ID: 977285303

View in Genome Browser
Species Human (GRCh38)
Location 4:95098649-95098671
Sequence AAGCAGCAGCAGAATGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 361}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977285303 Original CRISPR AAGCAGCAGCAGAATGAACC TGG (reversed) Intronic
900376110 1:2355590-2355612 AAGCGGCAGCGGAATGCCCCTGG - Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
901110262 1:6787639-6787661 AAGCAGCAGCAGAAGAATCACGG + Intronic
902259694 1:15215302-15215324 AAGCAGCAGCAGCATCACCCCGG - Exonic
902515257 1:16986505-16986527 CAGCAGCAGCAGCTTGAAGCCGG + Exonic
902575996 1:17377995-17378017 CAGAAGCAGCAGGATGACCCAGG - Intronic
902610830 1:17596275-17596297 ACCCAGCAGCAGGCTGAACCTGG + Intronic
904946783 1:34205200-34205222 CAGAAGCAGCAGAAGGACCCTGG + Intronic
905933969 1:41809008-41809030 AAGCATCAGCTGTATGACCCTGG - Intronic
905943547 1:41883406-41883428 AAGCAGCATAAGAGTGAAACGGG + Intronic
906059330 1:42938185-42938207 AGGGAGCAGCTAAATGAACCAGG - Intronic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906606775 1:47178203-47178225 AGGCATCAGCACAATGGACCTGG - Intergenic
906706921 1:47901727-47901749 ACGGAGCAGCATAATTAACCAGG + Intronic
907609195 1:55850818-55850840 AACCAGCATCAGAATGATCGTGG + Intergenic
907835236 1:58102391-58102413 AAGCAGCTTCAGAGTGAAACTGG + Intronic
908392433 1:63695893-63695915 TAGAGGCAGCAGAAAGAACCAGG + Intergenic
909572097 1:77126026-77126048 AAACAGCAGCTGACTGAACTCGG - Intronic
909679185 1:78272465-78272487 ATGCAGCGGAAGAATGAAACTGG - Intergenic
910235197 1:85028404-85028426 AATCAGCAGAAGAATCATCCTGG - Intronic
911213749 1:95169247-95169269 AAGCAGCATCAGCATGACCTGGG - Intronic
911292971 1:96080476-96080498 AGGCAGCAGGAGAAAGAAGCAGG + Intergenic
911386406 1:97180636-97180658 AAGCAACATCAGAATTAATCTGG + Intronic
912145325 1:106786686-106786708 TAGCAGCAGCAGAAGGACACGGG - Intergenic
913397492 1:118388391-118388413 AAGCAGAAGCAGAATGACTCTGG + Intergenic
913404432 1:118473867-118473889 AAGAAGGACCAGAAAGAACCAGG - Intergenic
914753905 1:150552545-150552567 AAGCAGCAGCAGATACAGCCAGG - Exonic
915168307 1:153960765-153960787 AAGCAGCAGCAAAATGTTCAGGG + Intronic
915468729 1:156113516-156113538 AGCCAGCTGCAGAATGGACCTGG + Intronic
916787571 1:168097553-168097575 CAGCAGCAGCAGAATTGATCTGG - Intronic
918712785 1:187751757-187751779 AAGCAGGAGAAGAAAGACCCCGG + Intergenic
919756479 1:201069256-201069278 CAGCAGCAGCAGCATAAAGCAGG + Intronic
919917593 1:202148437-202148459 AAGCAGCAGCAGTAAGGACAAGG - Exonic
922481841 1:225944769-225944791 AAGCAGCAGCAGCAGGGGCCTGG - Intergenic
922673503 1:227532900-227532922 AAGAAGCAGCAGAAAGATCCTGG - Intergenic
922983365 1:229847578-229847600 CAGGAGCAGCAGAATGACCAAGG + Intergenic
923187944 1:231592084-231592106 AAAAAGCAGCAGAATGAATATGG - Intronic
923526110 1:234774040-234774062 AAGCAGCTGCAGAAGAGACCAGG + Intergenic
923683990 1:236141994-236142016 AATCAGCAGCAGAATGCGCGAGG + Intergenic
924351153 1:243115735-243115757 AAGCTGCAGCAGAGTGTGCCTGG - Intergenic
924426419 1:243954458-243954480 AAGCAGCAGCAGTAACAACGTGG - Intergenic
924597624 1:245461246-245461268 AAGCAGAAGCAGAATCAGTCTGG - Intronic
924674405 1:246160932-246160954 GAGCAGCAGCAGACAGAAGCTGG + Intronic
1063191178 10:3696355-3696377 CAGTAGCAACACAATGAACCCGG + Intergenic
1063413949 10:5858011-5858033 AACAACCAGCAGAAGGAACCGGG + Intergenic
1063482296 10:6386433-6386455 AAGCATCAGCAGGTTGAACAGGG + Intergenic
1063613827 10:7585451-7585473 GAGCTGCAGCAGAGTGAAACAGG - Intronic
