ID: 977295293

View in Genome Browser
Species Human (GRCh38)
Location 4:95202781-95202803
Sequence GCCCCTGTGCTGCTCCTCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 242}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977295293_977295300 20 Left 977295293 4:95202781-95202803 CCAGCGAGGAGCAGCACAGGGGC 0: 1
1: 0
2: 0
3: 26
4: 242
Right 977295300 4:95202824-95202846 GCGCTTCGCAGCCGCTTTGGTGG 0: 1
1: 0
2: 0
3: 3
4: 28
977295293_977295295 -2 Left 977295293 4:95202781-95202803 CCAGCGAGGAGCAGCACAGGGGC 0: 1
1: 0
2: 0
3: 26
4: 242
Right 977295295 4:95202802-95202824 GCCCAAAGATGGCCAGCTTGAGG 0: 1
1: 0
2: 1
3: 14
4: 141
977295293_977295301 23 Left 977295293 4:95202781-95202803 CCAGCGAGGAGCAGCACAGGGGC 0: 1
1: 0
2: 0
3: 26
4: 242
Right 977295301 4:95202827-95202849 CTTCGCAGCCGCTTTGGTGGTGG 0: 1
1: 0
2: 0
3: 3
4: 58
977295293_977295299 17 Left 977295293 4:95202781-95202803 CCAGCGAGGAGCAGCACAGGGGC 0: 1
1: 0
2: 0
3: 26
4: 242
Right 977295299 4:95202821-95202843 GAGGCGCTTCGCAGCCGCTTTGG 0: 1
1: 0
2: 0
3: 2
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977295293 Original CRISPR GCCCCTGTGCTGCTCCTCGC TGG (reversed) Exonic
900164341 1:1238763-1238785 GCCCCTCTGCTGTCCCTGGCAGG + Intergenic
900472313 1:2860995-2861017 GCCTCTGTGCTGCTTCCCTCTGG + Intergenic
902024235 1:13371133-13371155 GCCCCTGTCCTGCTCCCCAGAGG - Exonic
902336977 1:15759328-15759350 GTCCCGGGGCTGCTCCTCTCTGG + Intronic
902549751 1:17212256-17212278 GCACCTGTGGGGCTCCTGGCAGG + Intronic
905926285 1:41752229-41752251 ACCTCTGTGCTGCACCTCCCTGG + Intronic
906649528 1:47502952-47502974 GCCCCTGACCTGCCCTTCGCTGG + Intergenic
910935087 1:92480821-92480843 GCCCCTGCGCTGCAGCTCCCTGG + Exonic
915087574 1:153398546-153398568 GCCTCTGTGCAGCTCCTCTCTGG + Intergenic
916440431 1:164819579-164819601 TCCCAGGTGCTGCTCCTCACAGG + Intronic
1070400699 10:76051059-76051081 GCCCCAGGGCTGCTCCATGCAGG - Intronic
1070698916 10:78584678-78584700 GCCCCTGTGCTCACCCTCCCTGG + Intergenic
1071672277 10:87619672-87619694 GCCGATGTGCTGCTCTTCTCAGG + Intergenic
1072750480 10:97975084-97975106 GCCCCTCCGCCGCTCCTCCCGGG - Intronic
1074818681 10:117163465-117163487 GCCCACGTGCTGGTCCACGCCGG - Intergenic
1075020554 10:118948959-118948981 ACCCCTGAGCTGATCCTGGCAGG - Intergenic
1075210977 10:120490772-120490794 CCACCTGTGCTGCTGCTCACTGG + Intronic
1076712865 10:132348191-132348213 GCGCCTGATCTCCTCCTCGCTGG - Exonic
1077265765 11:1648722-1648744 GCCCTTCTGCTGCTCACCGCGGG + Intergenic
