ID: 977303628

View in Genome Browser
Species Human (GRCh38)
Location 4:95297016-95297038
Sequence CCCCACCAGCATGTGTAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 125}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977303628_977303638 24 Left 977303628 4:95297016-95297038 CCTGGTTACACATGCTGGTGGGG 0: 1
1: 0
2: 0
3: 13
4: 125
Right 977303638 4:95297063-95297085 CCACTGACTAGTCTATGTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 73
977303628_977303635 22 Left 977303628 4:95297016-95297038 CCTGGTTACACATGCTGGTGGGG 0: 1
1: 0
2: 0
3: 13
4: 125
Right 977303635 4:95297061-95297083 ATCCACTGACTAGTCTATGTAGG No data
977303628_977303636 23 Left 977303628 4:95297016-95297038 CCTGGTTACACATGCTGGTGGGG 0: 1
1: 0
2: 0
3: 13
4: 125
Right 977303636 4:95297062-95297084 TCCACTGACTAGTCTATGTAGGG 0: 1
1: 0
2: 0
3: 10
4: 81
977303628_977303634 -6 Left 977303628 4:95297016-95297038 CCTGGTTACACATGCTGGTGGGG 0: 1
1: 0
2: 0
3: 13
4: 125
Right 977303634 4:95297033-95297055 GTGGGGTAGGGAGTAAAGGAGGG 0: 1
1: 0
2: 9
3: 92
4: 1075
977303628_977303633 -7 Left 977303628 4:95297016-95297038 CCTGGTTACACATGCTGGTGGGG 0: 1
1: 0
2: 0
3: 13
4: 125
Right 977303633 4:95297032-95297054 GGTGGGGTAGGGAGTAAAGGAGG 0: 1
1: 0
2: 6
3: 76
4: 713
977303628_977303632 -10 Left 977303628 4:95297016-95297038 CCTGGTTACACATGCTGGTGGGG 0: 1
1: 0
2: 0
3: 13
4: 125
Right 977303632 4:95297029-95297051 GCTGGTGGGGTAGGGAGTAAAGG 0: 1
1: 0
2: 4
3: 43
4: 425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977303628 Original CRISPR CCCCACCAGCATGTGTAACC AGG (reversed) Intronic
901217296 1:7561890-7561912 CTTCACCAGCATGTGTCACCAGG + Intronic
901257632 1:7844749-7844771 CGCCAGCAGCAGGTGCAACCTGG - Exonic
902983610 1:20142315-20142337 CCCCTCCAGCCTGTGGGACCTGG + Intronic
909878920 1:80848164-80848186 GGCCACCAGCATGTGACACCAGG - Intergenic
910476041 1:87608592-87608614 CCACACCACCATGTTTTACCAGG - Intergenic
911059877 1:93738672-93738694 CCCCACCAGCATCTCCCACCAGG - Intronic
913610371 1:120504561-120504583 CCCCACCCCCATCAGTAACCAGG - Intergenic
914580819 1:149017678-149017700 CCCCACCCCCATCAGTAACCAGG + Intronic
919842891 1:201622332-201622354 CCCCAGCAGCATGTGGAAGAAGG + Intergenic
922371889 1:224919618-224919640 CCCCAGAAGACTGTGTAACCAGG - Intronic
922785948 1:228282296-228282318 CCCCACCAGCTTCTGTAGCCAGG - Intronic
923937688 1:238781571-238781593 CCCCACCATCTTGTGTTCCCTGG - Intergenic
1065304437 10:24355114-24355136 CCTCACCAGTCTGTGTCACCTGG - Intronic
1065586815 10:27226852-27226874 CCACACCAGCCTGGGTAACATGG - Intronic
1065989204 10:30991416-30991438 CCCCACCAGCAAGTTGATCCAGG - Intronic
1073360891 10:102897664-102897686 CACCACCAGCCTGGGCAACCCGG - Intronic
1073710447 10:106031096-106031118 AACCACCAGCATGAGTTACCTGG + Intergenic