1063944038 10:11159730-11159752 AGGCAAAAGCAGAAAGAACCTGG - Intronic
1064392968 10:14957468-14957490 TGGCTGCAGCAGAATGATCCGGG + Intergenic
1067837759 10:49652145-49652167 AAGGAGGAGCAGACTGAACTGGG + Intronic
1069725422 10:70574481-70574503 GTGCAGAGGCAGAATGAACCTGG + Intergenic
1070718898 10:78742949-78742971 CAGCAGCAGCAAAATAAACAAGG + Intergenic
1072568954 10:96641994-96642016 AAGCAGCAGCAACTTGGACCTGG - Intronic
1072608157 10:97000603-97000625 CTGTAGCAGCAGAATGAACCAGG + Exonic
1073398830 10:103240444-103240466 AAGGAGAAGCAGAGTGCACCAGG + Intergenic
1073580774 10:104663769-104663791 ATGCTGCTGCTGAATGAACCAGG + Intronic
1074157707 10:110812714-110812736 AAGCAGCAGCAGGATGCCCCCGG + Exonic
1075403430 10:122177635-122177657 GAGCAGCAGGAGAATGAAGCTGG + Intronic
1075610250 10:123848286-123848308 AAGGATCAGCAGATTGCACCTGG - Intronic
1076986246 11:237651-237673 AACCAGCTGCAGAATGAATAGGG - Intronic
1078132874 11:8627538-8627560 AAGCAGCAGTAGAAACAACTGGG - Intronic
1078236255 11:9487451-9487473 AGGCAGGAGAAGCATGAACCCGG - Intronic
1078650753 11:13189849-13189871 AATCAGAAGCAGAAGTAACCTGG + Intergenic
1079031412 11:16988947-16988969 AAGCAACAGCTGAATGAACTGGG - Intronic
1080140071 11:28906735-28906757 AAGCAGCATCATGATTAACCAGG + Intergenic
1080746781 11:35115492-35115514 AAGCAGCAGCAAAATGAGAGAGG + Intergenic
1084098378 11:66928447-66928469 TGGCAGCAGCAGAATGACCATGG + Intronic
1085295206 11:75427580-75427602 AAGGAGCAGGAGAATAAGCCAGG - Intronic
1086825136 11:91487073-91487095 AGACCGCAGCAGAATGAAACTGG - Intergenic
1089536307 11:119162478-119162500 AATCAGAAGCAGAATGAGCCTGG - Exonic
1091987075 12:4919289-4919311 AAGCAGAAACAGATAGAACCAGG + Intronic
1092146067 12:6215492-6215514 GACCAGCAGCAGGATGACCCAGG - Intronic
1092899076 12:13041565-13041587 AAGCAGCTGCCAAATGAATCAGG - Intergenic
1092899244 12:13043429-13043451 AAGCAGCTGCCAAATGAATCAGG - Intergenic
1094371584 12:29744245-29744267 AAGATGAAGCAGAATGAACCAGG + Intronic
1094732382 12:33192660-33192682 AATATGCAGCAGAATGAAACTGG - Intergenic
1095257847 12:40061181-40061203 AAGCAGCAGCATAAATAAGCTGG + Intronic
1096994635 12:55830947-55830969 AGGCAGCAACAGAGTGACCCTGG + Intergenic
1099777514 12:87151835-87151857 AAGAAGCAGCAGAAAGGCCCTGG - Intergenic
1100064246 12:90622057-90622079 AAGCAGCAGTAGAAAGAAAAAGG - Intergenic
1100088228 12:90937105-90937127 AAGAAGCAGCAGAAAGGCCCTGG - Intronic
1102990133 12:117309481-117309503 AAGCATCAGGAAAATGAAGCCGG + Intronic
1103843136 12:123881648-123881670 AAGCAACACCAAAATGAACTTGG + Exonic
1104021248 12:124993828-124993850 CAGCAGCAGCAGCAGGAGCCCGG - Exonic
1104023273 12:125008098-125008120 TAGCAGCAGCAGCATCACCCAGG - Intronic
1104349080 12:128029284-128029306 GAGGAGCAGCAGAATGGAGCAGG - Intergenic
1105606899 13:21933403-21933425 AAGCAGCTGCAGCCTGCACCAGG - Intergenic
1105723171 13:23135712-23135734 ATGCTGCAGCAGAATAAACAAGG + Intergenic
1105908151 13:24834659-24834681 AAGAAGCAGCAGAAAGGCCCTGG + Intronic
1107096022 13:36536675-36536697 AAGCACCAGCTGAATAAACAAGG + Intergenic
1107998061 13:45880481-45880503 AAGAAGCATCAGAATTAAACTGG + Intergenic
1108601214 13:51996775-51996797 AAGAAGCAGCAGGATAAAGCAGG - Intronic
1109767061 13:66915703-66915725 AAGCAGCAGCATAAGGTAGCTGG + Intronic
1109877262 13:68421692-68421714 AAAAAGCAGAAGAATGAACTTGG - Intergenic
1110852729 13:80263153-80263175 AAGAAGCAGCAGAAAGGCCCTGG - Intergenic
1111276200 13:85950632-85950654 AAGGAGGAGAAGAATGAAGCTGG - Intergenic
1111423913 13:88054205-88054227 AACCAGAAGAAGAATGAAACTGG - Intergenic