1077543543 11:3159002-3159024 GTCGTGGTGCTGCTCCTCGCTGG - Intronic
1077564749 11:3290487-3290509 GCCTCTGTGTGGCTCTTCGCTGG + Intergenic
1077570639 11:3336304-3336326 GCCTCTGTGTGGCTCTTCGCTGG + Intergenic
1077917733 11:6622199-6622221 GCCACGGAGCTCCTCCTCGCCGG + Exonic
1080034818 11:27700252-27700274 GTCGCGGTGCTGCTCCCCGCCGG + Intronic
1081799504 11:45848016-45848038 GCCCCTGTTCTGCCACTCACTGG - Intronic
1083292193 11:61696425-61696447 GCCCCACTGCTCCTCCCCGCTGG - Intronic
1083487807 11:62994577-62994599 GCCGCTGCCCTGCTCCTGGCAGG - Exonic
1083961451 11:66017011-66017033 GCCCCTGGGGTTCCCCTCGCCGG + Intronic
1084416391 11:69035363-69035385 GCCCCTGCGCCCCTCCACGCAGG + Intergenic
1084672372 11:70614922-70614944 GCAGCTATGCTGCTCCTGGCTGG + Intronic
1084876749 11:72139001-72139023 GTCCTTGTGCAGCTCCTGGCTGG - Exonic
1084881770 11:72176807-72176829 GTCCTTGTGCAGCTCCTGGCTGG - Intergenic
1084887524 11:72220910-72220932 GTCCTTGTGCAGCTCCTGGCTGG - Exonic
1084967861 11:72753704-72753726 CACCCTGTGCTGCACCTCGCTGG - Intronic
1089115038 11:116087958-116087980 TCCTGTGTGCTGCTCCTCCCTGG - Intergenic
1089221202 11:116873461-116873483 GGCTCTGTGCTGCTACTCACTGG + Exonic
1089377468 11:118004804-118004826 GCCCCAGTGAGGCTCCTGGCTGG - Intergenic
1089524860 11:119090208-119090230 GCAGCTGGGCTGCTCTTCGCAGG - Exonic
1090465273 11:126928015-126928037 GCTCCTGTGCTTCTCCAGGCTGG + Intronic
1091035445 11:132228721-132228743 GCCCCTGTGCTGCTTCTGAGCGG + Intronic
1091046606 11:132331033-132331055 GCCACTGGGCTGCTTCCCGCAGG - Intronic
1091278396 11:134367963-134367985 GCCCCTGTGCCGCTCATCCCAGG - Intronic
1091802449 12:3333257-3333279 GCCTCTGTGCTTGTCCTTGCAGG - Intergenic
1094425213 12:30310108-30310130 GCCTCTGTGCTGCTCCTGGGTGG - Intergenic
1095926674 12:47585722-47585744 GCCCCCATGCTGCTCCCTGCAGG - Intergenic
1097872273 12:64611023-64611045 GCTCCGGGGCTGCTCCCCGCAGG - Intronic
1099918109 12:88921622-88921644 GCCCCTCTTCTGCTGCTAGCTGG - Intergenic
1101865761 12:108518310-108518332 TCCCCTGTGCTGGTCTCCGCAGG - Intronic
1102829475 12:115983457-115983479 GTCCCTGTGCTGCTGCTGGTGGG + Exonic
1103500861 12:121400500-121400522 GGCCCTGTGCGCCTCCTCGGGGG + Intronic
1103563143 12:121803136-121803158 CCCCCTCTGCCGCTCCTCTCTGG - Intronic
1104292259 12:127481489-127481511 GCCACTGTGTTGATCCTCGCAGG - Intergenic
1104529224 12:129553297-129553319 GCACCTGTGCTGCTGCTGTCAGG + Intronic
1104569082 12:129909383-129909405 GCCCCTGTTCTGCTTCCCACTGG + Intergenic
