ID: 977275676

View in Genome Browser
Species Human (GRCh38)
Location 4:94975032-94975054
Sequence TTCGTCCTTGTGAAGTCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 102}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977275676_977275681 18 Left 977275676 4:94975032-94975054 CCAACAGACTTCACAAGGACGAA 0: 1
1: 0
2: 1
3: 1
4: 102
Right 977275681 4:94975073-94975095 ACGGTGCCACAAAAGGTATTGGG 0: 1
1: 0
2: 0
3: 6
4: 46
977275676_977275680 17 Left 977275676 4:94975032-94975054 CCAACAGACTTCACAAGGACGAA 0: 1
1: 0
2: 1
3: 1
4: 102
Right 977275680 4:94975072-94975094 TACGGTGCCACAAAAGGTATTGG 0: 1
1: 0
2: 0
3: 3
4: 37
977275676_977275683 28 Left 977275676 4:94975032-94975054 CCAACAGACTTCACAAGGACGAA 0: 1
1: 0
2: 1
3: 1
4: 102
Right 977275683 4:94975083-94975105 AAAAGGTATTGGGCTACTTCAGG 0: 1
1: 0
2: 0
3: 9
4: 124
977275676_977275679 11 Left 977275676 4:94975032-94975054 CCAACAGACTTCACAAGGACGAA 0: 1
1: 0
2: 1
3: 1
4: 102
Right 977275679 4:94975066-94975088 GTTATTTACGGTGCCACAAAAGG 0: 1
1: 0
2: 1
3: 8
4: 87
977275676_977275677 -1 Left 977275676 4:94975032-94975054 CCAACAGACTTCACAAGGACGAA 0: 1
1: 0
2: 1
3: 1
4: 102
Right 977275677 4:94975054-94975076 AACTTCCAGTTTGTTATTTACGG 0: 1
1: 0
2: 3
3: 24
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977275676 Original CRISPR TTCGTCCTTGTGAAGTCTGT TGG (reversed) Intronic
900287922 1:1910610-1910632 CTCGTCCTTGTGGGGTCTGCGGG + Intergenic
905708465 1:40080566-40080588 TTTGTCCTTTTAAAGTCTCTTGG - Intronic
906251529 1:44314466-44314488 TTAGACCATGGGAAGTCTGTAGG - Intronic
907721230 1:56974272-56974294 CTCTTCCATGTGATGTCTGTTGG + Intergenic
908594112 1:65667456-65667478 TTCTGCATTGTGAAGACTGTGGG + Intergenic
908967968 1:69788211-69788233 TTTGTTCTGGTGGAGTCTGTTGG - Intronic
911209564 1:95125166-95125188 TTCTTCATTATCAAGTCTGTGGG + Intronic
913364663 1:118023941-118023963 TTGGTCCTTGTCATGTTTGTTGG - Intronic
919475889 1:198033588-198033610 GTGCTCCTTCTGAAGTCTGTAGG + Intergenic
1063179567 10:3585562-3585584 TTCGTGCCAGTGAAGTCCGTGGG - Intergenic
1064614083 10:17134800-17134822 TTTTTATTTGTGAAGTCTGTGGG - Intergenic
1065316308 10:24467257-24467279 TTGATCCGTGTGCAGTCTGTGGG + Intronic
1065792140 10:29270297-29270319 TGAGTCCTTGGGAAGCCTGTTGG - Intergenic
1067381841 10:45781401-45781423 TTCTTCCTTTTCAAGACTGTTGG - Intronic
1067889540 10:50122041-50122063 TTCTTCCTTTTCAAGACTGTTGG - Intronic
1068611069 10:59060940-59060962 TTCATCTCAGTGAAGTCTGTGGG - Intergenic
1069034937 10:63636598-63636620 TTCTTCCTTTTTAATTCTGTAGG + Intergenic
1070622668 10:78025721-78025743 ATCGTCCATGTGAAACCTGTGGG - Exonic
1071699571 10:87915692-87915714 TATGTCTTTGTGAAGTCTGGCGG - Intronic
1075130509 10:119734229-119734251 TTAGTCCTTGTGATGTATGGTGG + Intronic
1077380013 11:2228339-2228361 TTCATCCATGTGAAATGTGTGGG - Intergenic
1077452075 11:2654360-2654382 TTCATCCTTGTGAAGTAGGCTGG + Intronic