1112029971 13:95447963-95447985 AAGCAGAGGCAGAAAGAGCCTGG - Intronic
1113785037 13:112997962-112997984 CAGCAGCAGCTGTATGAAGCCGG + Intronic
1114650619 14:24282219-24282241 AAGCAGAAGCAGCATGATGCAGG + Intergenic
1114860725 14:26517228-26517250 TAGCAGCAGCAGAATGAGCAAGG - Intronic
1115594295 14:34894261-34894283 AAACAGCAGCAAAATCAAACTGG + Intergenic
1115833112 14:37364024-37364046 AAGCAGTAACAGACTGTACCTGG - Intronic
1116181079 14:41536648-41536670 ATGAAGCAGAAGAATGAAACTGG - Intergenic
1117068766 14:52036994-52037016 AAGCAACAGCAAAATAAACTGGG - Intronic
1118546550 14:66895884-66895906 TTACAGCAGCAGAATGGACCAGG - Intronic
1119433085 14:74581065-74581087 GAGCAGAAGCAGGATGAACACGG + Intronic
1119464403 14:74843683-74843705 CAGCAGAAGCAGAATAAAACAGG + Intronic
1120434688 14:84466423-84466445 AAGCAGCAGCTGCATTAACTGGG + Intergenic
1121459754 14:94065824-94065846 AAGAAGCAGCAGAAAGGCCCTGG + Intronic
1124214826 15:27797717-27797739 TATCAGCAGCAGACAGAACCAGG + Intronic
1125795793 15:42403095-42403117 CAGGAGCAGCAGAAGGACCCTGG - Intronic
1125990093 15:44098001-44098023 GACCTGCAGCAGCATGAACCTGG + Intronic
1125990208 15:44099344-44099366 AAGCAGCAGCAGCATTACCTGGG - Intronic
1127215501 15:56819395-56819417 AAGCAGCAGCAGGAGCAACAGGG - Intronic
1127586330 15:60381680-60381702 AAGGAGCAGCAGAACTTACCGGG + Intronic
1129098317 15:73233193-73233215 CAGCAGCAATAGAATCAACCTGG + Intronic
1129866457 15:78912727-78912749 AAGCACCACTACAATGAACCAGG - Intergenic
1129977706 15:79836257-79836279 AAGCAGCAGCAGCAGCACCCAGG + Intronic
1130821761 15:87503323-87503345 AGGCAGCAGCAGAGGGACCCTGG + Intergenic
1131412352 15:92220478-92220500 AGGCAGGAGAAGCATGAACCCGG - Intergenic
1132714970 16:1285715-1285737 GAGCAGCGGGAGAAAGAACCGGG + Intergenic
1132784563 16:1648663-1648685 GGGCGGCAGCAGAAGGAACCAGG - Intronic
1133456839 16:5949729-5949751 CAGCAGCAGCAGCATCAACTAGG + Intergenic
1133621492 16:7530923-7530945 CAGCAGCAGCAGAATGTACCTGG + Intronic
1133883013 16:9800740-9800762 AAGCAGCAGCAGAAGAGAACTGG + Intronic
1133893188 16:9901118-9901140 AAGCAGCAGAAGGAAAAACCAGG - Intronic
1135074941 16:19384979-19385001 CAGGAGCAGAAGAATGAACCAGG + Intergenic
1136749357 16:32619235-32619257 CAGCAGCACCAAAATGAGCCTGG + Intergenic
1137303119 16:47172961-47172983 AAGTTGCAGCAGAATGAAAGAGG - Intronic
1138035757 16:53604283-53604305 AAGCAGCTTGACAATGAACCAGG + Intronic
1138059233 16:53872227-53872249 AAGAAGCACCAGAATGCAGCAGG - Intronic
1141495815 16:84408669-84408691 AAGCAGTGGCCGAATAAACCAGG - Intronic
1203051489 16_KI270728v1_random:878449-878471 CAGCAGCACCAAAATGAGCCTGG + Intergenic
1142790800 17:2264110-2264132 TAGCAGCTGCAGATTGAACAAGG + Intronic
1143850313 17:9806364-9806386 AAGCACAAACAGAATGAACTTGG + Intronic
1143964522 17:10747482-10747504 AAGCAGCAGCAGAGGGAGCGAGG - Intergenic
1144132205 17:12257272-12257294 AAGCAGCAGCAGCAAGATCAGGG + Intergenic
1145898418 17:28474196-28474218 AAGCAGCAGCAGAGTGAAGAGGG + Intronic
1146352262 17:32104580-32104602 AAGAAGCAGCTAGATGAACCTGG + Intergenic
1146703093 17:34979450-34979472 AATGCGCAGCAGAATGAACCAGG - Intronic
1146890212 17:36501928-36501950 AAACAGCAGCAAAATCAACCAGG + Intronic
1149781842 17:59403755-59403777 AAGCAGCACCAGAATTAACATGG - Intergenic
1149869767 17:60170918-60170940 AAGAAGCAGCTGGATGAACCTGG + Intergenic
1150318895 17:64193257-64193279 AAGCAGCAACAGAAAAACCCTGG - Intronic
1150484123 17:65532421-65532443 AAGCAGCAGCAGCAGCAGCCAGG + Intronic
1150926313 17:69535685-69535707 AAACAGAAGCAAAAAGAACCAGG + Intronic