1105471918 13:20703137-20703159 GGGCCTGTGCTGCGCCACGCAGG - Intronic
1107731766 13:43356013-43356035 GCGCCGGTGCCGCTCCTCCCGGG + Exonic
1108479664 13:50856041-50856063 GGCTCTGTGCTGCTCCTGGGTGG - Intergenic
1110410322 13:75197855-75197877 GCCTCTGTGTTGCTCCTCCAGGG - Intergenic
1111641553 13:90976875-90976897 GCCCCCATGCTGCTCCCCGGTGG - Intergenic
1112484998 13:99811708-99811730 GCCCCTCTGATGATCCTGGCTGG + Intronic
1112580661 13:100674457-100674479 GCCCCTGAGCTTCTCCGCCCGGG - Intronic
1113378326 13:109783663-109783685 GCCCCTGAGCGGCTCCCCGCCGG + Exonic
1115447031 14:33502413-33502435 GCTCCTGTGCTGCTCTTCGTTGG + Intronic
1115850683 14:37587952-37587974 GCCGCGGTGCTCCTGCTCGCTGG - Intergenic
1118752418 14:68816657-68816679 GCCCCTGTGTCTCCCCTCGCGGG - Intergenic
1120843947 14:89110356-89110378 TCCCCCGTGGTGCACCTCGCAGG + Intergenic
1121055218 14:90846359-90846381 CATCCTGTGCTGCTCCTGGCTGG - Intergenic
1122155822 14:99749900-99749922 GCCCCTTGGCTGCTCCCCGATGG + Intronic
1122417276 14:101556435-101556457 GCCCCAGTGCTGGTCCTACCTGG - Intergenic
1123139716 14:106063043-106063065 GGCCCTGTGCTTCTCGTCACTGG + Intergenic
1123156950 14:106235954-106235976 GGCCCTGTGCTCCTCGTCACTGG + Intergenic
1123800254 15:23811592-23811614 GCCCCTTTCCTGATCCTAGCAGG - Intergenic
1125216740 15:37283607-37283629 GGCTCTGTGCTGCTCCTGGATGG + Intergenic
1128736322 15:70055929-70055951 GCCCCAGTGCCGCTGGTCGCAGG - Intronic
1129202152 15:74009406-74009428 GCCCATGTAATGCTCCTTGCAGG - Intronic
1130017928 15:80201776-80201798 GTCCAGGTGCTGCTCCTCCCAGG + Intergenic
1131153226 15:90059790-90059812 TCCCCTGTTGTCCTCCTCGCAGG - Intronic
1131401367 15:92128158-92128180 GGCCCTGGGCTGCTCCTTGCTGG + Intronic
1132040829 15:98523470-98523492 GCCCCAGTGCTGCCCCTTACTGG - Intergenic
1132378415 15:101348181-101348203 GCGCCTCCGCTGCTCCTCCCCGG + Intronic
1132985009 16:2761588-2761610 GGGCCTGTGCTGCTCCTTTCCGG - Exonic
1133236467 16:4389505-4389527 GCCCCAGGCCAGCTCCTCGCAGG - Intronic
1133262185 16:4558100-4558122 GCCTCTTTGCTGCTCCTCACAGG - Intronic
1133631808 16:7629148-7629170 GGCCCTGGGCTGCTTCTCCCTGG + Intronic
1136228996 16:28876200-28876222 GCCCTTCTGCAGCTCCTGGCGGG + Intergenic
1136408983 16:30065620-30065642 GCCTCTGGGCTGCGCCTCTCGGG + Intronic
1136569612 16:31088772-31088794 GGCCCAGTGCTGCTCATCGCGGG - Exonic
1139596159 16:67959577-67959599 TCCCCTGCACTGCTCCACGCAGG - Intronic
1141660411 16:85438311-85438333 GGGTCTGTGCTGCTCCTTGCTGG + Intergenic
1141768746 16:86075762-86075784 GACCCAGTGCTGCCCCTGGCTGG + Intergenic