1075725395 10:124608279-124608301 CCCCACCAGCCTGTGTGCCCAGG + Intronic
1076988001 11:253278-253300 AGCCACCAGCATCTGTGACCTGG + Intergenic
1077030826 11:466171-466193 CCAGACCAGCCTGTGTAACATGG + Intronic
1077152230 11:1077532-1077554 CCTCACCCTCATGTGGAACCGGG + Intergenic
1078831170 11:14978692-14978714 CCCCACCAGCTTTTCTAACTAGG + Intronic
1083484899 11:62977126-62977148 CCCACCCTGCATGTGTTACCTGG + Exonic
1084311188 11:68317261-68317283 CCCCACCAGCATGGGCAAGGTGG - Intronic
1084709082 11:70832841-70832863 CCCCACGAGCAGGTGCAGCCAGG + Intronic
1087304550 11:96473085-96473107 ACCCACCTGCATGTGCCACCTGG + Intronic
1092582680 12:9862904-9862926 CCCCACCAGCTTGAGTTTCCTGG + Intronic
1094436485 12:30425603-30425625 CCCCAGCAGGATGTGCAACAGGG - Intergenic
1096684286 12:53277592-53277614 CCTCACCAGCATCTGCAGCCAGG - Exonic
1103986127 12:124768672-124768694 CACCACCACCATCTGTCACCAGG + Intergenic
1104444953 12:128825078-128825100 CCCAACCTGCATGTGTTAACAGG + Intergenic
1105546184 13:21352610-21352632 CCAAGCCAGCATGTGTGACCAGG - Intergenic
1105740985 13:23322786-23322808 CCCCGCCAACAGGTGTAACGTGG + Intronic
1106419009 13:29570103-29570125 CCCCACCTGCCTGTGAATCCTGG + Intronic
1111903882 13:94232890-94232912 AGGCACCAGAATGTGTAACCAGG + Intronic
1118719520 14:68584199-68584221 CCCCACCAGCCTGTGCCACTTGG + Intronic
1122023663 14:98859265-98859287 CCCCAGCAGCCTGGGTCACCAGG - Intergenic
1127013225 15:54653243-54653265 CCTCACCAGCATTTGTTGCCTGG - Intergenic
1127047554 15:55043167-55043189 ACCCACCTGCATGTGCCACCTGG - Intergenic
1128569070 15:68720185-68720207 CCCCACCTGCATTTGAATCCTGG + Intronic
1132561866 16:598902-598924 CTCCAGCAGCGTGGGTAACCCGG + Intronic
1134626987 16:15729269-15729291 CCCCACAAGCAGATGGAACCAGG + Intronic
1136275393 16:29176764-29176786 CCCCACCTGGATGTGCAGCCTGG + Intergenic
1137903408 16:52293740-52293762 CCTCACCAGCATGTGTGTCATGG - Intergenic
1138241763 16:55433268-55433290 CAGCACCAAAATGTGTAACCTGG - Intronic
1142079753 16:88142829-88142851 CCCCACCTGGATGTGCAGCCTGG + Intergenic
1143030606 17:3965020-3965042 CCCCAGCAGGAAATGTAACCAGG + Intergenic
1143454093 17:7054630-7054652 CACCACCAGCCTGGGTAACACGG - Intergenic
1145258228 17:21339243-21339265 CCCCACCAGAAAGTGTAAAAGGG - Intergenic
1145318408 17:21748763-21748785 CCCCACCAGAAAGTGTAAAAGGG + Intergenic
1146256756 17:31395979-31396001 CCACACCAGCCTGGGTAACATGG + Intronic
1146475968 17:33163064-33163086 CCCCACCAGAATGAGCACCCTGG - Intronic
1147937915 17:44024175-44024197 CCCCACCAGCCTGTGGCGCCTGG - Intergenic
1149856980 17:60091328-60091350 CCCTCCCAGCATGTGCATCCTGG + Intergenic
1150063403 17:62088329-62088351 CCCCACCAGGATGGGGATCCTGG + Intergenic
1152586519 17:81191831-81191853 GCCCACCAGGGTGTGAAACCAGG + Intronic
1155693755 18:28658501-28658523 CCAGACAAGCATCTGTAACCTGG + Intergenic
