ID: 977303010

View in Genome Browser
Species Human (GRCh38)
Location 4:95289391-95289413
Sequence TTCATGTTGTTATCTGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977303009_977303010 11 Left 977303009 4:95289357-95289379 CCTCGATCTGTGGAAATTCTGTA 0: 1
1: 0
2: 1
3: 10
4: 122
Right 977303010 4:95289391-95289413 TTCATGTTGTTATCTGCTGCTGG No data
977303008_977303010 12 Left 977303008 4:95289356-95289378 CCCTCGATCTGTGGAAATTCTGT 0: 1
1: 0
2: 1
3: 13
4: 155
Right 977303010 4:95289391-95289413 TTCATGTTGTTATCTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977303010 Original CRISPR TTCATGTTGTTATCTGCTGC TGG Intronic
No off target data available for this crispr