1142292152 16:89198130-89198152 GCATCCCTGCTGCTCCTCGCTGG - Exonic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1143043601 17:4058368-4058390 ACCCCTGTGGTGGTCCTGGCAGG - Intronic
1143338769 17:6193266-6193288 GCCGCTCTGCTGATCTTCGCTGG - Intergenic
1143994277 17:10993311-10993333 GTCTCTGTGCTGCTCCTCCCAGG + Intergenic
1145868390 17:28255272-28255294 GCCCCTGTCCTGCTGCTCTCTGG - Intergenic
1147376171 17:40023561-40023583 GCCCCTGCTCTGCTCCTGGCAGG + Intronic
1148017162 17:44530031-44530053 GCCCCTGTCCTGTTCCCTGCTGG - Intergenic
1148804812 17:50258827-50258849 GCCCCTGAGCAGCTCCTGGGTGG + Intergenic
1152217497 17:79042320-79042342 GCCCAAGTGCCGCCCCTCGCGGG + Intronic
1152649123 17:81483830-81483852 GCCCCTGTTCTGGTGCCCGCCGG - Intergenic
1152716743 17:81903941-81903963 GCCTCTGGGCTGCTCCAGGCGGG + Intronic
1152731988 17:81977144-81977166 GCCCCTGTACGGATCCTCCCTGG - Intronic
1152834368 17:82519852-82519874 GCCCCCGGGCCGCTCCGCGCGGG - Exonic
1152892635 17:82891131-82891153 GCGACTGGGCTGCTCCTCCCAGG - Intronic
1152930968 17:83109681-83109703 GCCCCTGTGATGCTCATGGACGG - Intergenic
1153839138 18:8990489-8990511 GACCCTGTGCTGCTCCGTCCGGG - Intergenic
1153926068 18:9836127-9836149 GCTGCTGTGCTGCTCGTGGCCGG + Intronic
1154070505 18:11148598-11148620 GCCCCTCTGCTCCGACTCGCCGG - Intronic
1154148402 18:11885742-11885764 GCCCCCGTGGTGCACCTCGCAGG + Exonic
1154360466 18:13656386-13656408 GCCCCTGTGGTACTCATTGCTGG - Intergenic
1155168642 18:23250661-23250683 GCCCCTTTCCTGGTCCTTGCAGG + Intronic
1157433866 18:47652440-47652462 GGACCTGTGCTGCACCTAGCCGG + Intergenic
1157878290 18:51294202-51294224 GCCTCTCTGCTGTTCCTCTCTGG - Intergenic
1158416526 18:57253832-57253854 GCCCCTGTGATGCTGCTTGCTGG + Intergenic
1160006304 18:75071585-75071607 TCCCCTCTGGTGCTCCTCTCTGG - Intergenic
1160556614 18:79729657-79729679 GCCCGTGTGCTTCTCCTCTTGGG + Intronic
1160587005 18:79918463-79918485 CCCCCGGTGCCGCTCCTCACTGG - Intronic
1160830404 19:1102072-1102094 GCCTCTGTGCTGCATCTGGCAGG + Intergenic
1162344692 19:10112402-10112424 GCCCCTGTGCTGCTGTGCCCTGG + Intronic
1162899319 19:13785218-13785240 GCCCCTGGGGTGCTCCTCGAAGG - Intergenic
1163268038 19:16233322-16233344 GGCCCTGTGCTGCCCCAGGCTGG - Intronic
1164480360 19:28607033-28607055 GCCCCTGTGTTGATCCTCCGTGG - Intergenic
1164527509 19:29022772-29022794 GCCTGTCTGCTGCTCCACGCTGG - Intergenic
1164587167 19:29483322-29483344 GCCCTTGTTCTGATCCTCCCAGG - Intergenic