1151197691 17:72443524-72443546 AGGCAACAGCAGAAGGAACTGGG + Intergenic
1152089772 17:78240080-78240102 AAGCAGCAGCAGCCTGTGCCAGG - Exonic
1153101310 18:1473144-1473166 AAGTAGCAGCAGCCTGAGCCAGG - Intergenic
1153414021 18:4825461-4825483 AAGCAGCAGCAGCAGGAAGAGGG - Intergenic
1153741288 18:8131338-8131360 AAGCAGCATCAGCATGACCCAGG + Intronic
1156072986 18:33236506-33236528 AAGAAGCAACAGAAAGAAACTGG - Intronic
1156235530 18:35200036-35200058 AAGTAACAGAAGAATAAACCTGG + Intergenic
1158206204 18:54995921-54995943 AAGAAGCAGCAGAATGGATCTGG - Intergenic
1158888808 18:61854072-61854094 AAGCAGTGGCAGAAAGAACGTGG - Intronic
1159783786 18:72690745-72690767 AAGTAGAAGCAGAAGGAAGCAGG + Intergenic
1162818381 19:13209160-13209182 AGGCAGCAGCTGCAGGAACCTGG - Intronic
1162943454 19:14028209-14028231 GAGCAGCAGCAGCATGTACCTGG - Exonic
1163242785 19:16074708-16074730 AGGAAGCAGGAGAATGAAGCTGG + Intronic
1163262876 19:16201819-16201841 AGGCTGGAGCAGAGTGAACCAGG + Intronic
1166705530 19:44905983-44906005 AAGCAGCAGGGGACTGGACCTGG + Intronic
1166863803 19:45824261-45824283 AAGCAGCAGCAGGTGGAGCCTGG - Intronic
1166869241 19:45861276-45861298 AAGCAGAAGAAGAATGAAACAGG - Intronic
1167034374 19:46985407-46985429 AAGCAGCAGAAGCTTGAGCCAGG + Intronic
1167687701 19:50967029-50967051 AAGCAACAGCCGAATGCACCTGG + Intronic
1168606380 19:57763377-57763399 ATGCACCAGGTGAATGAACCTGG + Intergenic
925733561 2:6941379-6941401 AAGCAGCAAATGAATAAACCTGG - Intronic
925919818 2:8631118-8631140 AAGCAGGAGCACCAGGAACCTGG + Intergenic
926145429 2:10394329-10394351 AACCAGCAGCAGAATGTACCAGG - Intronic
926596241 2:14792087-14792109 AGGCAGCAACAGCAGGAACCAGG + Intergenic
927257913 2:21056424-21056446 CAGCAGCAGCAGAATAACCCAGG + Intergenic
927944764 2:27129031-27129053 AAGCAGCAGCACAATGGGCTGGG - Exonic
928196597 2:29220757-29220779 GAGCTCCAGCAGGATGAACCGGG + Exonic
928727236 2:34188734-34188756 AAACAGTAGAAGAGTGAACCTGG - Intergenic
928861083 2:35857643-35857665 AAGCAGCAGCTAAATGAGGCGGG - Intergenic
930075260 2:47401160-47401182 ATTCAGCAGCAGAATCACCCTGG - Intergenic
930837067 2:55805692-55805714 AAGCAGCAGCAGAATTAACATGG - Intergenic
931243273 2:60471384-60471406 AAGAAGCAGCAGAATCAGCTGGG - Intronic
931244157 2:60478821-60478843 AAGCAGCTGCAGCATGCCCCGGG - Intronic
931302711 2:60996616-60996638 AAGCAACAGCAGCATGAAGCAGG + Intronic
931867314 2:66426465-66426487 AAGCAGCAGAAGACAGAAGCCGG + Intergenic
932475775 2:72004937-72004959 AAGCAGCAGCTGTGGGAACCAGG + Intergenic
932658659 2:73632764-73632786 AAGCAGTAGCAGCAGCAACCAGG + Intergenic
932665263 2:73692711-73692733 AAGCAGTAGCAGCAGCAACCAGG + Intergenic
936489934 2:112961271-112961293 AGGCAGCATCAGAATGACGCTGG - Intergenic
937248414 2:120508951-120508973 ACAAAGCAGCAGAAGGAACCTGG + Intergenic
937248644 2:120510084-120510106 AAGCAGCAGCAAGCTGGACCGGG + Intergenic
938088439 2:128417034-128417056 AGGAAGCAGCTGAAGGAACCTGG + Intergenic
938598368 2:132811936-132811958 AAGAAGCAGCAGAAAGGCCCTGG - Intronic
939014467 2:136886107-136886129 ATGCAGGAGCAGAGTGAACATGG + Intronic
939691371 2:145265953-145265975 AGGCAGAAGCAGAATGATCTGGG + Intergenic
940185770 2:150983674-150983696 AAGAAACAGTAGAATGTACCTGG - Intergenic
940431256 2:153592905-153592927 AAGAAGCAGCAGAAAGGCCCTGG + Intergenic
940945871 2:159616462-159616484 ATCCAGCAGCAGATTGAAGCAGG + Exonic
942073368 2:172335221-172335243 AGGCAGCAGCAGGCTGCACCAGG + Intergenic
942228098 2:173834569-173834591 GAGCAGGAGCAGAATGAAAATGG + Intergenic
