520181 ATTTGGTATTTGAATGAGTAAGG + Intergenic
1015628134 6:135203177-135203199 ATTTGAAATTTAAATGAGGTTGG - Intronic
1016152210 6:140755503-140755525 ATTGAGAATTTCAGAGAGGGTGG - Intergenic
1017665042 6:156711901-156711923 ATTGGCAATATCAATAAGGCAGG + Intergenic
1018344761 6:162888764-162888786 ATTGGGTTTTCCAAAGAGGAAGG - Intronic
1020254525 7:6495379-6495401 ATTGGGGATTTTAAGGAGGCTGG + Intergenic
1020512364 7:9073713-9073735 ATTGTGAATTTTTATGAGTATGG + Intergenic
1022193278 7:28038157-28038179 AATGGGAATTTCCATGAAGTGGG + Intronic
1024689404 7:51782874-51782896 ATTGAGAATTTCAAAGATCATGG + Intergenic
1025988064 7:66473520-66473542 ATAGAGAATTTCATGGAGGATGG + Intergenic
1027211049 7:76149417-76149439 ATAGAGAATTTCATGGAGGATGG + Intergenic
1028384716 7:90242142-90242164 ATGAAGAATTTCACTGAGGAGGG + Intergenic
1030319524 7:108150016-108150038 AATGGCCAGTTCAATGAGGATGG - Exonic
1030624583 7:111830839-111830861 ATGGGCAATTTCACTGATGAGGG - Intronic
1030777855 7:113557552-113557574 AATGGAAATTTCAGTGATGATGG + Intergenic
1031658295 7:124386516-124386538 CTTGGGAATTTGAATAAGTATGG - Intergenic
1033236705 7:139643749-139643771 AATTGTAATGTCAATGAGGAAGG + Intronic
1034035672 7:147818275-147818297 AATAGGAATTTCAAAGAGAAAGG - Intronic
1042051227 8:64710210-64710232 ATTGAGAGTTTCAGAGAGGATGG - Intronic
1043780385 8:84326919-84326941 AATAGGAAGTTCTATGAGGAAGG + Intronic
1044952600 8:97448705-97448727 ACTGGGGATTTCAAATAGGAAGG - Intergenic
1047160961 8:122378807-122378829 ACTGGGTATTTCAATGAGCGTGG + Intergenic
1048015218 8:130491101-130491123 AGTGGGAAGTTGAATGTGGAAGG + Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1050282991 9:4071737-4071759 ATTGTGTGTTTCAAGGAGGATGG - Intronic
1052046223 9:23797479-23797501 ATTGGGAATTTAAAACAGAAAGG + Intronic
1055471948 9:76620697-76620719 TTTGGGAATTCCAGTGAGCAAGG + Intronic
1057320125 9:94005108-94005130 ATATGGTAGTTCAATGAGGATGG - Intergenic
1058167089 9:101632334-101632356 ATTGTAAGTTTCCATGAGGATGG + Intronic
1185635677 X:1550107-1550129 AGTGGGATTTGCCATGAGGAAGG - Intergenic
1185911988 X:3989925-3989947 ATTGGGAATTGAAATAAGTAAGG - Intergenic
1186026314 X:5317484-5317506 ATTATGAATTTCAAGGAGAAAGG + Intergenic
1190570217 X:51773671-51773693 ACTGGGTTTTTCAATGAAGAGGG + Intergenic
1192339483 X:70251426-70251448 ACTGTGAATTTCTAAGAGGAGGG - Intergenic
1198162637 X:134022721-134022743 AATGGCAGTTGCAATGAGGATGG - Intergenic
1198424766 X:136506114-136506136 ATAAGGTATTTCAATGAGCAAGG - Intronic
1201467363 Y:14297907-14297929 CTTGGATATTTCAATGAGGAAGG - Intergenic