1164674562 19:30092850-30092872 GCTTCTGGGCTGCTCCTCCCTGG + Intergenic
1165468201 19:35987428-35987450 GCCCCTGTGCTCTCCCTTGCTGG + Intergenic
1166077379 19:40421419-40421441 GCCCGTGTGCTGGGCCTGGCTGG - Intergenic
1167149166 19:47699083-47699105 GCCTCTGGGCTCCTCCTCGCTGG + Intronic
1167529050 19:50003433-50003455 GACCCTGAGCTGCTGCTCACGGG + Intronic
1168411652 19:56143950-56143972 GCACCTGTGCTGCCTCCCGCTGG - Intronic
1168468494 19:56622585-56622607 GCACCTGTACGGCTTCTCGCCGG - Exonic
925159757 2:1675889-1675911 ACTCCTGCGCTGCTCCTCTCTGG - Intronic
925253978 2:2466507-2466529 GCACCTGTGCTGTGCCTGGCTGG - Intergenic
925328360 2:3039891-3039913 GGCACTGTGCTGCTCCTTGGAGG - Intergenic
925336478 2:3102468-3102490 GCCCCAGCGTTGGTCCTCGCGGG - Intergenic
925350101 2:3195091-3195113 GGTCCTTGGCTGCTCCTCGCAGG + Intronic
925609923 2:5693848-5693870 GCCCCCCAGCTGCTGCTCGCTGG - Exonic
927642219 2:24852502-24852524 TGCCCTGTGCTACTCCTCACAGG + Intronic
928389030 2:30894938-30894960 GCTCCTGTGCTGCTGCTCTGGGG - Intergenic
932413299 2:71559713-71559735 GGCCCTGAGCTGCACCTGGCAGG - Intronic
933255696 2:80078451-80078473 TCCACTTTTCTGCTCCTCGCTGG - Intronic
933639263 2:84741685-84741707 GCCACTGTGCTGCTCCAGGGAGG - Intronic
937002901 2:118484483-118484505 GCCCCAGTGCAGGTCCTCCCTGG - Intergenic
937310880 2:120902663-120902685 GAGGCTGTGCTGCCCCTCGCCGG + Intronic
938379282 2:130827505-130827527 GCCCCCGCTCTGCTCCTCGCTGG + Intergenic
940082814 2:149823742-149823764 GCACCTGTGCTCATCCTGGCTGG + Intergenic
941065189 2:160893741-160893763 GTCCCTGGGCTGCTGCTCCCTGG - Intergenic
941124764 2:161571501-161571523 GCCACTGTGCAGCTCCAAGCAGG - Intronic
941179731 2:162244626-162244648 GCCACTGTCCTGCTCTTTGCTGG - Intronic
942953586 2:181749792-181749814 GCCCCTTTGCTGCAGGTCGCTGG + Intergenic
946174857 2:217916352-217916374 GCCCCTGTGCTGGGCCTGCCTGG + Intronic
947594357 2:231401405-231401427 GCCACTGTGCTGATCCTCCACGG - Intergenic
948741926 2:240053938-240053960 GCCCCTGTGCTCTTCCTCTCAGG + Intergenic
1171249484 20:23637527-23637549 GACCCCGTGCTGCTCCTCTCCGG - Intronic
1172247395 20:33455411-33455433 GCCCCTGTGCTTCTAATCTCTGG - Intergenic
1172993197 20:39050756-39050778 GCCCATCTGCTTCTCCTGGCAGG - Intergenic
1173333542 20:42095399-42095421 GCCTCTGTGCTGTTCCTCAAGGG + Intronic
1175516313 20:59572336-59572358 GCCCCTGGGCTGCACCCCGGGGG - Intergenic
1175539120 20:59737176-59737198 GCCCCTGTCCTGTTCCCCACTGG + Intronic
1175976904 20:62715447-62715469 GACCCTGTGGTGCTCCCCGTGGG + Intronic