942533966 2:176943636-176943658 AAGCAGCAGCTGAGAGAACTTGG + Intergenic
943621245 2:190150381-190150403 AGGAAGCAGCAGAAAGGACCTGG - Intronic
944455026 2:199884400-199884422 AAACAGCAGAAGAGTGAATCAGG + Intergenic
945825539 2:214716662-214716684 AGGAAGCAGCAGAAAGACCCTGG + Intergenic
945981237 2:216313076-216313098 AAGGTGCAGAAGAATGAAACTGG - Intronic
946246677 2:218391716-218391738 AAGCAGGAGAAGCTTGAACCTGG - Intronic
946456307 2:219829330-219829352 AAAGAGCTGCAGAATGAAACAGG + Intergenic
948044407 2:234932488-234932510 AAGCAGCATCAGAAAGCACAAGG - Intergenic
948428487 2:237902991-237903013 AAGCAGCAGCAGGTTAGACCAGG - Intronic
1169102606 20:2964285-2964307 GAGCAGAACAAGAATGAACCAGG - Exonic
1169338063 20:4773706-4773728 AAGAAGCATCAGAATCACCCAGG - Intergenic
1170034424 20:11975069-11975091 AGACAGCAGCATAATGAAGCTGG + Intergenic
1170375922 20:15699919-15699941 AAGAAGCAGCAGAAAGGCCCTGG - Intronic
1170742992 20:19074084-19074106 TAGCAGCATAAGAATGCACCAGG + Intergenic
1170781326 20:19428148-19428170 CAGTAGCAGCAGCATGAGCCCGG + Intronic
1171178855 20:23076744-23076766 CAGATGCAGCAGAATGAATCGGG + Intergenic
1171242460 20:23582537-23582559 AGGAAGCAGCAGAAAGACCCTGG - Intergenic
1172372231 20:34403142-34403164 AATAAGCAGAATAATGAACCAGG - Intronic
1173904938 20:46619718-46619740 AAGAAGCAGAAGAATGTTCCTGG - Intronic
1173963019 20:47089576-47089598 AAGCAGCATCAGAATCACCTGGG + Intronic
1174085207 20:48003079-48003101 AAGAAGCAGCACAATGCAACAGG - Intergenic
1174529145 20:51197211-51197233 CAGCAGCACCAGAATGACTCAGG + Intergenic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1175280367 20:57800195-57800217 AAGCAGCCACAGAATCATCCTGG - Intergenic
1175520533 20:59599878-59599900 AGGAAGCAGCAGGATGGACCAGG - Intronic
1177627933 21:23688853-23688875 AAGAGGCAGCAGAATGTACGTGG - Intergenic
1178320595 21:31602255-31602277 CAGCAGCAGCAGAAGAAAACTGG + Intergenic
1179356766 21:40667066-40667088 AAGAAGCAGCAGACTTATCCAGG + Intronic
1179576149 21:42309754-42309776 ACGCAGCCCCAGAATGACCCTGG - Intergenic
1179974882 21:44859063-44859085 CAGCAGCACCAGAAGGACCCAGG + Intronic
1180030910 21:45206960-45206982 CAGCAGCAGCAGAGAGAGCCTGG + Intronic
1180847732 22:18993417-18993439 AAGCAGGAGAAGAATGAGGCTGG - Intergenic
1182148058 22:28009547-28009569 CAGAAGCAGGAGAATGATCCAGG + Intronic
1182183547 22:28376888-28376910 AAGAAGCACCAGAAAGAAACAGG + Intronic
1182659582 22:31915800-31915822 AAGAAACAGCAGGTTGAACCTGG - Intergenic
1184522678 22:45004701-45004723 AAGCAGCCACTGAATGAAGCTGG - Intronic
1184713924 22:46269486-46269508 AGGCAGAACCAGGATGAACCTGG + Intronic
1184732710 22:46379645-46379667 AAGCAGGAGAAGAATGAGGCTGG + Intronic
1184948604 22:47822742-47822764 AGGCAGGAGCAGACTGAAACTGG + Intergenic
950446645 3:13042590-13042612 AGACAGCAGCAGCATGAGCCGGG - Intronic
950569153 3:13789289-13789311 AAGCAGCAGCAGGATGCAAGTGG + Intergenic
951505128 3:23436312-23436334 ATGGAACAGCAGAATGAACCTGG - Intronic
951589923 3:24253484-24253506 AAGCAGCAGCAAAGTGCACTGGG + Intronic
952157167 3:30655910-30655932 CAGCAGCAGCAGGATCACCCGGG + Intronic
952702339 3:36340584-36340606 AGGCTGCAGCAGCTTGAACCTGG - Intergenic
952866295 3:37857447-37857469 AAGGAGCAGCAGCATGTTCCAGG - Intergenic
956423865 3:69112729-69112751 AAGCAGCAGCAGCATTACCAGGG + Intronic
957917889 3:86709256-86709278 AAGCTGAACCAGAATGTACCTGG - Intergenic
958171664 3:89947104-89947126 GAGCAGCAGCAGGAAGATCCTGG + Intergenic
959463638 3:106657746-106657768 AAGCCACAGAAGAATGAAACTGG + Intergenic
959563162 3:107805677-107805699 GAGCAGAAACAGAATGATCCTGG + Exonic