1157477325 18:48031691-48031713 CACCACCAGCATGTGGCAACTGG - Intronic
1160909720 19:1468974-1468996 CCCCAGCAGCCTGGGTGACCGGG - Exonic
1161106177 19:2445170-2445192 CCCCACCAGCCTTTGCAACCTGG + Intronic
1162953316 19:14084688-14084710 GCCCACCAACATGTGTTGCCCGG - Intronic
1164962194 19:32443157-32443179 CCCAGCCAGCATGTGTCAGCAGG + Intronic
1165443745 19:35845531-35845553 GCCCTCCAGCCTGTGGAACCGGG + Exonic
1167213229 19:48146880-48146902 CCCCACCTCCCTGTGTGACCTGG + Intronic
1168466099 19:56602401-56602423 TCCCACCAGCATGTCTGAGCGGG + Intronic
927655326 2:24940370-24940392 CTCCACCAGCATCTGTGAGCAGG + Intergenic
928609339 2:32976776-32976798 CTCCACCAGCCTGTGAACCCAGG + Intronic
932596395 2:73096218-73096240 CCCCACCAGCAGGAGTAACTAGG - Intronic
935732241 2:106073779-106073801 CCCCACCACCATGTGTAGGAGGG - Intronic
937024813 2:118689273-118689295 CCCCAGCTGCCTGTGTACCCTGG + Intergenic
937220591 2:120341161-120341183 CCCTCCCAGCAGGTGTAAGCAGG - Intergenic
937303112 2:120855419-120855441 GTCCATCAGCATGTGTACCCAGG + Intronic
937413899 2:121699226-121699248 CCCCACCAACCTGGGTAACATGG + Intergenic
947916796 2:233837860-233837882 CCCCACCAGCTTGTGCTCCCTGG - Intronic
1171499043 20:25579034-25579056 CTCAACCAGCATGTGTAGACAGG + Intronic
1172192011 20:33067742-33067764 CCCCTCCAGCATGGGGAAGCTGG + Intronic
1173445729 20:43116324-43116346 CCCCACCACCTTGTGTATTCTGG - Intronic
1174404699 20:50295809-50295831 CCCCAGCATCATGTGCAGCCTGG + Intergenic
1174603790 20:51745641-51745663 CCCCACCAGAGAGTGTAATCTGG + Intronic
1174837887 20:53875545-53875567 CCCCATCACCATGTCTGACCTGG - Intergenic
1175431690 20:58909512-58909534 CCCCACCAGCATGTTTGACGTGG + Exonic
1179886609 21:44316876-44316898 CCCCACCAGCCTGTGCCTCCTGG + Intronic
1180966172 22:19789025-19789047 CCCCACCTGCAGCTGGAACCAGG + Intronic
1183457401 22:37930248-37930270 CCCCACAAGCAAGTGCACCCGGG - Intronic
1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG + Intronic
951106497 3:18750008-18750030 AACCACCAGCATGTCTTACCTGG - Intergenic
953023273 3:39129545-39129567 TCCCACTAGCATGTGCAAGCAGG - Intronic
953220727 3:40969429-40969451 CAGCACCTGCATGTGCAACCAGG - Intergenic
961056791 3:123795672-123795694 CCCCACCTGCACTTGGAACCTGG - Intronic
962745505 3:138394898-138394920 CTCCACCAGCATGTGTTGCCTGG + Intronic
966927792 3:184656819-184656841 TCCCTGCAGCATGGGTAACCTGG + Intronic
968605292 4:1532480-1532502 CCCCACCAGCATCTGTAGGTAGG + Intergenic
977085719 4:92596077-92596099 CCCCAACAGCCTGTGTTTCCTGG + Intronic
977303628 4:95297016-95297038 CCCCACCAGCATGTGTAACCAGG - Intronic
977910024 4:102523621-102523643 CACCACCAGCATGAGCAGCCTGG + Intronic
984891723 4:184499953-184499975 TCCCACCACCATGTGTAAGCTGG + Intergenic
985574929 5:669634-669656 CACCACCAGCATGAGTCACTCGG + Intronic