1178061358 21:28856673-28856695 GGCTCTGTGCTGCTCCTGGGTGG - Intergenic
1180729145 22:17968378-17968400 GCTCCTGTGCTGCTCCCCCGTGG - Intronic
1181511026 22:23388786-23388808 GCCCCTGTGGGGCACCTAGCAGG + Intergenic
1181688959 22:24547757-24547779 GCCTCTCTGCTGCTGCTCCCTGG + Intronic
1184153077 22:42649535-42649557 GCCGCTGTGCTGCCCCGCGCGGG + Intronic
1184474364 22:44712505-44712527 TCCCCTGTGCTCCTTCTCCCAGG - Intronic
1184594784 22:45507140-45507162 GCCCCAGCCCCGCTCCTCGCTGG - Intronic
1185061730 22:48610522-48610544 GCCCCTCTGCTCCTCCGTGCTGG - Intronic
1185061747 22:48610586-48610608 GCCCCTCTGCTCCTCCATGCTGG - Intronic
1185212149 22:49576341-49576363 GCCTCTGTCCTGCTCCCCCCTGG - Intronic
1185244016 22:49763745-49763767 GCCCCAGGCCTGCTCCTCTCTGG + Intergenic
1185292138 22:50032473-50032495 GCCCCTGGCCAGCTCCTCCCAGG + Intronic
1185315943 22:50179144-50179166 GCCCCCGTCCTCCTCCTCCCGGG - Exonic
950101785 3:10361653-10361675 TCACCTCTGCTGCTCCTCCCAGG + Intronic
950584159 3:13880680-13880702 GCCCCACTGCTGTTCCGCGCGGG - Intergenic
950635178 3:14309026-14309048 GCCCCTGAGCTGCTCTTCCTGGG - Intergenic
952258568 3:31716576-31716598 CCACCTGTGCTGCTCCTCCCTGG - Intronic
953220995 3:40971428-40971450 CACCCTGTGCTGCCCCTTGCCGG + Intergenic
953787436 3:45921634-45921656 GCCCCTGGGCTGCCCCTCAGAGG - Exonic
954754150 3:52829938-52829960 GCCCGTGTGCCCCTCCTCGGGGG - Intronic
954954632 3:54508374-54508396 GCCCATGTGCTGTTCTTCTCTGG - Intronic
963398036 3:144757814-144757836 GCCCTTTTGCCGCTCCTGGCTGG - Intergenic
965537166 3:169835464-169835486 GCCCCTGTGATGCTCCACAGAGG - Intronic
968597318 4:1492147-1492169 GCCCCTGTGCTGCTGGTAACAGG - Intergenic
968651423 4:1761683-1761705 GACCCTGTGCTCCTCCACGTGGG + Intergenic
968804149 4:2761861-2761883 GCCCCTGTGGGGCTCCTACCTGG + Intergenic
968936167 4:3611643-3611665 GCCCATGTGCAGCTCCAGGCTGG - Intergenic
969392658 4:6901664-6901686 GCCCCTGCCTTGCTCCTCTCTGG + Intergenic
969427033 4:7130416-7130438 GCCCCTGGGCTGCTGCGTGCGGG - Intergenic
969654198 4:8486889-8486911 CTCCCTGGGCTGCTCCTCGCCGG - Intronic
970566038 4:17333587-17333609 GGCCCTGTGCTTCTCCAGGCTGG + Intergenic
974021042 4:56692735-56692757 GCCTGTGTGCTGCTCCTCCAAGG - Intergenic
977295293 4:95202781-95202803 GCCCCTGTGCTGCTCCTCGCTGG - Exonic
985690886 5:1311639-1311661 GCCCCGGGGCTGCTCCTGCCAGG + Intergenic
985749541 5:1666486-1666508 GCCCCTGGGCTGCCCCTGGAGGG + Intergenic
986305250 5:6509503-6509525 ACCCCTCTCCTGCTCCTCCCCGG + Intergenic