959664856 3:108909637-108909659 AGGCAGCATCTGAAAGAACCGGG + Intronic
959985391 3:112565677-112565699 CTGAAGCAGGAGAATGAACCCGG + Intronic
960157522 3:114311036-114311058 AAGCAGCACCTGAAAGAATCAGG - Intergenic
960459182 3:117912470-117912492 ATGCAGCAGCAGCATCAACAAGG + Intergenic
961999987 3:131285667-131285689 AAGAAGCAGAAGAATGACTCAGG - Intronic
962753087 3:138449046-138449068 AGGCAGCAACAGAATGACCAAGG - Intronic
964172368 3:153785927-153785949 AAGGAGGAGCAGAATAAACTGGG + Intergenic
964546831 3:157843566-157843588 CAGCAGCAGCAAAATGAGCAAGG + Intergenic
964601356 3:158504039-158504061 AAGAAGCAGCAGAAAGGCCCTGG - Intronic
965724580 3:171700687-171700709 AAGCAGCATCTGAGGGAACCTGG + Intronic
965795155 3:172432021-172432043 AATCAGCAGCAGCATGAAAACGG - Intergenic
966020525 3:175203305-175203327 AGGAAGCAGCAGAAGGACCCTGG - Intronic
966037812 3:175441581-175441603 AAGCAGCATCTGCATGAACTAGG - Intronic
966448955 3:180036590-180036612 AAACCGAAGCAGAATGTACCAGG - Exonic
966728811 3:183133228-183133250 AAGCAGCATCAGAATTCCCCTGG - Intronic
967826962 3:193884746-193884768 AAGCAGCAGCAGAGTCAGCTGGG + Intergenic
967830327 3:193913038-193913060 AAGCAGAAGCTGAAAGATCCAGG - Intergenic
968276667 3:197445632-197445654 AAGGAGCAGAAGAAGGAACAGGG - Intergenic
969854895 4:9991173-9991195 AAGCAGCAGGGGAAGGAGCCAGG - Intronic
970574113 4:17411218-17411240 AAGCAGCAGCAGCCTGATGCAGG + Intergenic
971516308 4:27490941-27490963 CAGCAGCAGCATCAGGAACCAGG - Intergenic
971977764 4:33712352-33712374 AAGCAGCAGCAGAGTTATACAGG - Intergenic
972239167 4:37171242-37171264 AAGCAGCAGCAGTATTACCTGGG + Intergenic
973880711 4:55268852-55268874 ATACAGCAGCAGAAAGATCCAGG + Intergenic
974309621 4:60187954-60187976 AACCAGCAGCAGCATTACCCAGG + Intergenic
974841962 4:67309136-67309158 GAGCTGCTGCAGAAAGAACCAGG - Intergenic
975751125 4:77524610-77524632 AAGCTGCAACAGACTGTACCTGG - Intronic
976436109 4:85019998-85020020 AGGCAGTAGCAGATGGAACCAGG + Intergenic
976462471 4:85328311-85328333 CAGTAGCAGCAGAATGGACTGGG - Intergenic
976621246 4:87129762-87129784 TACCAGTAGCAGAATGAACTAGG - Intronic
976758951 4:88527759-88527781 AACCGGCAGCAGAATGAACAAGG - Intronic
977285303 4:95098649-95098671 AAGCAGCAGCAGAATGAACCTGG - Intronic
977296218 4:95212592-95212614 ATGCAGAAGCAGAAAGAACTGGG - Intronic
977456098 4:97261515-97261537 AAGAAGCCTCAGAATGAAACAGG + Intronic
978676307 4:111322566-111322588 AGAGAGCAGCAGAATAAACCGGG + Intergenic
979250787 4:118564803-118564825 AAGCTGCAGCAGAGTGTGCCTGG + Intergenic
981346537 4:143683497-143683519 AAGAAGCAGCAGAAAGGCCCTGG + Intronic
981671094 4:147287773-147287795 CAGCAGCAGCAGCATGACCTGGG + Intergenic
982636775 4:157906837-157906859 CAGCAAGAGAAGAATGAACCAGG + Intergenic
983033332 4:162830737-162830759 AAGCATTAGCAGAATGAAAATGG + Intergenic
984468863 4:180139452-180139474 AAGACACAGCAGAATGAACAAGG + Intergenic
984473863 4:180213045-180213067 CAGCAGCAGCAGAATAAAAGAGG - Intergenic
985075944 4:186214701-186214723 AGCCAGCAGGAAAATGAACCTGG - Intronic
988908662 5:35816944-35816966 AATCATCATCAGAATGAAGCAGG + Intergenic
989710177 5:44388612-44388634 AAGCAGCAGCAGCAGCAGCCGGG + Exonic
990338142 5:54795088-54795110 AACCAGCAGTAGAAAGAAGCAGG - Intergenic
990995904 5:61732004-61732026 AGGAAGCCTCAGAATGAACCAGG - Intronic
991414516 5:66378893-66378915 AAGGAGCAGCAGGAAGAGCCTGG + Intergenic
991640730 5:68749268-68749290 AAGCAGCAGCAAGAGGAATCTGG - Intergenic
993021536 5:82597533-82597555 AAGCAGCAGCAGGATTAAAGAGG + Intergenic