1079743207 11:24090928-24090950 TTTGTTCTTTTGGAGTCTGTGGG + Intergenic
1081547152 11:44079571-44079593 TCCGTGTTTGAGAAGTCTGTTGG + Exonic
1085188298 11:74595140-74595162 TTCATCCATGAGAAGTCTGAGGG - Intronic
1088336376 11:108708849-108708871 TTTATCCTTTTGATGTCTGTGGG + Intronic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1090580541 11:128153994-128154016 TTTGTCCATGTGCAGTCTTTGGG - Intergenic
1090606961 11:128431748-128431770 TCCTTTCCTGTGAAGTCTGTGGG + Intergenic
1091921229 12:4306525-4306547 TTCTGCCTAGTGAAGTCTGCTGG + Intergenic
1098338900 12:69431653-69431675 GTGCTCCTTCTGAAGTCTGTAGG - Intergenic
1099143729 12:79012673-79012695 TGGTTCCTTGTGAAGTGTGTAGG + Intronic
1099219554 12:79896990-79897012 ATCGTTCTTGGGAAGTCTTTAGG - Intronic
1100315329 12:93440599-93440621 CTCATTCTTGTGAAATCTGTGGG - Intronic
1102738490 12:115185020-115185042 TTCCTGCTGGTGAAGTCAGTGGG + Intergenic
1104495875 12:129238108-129238130 CTAGTCCCTGTGAAATCTGTGGG + Intronic
1108304935 13:49121782-49121804 TTCTTCCTTGTTTAGTCTTTGGG - Intronic
1119634528 14:76263240-76263262 TACGTCTTTGTGAAGTCGGCAGG - Intergenic
1129870841 15:78940071-78940093 TTCGTTTTTGTGAAGTCTTGCGG - Intronic
1131356791 15:91752264-91752286 TGCTTCCTTTTGAATTCTGTTGG + Intergenic
1131896095 15:97031153-97031175 ATTGTCCTTTTGATGTCTGTGGG - Intergenic
1137468041 16:48729104-48729126 TTTGTCATAATGAAGTCTGTAGG - Intergenic
1148858002 17:50589612-50589634 TTCGTCCTTCTGAGGACTCTAGG + Intronic
1156455697 18:37292466-37292488 TTCAGCCTTGGGAAGACTGTGGG + Intronic
1157512346 18:48285876-48285898 TGCTTCCTTGTGAATTCTCTGGG + Intronic
1160439187 18:78876075-78876097 TTCTTCCTTGTGGTGTCTTTTGG - Intergenic
1162028071 19:7905367-7905389 TTCCTCCTTGGGGAGTCTCTTGG + Intronic
1166724194 19:45015788-45015810 TTCATCCTTGAGATGTCAGTTGG - Intronic
925102278 2:1257460-1257482 TTCGTCCCTGTGGCGTCTGCTGG - Intronic
926288661 2:11511142-11511164 TTCGTTCTTGTGAAGACTGCTGG - Intergenic
934497999 2:94827234-94827256 TTGGTCTTTGTGAATTCTGAAGG - Intergenic
937531379 2:122831598-122831620 TTCCTCCTTGTAAAGCCTGAGGG + Intergenic
938044134 2:128101206-128101228 TTCTTCCTTCTTATGTCTGTGGG + Intronic
940664646 2:156593544-156593566 TTCTTCCTTGAGCAGTCTGCTGG + Intronic
942322693 2:174749908-174749930 TGCCTCCGTGTGAAGTCTGCAGG + Intronic
1169104662 20:2984438-2984460 CTCATCCTTCTTAAGTCTGTAGG + Intronic
1171568193 20:26215676-26215698 TTACTCCTTATGAATTCTGTAGG - Intergenic
1179145803 21:38766373-38766395 TTGCTCCTTCTGAAGACTGTAGG - Intergenic
952121214 3:30246556-30246578 TTCTTCATTATGAAGTCTTTAGG - Intergenic
958602897 3:96321534-96321556 TTCTTCCTTATGATGTCTTTTGG - Intergenic
961454879 3:127019016-127019038 TTTGTCCTTGAGATGTCTATAGG + Intronic
961903216 3:130235189-130235211 TTGGTCCTTGTCGACTCTGTGGG - Intergenic
969903395 4:10370856-10370878 TTAGTCCTTCTGCAGTGTGTTGG + Intergenic
971477185 4:27083519-27083541 ATCCTCCTTCTGAAGTCTCTAGG + Intergenic