990557462 5:56951301-56951323 GCCCCTGGGCTGGAGCTCGCTGG - Intronic
991305568 5:65172853-65172875 GCCGCTGCCCTCCTCCTCGCTGG - Exonic
992554666 5:77891718-77891740 TCCCCTGTGCTGTTCCTGCCAGG - Intergenic
993879821 5:93348880-93348902 TCCCCTGTGCAGCTCCCAGCAGG - Intergenic
994043501 5:95284263-95284285 CAACCTGTGCTGCTCGTCGCCGG - Exonic
997625356 5:135327347-135327369 GCCCAAGTTCTGCTCCTCCCAGG - Intronic
998060677 5:139116450-139116472 GCCCCAGGTCTGCTCCTGGCTGG + Intronic
998428376 5:142049144-142049166 GCCCTTGTGAGGCTCCTCTCAGG + Intergenic
999386695 5:151158495-151158517 GCCCCCCTGCTGATCCTCGGAGG - Intergenic
1002697475 5:181100637-181100659 GCCCCTGCGCTGCTGCCCGGCGG + Intergenic
1003616365 6:7658584-7658606 GTCTCTGTGCTGCTGCTGGCAGG + Intergenic
1006570473 6:34999030-34999052 GCCACTGTGCTGATCCTCCACGG - Intronic
1006644804 6:35508879-35508901 GCCTGTGTGCTCCTCCTCCCTGG + Intronic
1006719903 6:36143270-36143292 CCCCTTGTGCTGCCCCTCACTGG - Intronic
1012914898 6:105159503-105159525 GCACCTGTTCTTCTCATCGCTGG + Intronic
1015499888 6:133921008-133921030 CCCACTGTGCTCCTCCTAGCAGG - Intergenic
1016021658 6:139242597-139242619 GCTCCTCTGCTGCTGCTCGTGGG + Exonic
1018988062 6:168652897-168652919 ACCCCTGGGCTGCTCCTTCCTGG - Intronic
1019328560 7:451817-451839 GCCCCTCTGCTGCTCCCCCAGGG + Intergenic
1019547972 7:1587504-1587526 GCACCTGGGCTACTCCTCGGGGG - Intergenic
1019624513 7:2009177-2009199 GCCTCTGTGCAGCACCTCGGTGG - Intronic
1019917477 7:4143147-4143169 GCCCCTGTGCTGCTTCCGGTGGG + Intronic
1020257545 7:6510496-6510518 GTCCCTGTGCTGCTTCAGGCTGG - Intronic
1022113721 7:27246032-27246054 GCCCCTGCCCTACTACTCGCCGG + Exonic
1026870278 7:73846865-73846887 GCCCCTGTGCTGCTGACCACTGG - Intergenic
1030480113 7:110092678-110092700 GCTTCTGTGCTGCTCTTCTCAGG - Intergenic
1032087373 7:128891151-128891173 ACCCCTCGGCTGCTCCTCCCTGG - Intronic
1033564964 7:142569620-142569642 GGCTCTGTGCTGCTCCTGGTGGG - Intergenic
1033588854 7:142794139-142794161 GCCCCTGAGCTGCTTCTTTCAGG + Intergenic
1034413442 7:150953123-150953145 CACCCAGTGCTGCTCCCCGCCGG + Intronic
1034455371 7:151167343-151167365 GCCCCTGCGCCGCTGCCCGCTGG - Exonic
1035266769 7:157693555-157693577 GCCCCTGTGCTCCGGGTCGCTGG - Intronic
1035477487 7:159153581-159153603 TCCCCTGTGCTGCGCCTCTCTGG + Intergenic
1035535814 8:390746-390768 AGCCCTGTGCTGTTCCTGGCTGG + Intergenic
1036753009 8:11455089-11455111 GCCCCAGTGCTGCACGTGGCAGG + Intronic
1036849470 8:12191698-12191720 ACACCTGTGCTGCTTCTCTCAGG + Intronic