994042703 5:95276195-95276217 AAGAGGCAACAGAATGAACCAGG + Intronic
994349439 5:98727521-98727543 AGGCAGCAGCAGAGTGATCCAGG - Intergenic
995271151 5:110220662-110220684 AGGCAGCAGCAGAAAAGACCAGG + Intergenic
996010655 5:118478671-118478693 AGGAAGCAGCAGAAAGACCCTGG + Intergenic
996242372 5:121220285-121220307 ACACAGCAGAAGAATGAAACTGG + Intergenic
996308329 5:122076810-122076832 AAGCAGTAGCAGTCAGAACCAGG + Intronic
996400361 5:123055376-123055398 AGGCCTCAGCAGAATGAACAAGG + Intergenic
997246490 5:132354346-132354368 AAGCAGGAGAAAAATGAAGCAGG - Intergenic
997702227 5:135910872-135910894 AGGCAGGAGAAGAATGAACCAGG + Intergenic
998835224 5:146196795-146196817 GGGCTGGAGCAGAATGAACCAGG - Intergenic
998940747 5:147280086-147280108 AAGAAGCAGCAGAAAGGCCCTGG + Intronic
1000518686 5:162273106-162273128 GAGCAGAAACAGAATTAACCTGG + Intergenic
1000527385 5:162374646-162374668 AAGCAGCTGTAGAATGTAACTGG - Intergenic
1000554287 5:162705667-162705689 AAGCAGCATCAGCATGACCTTGG + Intergenic
1001291484 5:170465908-170465930 AAGCAGCAGGAGAATCCAACAGG + Intronic
1001313641 5:170628022-170628044 AAGCAGGAGCAGAAGGAAGAGGG - Intronic
1001393391 5:171398950-171398972 AAGCTGAAGCAGGAGGAACCAGG - Intronic
1001794619 5:174491645-174491667 AAAGAGGAGCAGAAAGAACCGGG - Intergenic
1002617291 5:180463872-180463894 ATGCAGCAGCAGGATGGGCCTGG - Intergenic
1003101057 6:3176957-3176979 CAGCAGCTGCACAAAGAACCAGG - Intergenic
1003127347 6:3365823-3365845 CAGCAGCAGCAGAAGGAAAAAGG + Intronic
1003340714 6:5217868-5217890 AAGGAGAAGCAGACTGAGCCAGG + Intronic
1003712020 6:8602867-8602889 AGGAAGCAGCAGAAAGACCCTGG - Intergenic
1007946250 6:45829655-45829677 AAGCAGCTGCAGGACAAACCAGG + Intergenic
1008140867 6:47830622-47830644 AATAAGTAGCAGAATGAACCAGG + Intronic
1010769631 6:79813387-79813409 GAGCAGCAGGAGGATGAATCAGG - Intergenic
1013852732 6:114535096-114535118 AGGAAGCAGCAGAAAGACCCGGG - Intergenic
1014618614 6:123636898-123636920 AAGAAGCAGCAGAAACAGCCAGG - Exonic
1015169220 6:130232415-130232437 AAGGAGCAGAAAAATGAAACAGG - Intronic
1016099688 6:140083558-140083580 AAGCAGCAGCATAGTAAAACAGG + Intergenic
1018290461 6:162287907-162287929 ACCCAGCAGCAGATGGAACCTGG + Intronic
1019030670 6:169008140-169008162 AAGCAGAGGCAGAACGAAGCAGG + Intergenic
1021939520 7:25665873-25665895 AAGCAAGAGGAGAATGAGCCAGG + Intergenic
1023097155 7:36672976-36672998 AAGCAGAAGAAGGATGAACACGG + Intronic
1023835712 7:44066086-44066108 CAGCAGCAGCAGAATGGGCAAGG + Intronic
1024245236 7:47464657-47464679 CAGCAGCATCAGCATAAACCTGG - Intronic
1024254066 7:47526834-47526856 AACCAGCAGCACAGAGAACCTGG - Intronic
1024560199 7:50638048-50638070 CATAAGCAGAAGAATGAACCTGG + Intronic
1024764799 7:52645025-52645047 AACCACCATCAGAATGAACAGGG - Intergenic
1025097532 7:56107950-56107972 CAGCAACAGCAGAATGTACTTGG + Intergenic
1029207368 7:98878000-98878022 AAGCAGCTGCAGAATCAATGGGG + Intronic
1029547322 7:101217230-101217252 CGGCAGCAGCAGCAGGAACCGGG + Exonic
1029665571 7:101992948-101992970 GACCAGCAGCAGAATGACCAGGG - Intronic
1030153528 7:106429044-106429066 AAGAAGCAGGAGTATGGACCAGG - Intergenic
1031188642 7:118517419-118517441 AAGCAGCAGATAAATGAAGCAGG + Intergenic
1031761345 7:125716478-125716500 AGGAAGCAGCAGAAAGACCCTGG - Intergenic
1032686452 7:134239191-134239213 AAGCCCCAGCAAGATGAACCTGG - Intronic
1033280924 7:140005901-140005923 CAGCAGCAGCAGCATCACCCGGG - Intronic
1035279746 7:157770098-157770120 AAGCAGAAGCAGCATTCACCGGG - Intronic
1038018248 8:23532567-23532589 AAGCAGGGGCAGAAGGAAACAGG + Intronic