972795083 4:42407704-42407726 GTCGTCCCTGGGAAGACTGTGGG + Intergenic
975152872 4:71040172-71040194 TTAGTCCTTGTGAGATCTGATGG + Intergenic
975499600 4:75070076-75070098 TTCTGCCTTGTTAAGTATGTGGG - Intergenic
977275676 4:94975032-94975054 TTCGTCCTTGTGAAGTCTGTTGG - Intronic
978733445 4:112057984-112058006 TTTGCCCTTTTGAATTCTGTGGG - Intergenic
981220757 4:142230908-142230930 TTCCTCCTTGTGAATTTTTTTGG + Intronic
981976722 4:150738474-150738496 TTCATCCTTGTGAAGTATGTTGG - Intronic
987175595 5:15304901-15304923 TTCTTCCTTGTGTAATGTGTGGG + Intergenic
992132901 5:73712331-73712353 TTTGTCCTTGTGAATTGTGAGGG + Intronic
1001205949 5:169763356-169763378 GTCGTCCTTGTCATGTCTCTAGG - Intronic
1004983471 6:21052964-21052986 TTTTTCATTGTTAAGTCTGTAGG + Intronic
1010065820 6:71681318-71681340 TTTGACCTTGTGAAATCAGTTGG + Intergenic
1012101421 6:95091668-95091690 GTGGTCCTTTTGAAGTCTGATGG - Intergenic
1015261499 6:131242908-131242930 TTCCTTCTTGTGAAGGATGTTGG - Intronic
1020793099 7:12650693-12650715 CTCCTCCTTGTCAAGTGTGTGGG - Intronic
1021193891 7:17652902-17652924 TTTGTCCCTGTGAATTATGTGGG - Intergenic
1022254185 7:28639636-28639658 TAAGTCCTTGTGAGGTCTTTGGG - Intronic
1022845714 7:34207637-34207659 TTTGACCTTGAGAAGTCTGGAGG + Intergenic
1023887176 7:44367577-44367599 TTAGTCCTTGTAAAGACTGCAGG - Intergenic
1026570966 7:71530370-71530392 TTCGTCCTTTAAAAGTCTTTAGG - Intronic
1035664757 8:1372872-1372894 TTCTTCCTTGTGAAATCTTAGGG + Intergenic
1047180266 8:122581004-122581026 TGGTTCCTTGTGAAGTCTTTGGG - Intergenic
1047583035 8:126237861-126237883 TGAGTCCTTTTGAACTCTGTTGG - Intergenic
1051176320 9:14364285-14364307 TTTGGCTTTGTGAAGTTTGTTGG + Intronic
1051241383 9:15060335-15060357 TTCGTCATTTATAAGTCTGTTGG - Intergenic
1056508599 9:87281271-87281293 TTGGTCCTTCTGAAGGCTCTGGG - Intergenic
1056752976 9:89365002-89365024 TCCTTGCTCGTGAAGTCTGTTGG + Intronic
1059177052 9:112176716-112176738 TTTGAGCTTGTGATGTCTGTGGG + Intergenic
1059283831 9:113156189-113156211 TGGGTACTTGTGAAGGCTGTGGG - Intronic
1059894100 9:118840655-118840677 TTGTTCCTAGTGAAATCTGTTGG - Intergenic
1062464328 9:136674482-136674504 TCCATCCGTGTGAAGTCTCTTGG + Intronic
1062700236 9:137896931-137896953 ATTGTCCTTTTGATGTCTGTAGG + Intronic
1188968755 X:36586662-36586684 TTTGCCCTTTTGAAGTCTATAGG + Intergenic
1190397390 X:49998757-49998779 TTCCTATTTGTGGAGTCTGTGGG + Intronic
1192360511 X:70435813-70435835 TCCATCCTTATGAAGGCTGTGGG - Intergenic
1194755270 X:97731916-97731938 TTCGTCCTCCTTCAGTCTGTTGG - Intergenic
1194882907 X:99275214-99275236 TTCATGCTTGTGATGTTTGTTGG - Intergenic
1196388373 X:115184187-115184209 TTAGTCCTTGTGACGTCAGAAGG - Intronic
1196650990 X:118168103-118168125 TTCGGACAAGTGAAGTCTGTTGG + Intergenic
1199799395 X:151234574-151234596 TTCTTGGGTGTGAAGTCTGTTGG + Intergenic
1199945967 X:152667947-152667969 TCCCTCCTTGGGAAGGCTGTAGG - Intergenic