1036870831 8:12433971-12433993 ACACCTGTGCTGCTTCTCTCAGG + Intronic
1038404389 8:27310863-27310885 GCTGCTGTGCTGCTCCTGCCAGG - Exonic
1039471821 8:37818212-37818234 GCCCCTGCCCTGCCCCTCTCAGG + Intronic
1039969464 8:42308858-42308880 ACACCTGAGCTGCTCCTCTCTGG - Intronic
1040565695 8:48564809-48564831 GGCACTGTGCTGCTCCTCTTGGG + Intergenic
1042040094 8:64580970-64580992 GCCCCTGGGCTGCTTCGAGCCGG + Exonic
1047759031 8:127940413-127940435 GACCCGGTTCTGCTCCTTGCTGG + Intergenic
1048306471 8:133288260-133288282 GCCCCTGTGCTGCAGCCAGCAGG - Intronic
1049206746 8:141367120-141367142 GCTCCTGAGCTGCTCCCTGCAGG - Intronic
1049642099 8:143720452-143720474 GCCCCTCTGGTGCTCCTAGAGGG + Intronic
1050820330 9:9871596-9871618 GCCCCTGCACTTCTCCTCCCAGG - Intronic
1050820368 9:9871750-9871772 GCCCATGAGCTTCTCCTCCCAGG - Intronic
1055668542 9:78576306-78576328 GCCCTTGAGCTGCTGCTTGCGGG + Intergenic
1056557647 9:87703165-87703187 GCGCCTGAGGTCCTCCTCGCTGG - Exonic
1056992320 9:91423658-91423680 GCCCCTTTCTTTCTCCTCGCCGG - Exonic
1059409255 9:114121980-114122002 GACCCTGAGCTGCTGCTCGGGGG - Intergenic
1060483698 9:124033655-124033677 GGCCCTTTTCTGCTCCTGGCTGG + Intergenic
1060555285 9:124504755-124504777 GCCCGGGTGCGGCTCCTCGCCGG - Intronic
1060849035 9:126860200-126860222 GCACCCGAGCTGCTCCTGGCAGG - Intergenic
1061297308 9:129683795-129683817 GCCCCTGTGCTTCTCTTCGGTGG - Intronic
1061878043 9:133554658-133554680 GCCCCTGGGGGGCCCCTCGCAGG - Exonic
1061912383 9:133732092-133732114 GCCCTTGCGCTGCCCCTTGCTGG - Intronic
1062456415 9:136641361-136641383 GCCCCCTTGCTGCTGCTCTCTGG - Intergenic
1062468997 9:136694078-136694100 TCACCTGTGCTGCCCCTGGCAGG + Intergenic
1062518463 9:136947523-136947545 GCCGCTAAGCTGCTCCTCTCAGG + Intronic
1062609851 9:137368946-137368968 GGCCCTGTGCCCCTCCTCACGGG - Intronic
1186405328 X:9296805-9296827 GCCCATGTGCTGCTCTTTGGAGG + Intergenic
1188190623 X:27167824-27167846 GCCCTTGATCTGCTCCTGGCAGG + Intergenic
1189268695 X:39735613-39735635 GGCTCTGTGCCTCTCCTCGCTGG - Intergenic
1190246059 X:48691180-48691202 TGCCCTGTGCTCCTCCCCGCAGG + Exonic
1191129691 X:56994949-56994971 GCAACTGTGCTCCTCTTCGCAGG - Exonic
1192247809 X:69388009-69388031 GCCCCTGTGCTTGTCCTGGTGGG + Intergenic
1194594252 X:95837498-95837520 GGCTCTGTGCTGCTCCCCACTGG + Intergenic
1198321391 X:135521515-135521537 TCCCCGGGGCTGCTCCTCCCCGG - Intronic
1198686983 X:139237647-139237669 GGCTCTGTGCTGCTCCCCGGTGG - Intergenic
1200153888 X:153965070-153965092 GGGCCTGTGCTCCTCCTCCCTGG + Intronic