1038052986 8:23830872-23830894 AAGCAGCAGGAGCAAGAACAAGG + Intergenic
1039648523 8:39314661-39314683 AAGCACCAGAAGAAGGAACATGG - Intergenic
1039799424 8:40941546-40941568 GAGAATCAGGAGAATGAACCTGG - Intergenic
1039805491 8:40994224-40994246 AAGAAGAAGAAGAAGGAACCGGG - Intergenic
1039972696 8:42333766-42333788 AAGCGGCAGCAATATGACCCAGG - Intergenic
1042798754 8:72693752-72693774 AAGCAGAAAGAGAAAGAACCAGG + Intronic
1043411612 8:80003612-80003634 AAGCACCAGTGAAATGAACCCGG - Intronic
1043808717 8:84706672-84706694 AAGGAGCAGCACAATTACCCTGG + Intronic
1044015970 8:87049141-87049163 AATCAGCAGCAAAAAGACCCAGG - Intronic
1044821735 8:96159957-96159979 AGGCAGCAGGCGGATGAACCCGG - Intronic
1046020720 8:108661564-108661586 ATGGAGCAGCAGCTTGAACCAGG + Intronic
1047391065 8:124451683-124451705 AGGCAGCACCAGCATGAACTAGG - Exonic
1047412420 8:124634770-124634792 CAGCAGCAGCAGAATCACCTGGG + Intronic
1047522547 8:125606365-125606387 AGGCAGGGGGAGAATGAACCAGG - Intergenic
1047975405 8:130125117-130125139 GAGCAGAACCTGAATGAACCTGG - Intronic
1050502582 9:6314780-6314802 AAGAAGCAGCAGAAAGGCCCTGG + Intergenic
1050559689 9:6821939-6821961 AAGCAGCAGCAGAATAAAAGAGG - Intronic
1051109367 9:13617914-13617936 GAGCAGCAGCACAAGGAACTGGG + Intergenic
1051637350 9:19192953-19192975 TAGCAGCAGCAGAAGGGCCCAGG - Intergenic
1051743258 9:20271425-20271447 AAGCAGCAGCAGCATATATCTGG - Intergenic
1052213482 9:25935914-25935936 AAGCAGCAGCACAGGGAAGCAGG + Intergenic
1052269687 9:26614600-26614622 AAGCAGCAGCACTAGGAAACAGG + Intergenic
1054776757 9:69130534-69130556 CAGCAGCAGCAGCATGACCTGGG - Intronic
1055948848 9:81712226-81712248 AAGCAGCATCAGAATGTACAAGG - Intergenic
1056711379 9:88994514-88994536 AAGCAGCAGCAGAATGGAGAAGG + Exonic
1059981379 9:119775887-119775909 GAGGAGCAGGAGAAAGAACCTGG - Intergenic
1060035640 9:120253243-120253265 AAGCAGCATCAGCATCAACTGGG + Intergenic
1060165579 9:121411673-121411695 AAGCATCAGCAGAATCAAGTGGG - Intergenic
1060531585 9:124350099-124350121 CAGCAGCAGCAGCAGGAAGCTGG - Intronic
1060781637 9:126417408-126417430 AATCAGCAGCAGCAGCAACCAGG - Intronic
1187038399 X:15566657-15566679 AAACAGCAGGAGAATCAACAAGG + Intronic
1187773713 X:22731002-22731024 AAGAAGCAGCAGAAAGGACCTGG - Intergenic
1187839430 X:23471517-23471539 AAGTAGTAACAGAATGAAGCAGG + Intergenic
1190074924 X:47309969-47309991 CAGCAGCACCAGATGGAACCAGG - Intergenic
1190443200 X:50496208-50496230 AAGCAGCAGCAGCATCATCTGGG + Intergenic
1191110807 X:56802177-56802199 AATCAACAGCATAATGACCCAGG - Intergenic
1191616580 X:63176355-63176377 GAGCAGCAGCAGGAAGACCCTGG + Intergenic
1191619717 X:63202568-63202590 GAGCAGCAGCAGGAAGACCCTGG - Intergenic
1191880884 X:65842936-65842958 AAGCAGCAGAAAAATCTACCTGG - Intergenic
1192995239 X:76505951-76505973 AAGGAGCAGCAGAAAGGTCCTGG - Intergenic
1193253484 X:79319975-79319997 AAGAAGCAGCAGAAAGGCCCTGG - Intergenic
1194311243 X:92310080-92310102 AAACAGCAACAGAGTGAAGCAGG - Intronic
1194927009 X:99837018-99837040 AGGAAGCAGCAGAAGGACCCTGG - Intergenic
1195574717 X:106437030-106437052 TTGTAGCAGCAGAAAGAACCGGG - Intergenic
1195909407 X:109874723-109874745 AAGGACCAGCAGAATGACTCAGG + Intergenic
1197067090 X:122246281-122246303 AACTAGCAGCAGAATGAATCAGG + Intergenic
1198371617 X:135995026-135995048 AACTAGCAGCAAAATGATCCAGG + Intronic
1200414214 Y:2890905-2890927 AAGCAGCAGAAGAAAGAATGAGG + Intronic
1200619519 Y:5424368-5424390 AAACAGCAACAGAGTGAAGCAGG - Intronic
1201416303 Y:13752029-13752051 CCGCAGCACCAGAAAGAACCCGG - Intergenic