986631794 5:9781376-9781398 CCCCAGCACCATGTCTCACCTGG + Intergenic
987852055 5:23368219-23368241 ACCCACCTGGATGTGTAACTTGG + Intergenic
990282865 5:54270481-54270503 CCCCAGGGGCATGTGTATCCTGG + Intronic
991416356 5:66396846-66396868 CCCAAACAGGATGTGTCACCAGG - Intergenic
994184223 5:96800614-96800636 TCCTATCAGCATGTATAACCTGG + Intronic
997674091 5:135700046-135700068 CCCCACCAGCATTTGACACATGG + Intergenic
1002624509 5:180515940-180515962 CTCCACCAGCCTGGGTAACGCGG - Intronic
1007758077 6:44113890-44113912 CCCCACCAGCCTGCGCAAGCGGG - Exonic
1009410038 6:63355877-63355899 CACAACCAGCATGAGTAACATGG - Intergenic
1010527535 6:76922346-76922368 CCCCACCATCATGGGTTCCCTGG + Intergenic
1013767503 6:113592049-113592071 CCCCAACAGTACTTGTAACCTGG - Intergenic
1018910482 6:168098559-168098581 CCCCACCAGCCTTGGTGACCGGG + Intergenic
1019017727 6:168892021-168892043 CCCCAGCAGCATGTGTTCCTGGG - Intergenic
1021710617 7:23412538-23412560 CCCCACCAGCATGGAGAACCTGG + Intronic
1021839059 7:24707533-24707555 GCCCACCAACATATGTTACCTGG + Intronic
1023841531 7:44101158-44101180 CAGCACCAGCATGTGTATCTGGG - Intergenic
1028532056 7:91849088-91849110 CCCCACCAGCATGGGGAAGCAGG + Intronic
1031373157 7:120992561-120992583 CCCCTCCAGGATGTGTAAACTGG + Intronic
1039465148 8:37780081-37780103 CTCCACCAGACTGAGTAACCAGG - Intergenic
1041929838 8:63274402-63274424 CCCCTCCAGCCTGGGTGACCGGG - Intergenic
1042485158 8:69339539-69339561 GCCCACCTGCATTTGTCACCAGG + Intergenic
1048324465 8:133428487-133428509 CCCGACCAGCATGTGGCACAAGG - Intergenic
1048577903 8:135707299-135707321 CTCCCCCAGCCTGAGTAACCTGG - Intergenic
1053436929 9:38081933-38081955 CCACACCACCATGTGTAAAAGGG + Intergenic
1055575352 9:77655831-77655853 AGCCACCAGCATGTCTGACCTGG + Intergenic
1057298377 9:93862282-93862304 CCCCACCAGCATGCATCCCCTGG + Intergenic
1059567777 9:115400416-115400438 ACCTACCATCATGTGTAACACGG - Exonic
1061593424 9:131613508-131613530 CCCCACCCCCATGTCTCACCTGG - Intronic
1061674879 9:132209988-132210010 GCCCACCAGCATGTGTAAGGAGG + Intronic
1062087856 9:134657906-134657928 CCTCACCAGCCTGTGACACCAGG - Intronic
1062213490 9:135376950-135376972 CTCCACATGCATGTCTAACCAGG + Intergenic
1062432695 9:136533071-136533093 CCCCGCCACCATGTGGACCCTGG + Intronic
1062434563 9:136541164-136541186 GCCCACCAGCATGTGCTGCCAGG + Intronic
1187410446 X:19046311-19046333 CTCCATCAGCTTTTGTAACCAGG - Intronic
1188753257 X:33929500-33929522 CACCACCAACATGTGTAGTCTGG - Intergenic
1190329635 X:49227833-49227855 CCCCATCAGAATGTAAAACCAGG + Intronic
1190740408 X:53284749-53284771 TCCCCCCACCATGTGTGACCAGG - Intronic
1191045199 X:56129013-56129035 CCCCACCCCAAAGTGTAACCTGG - Intergenic
1192192756 X:69002603-69002625 CCCCACCAGGATGTGTACTCTGG - Intergenic
1192301580 X:69909497-69909519 CCACACCAGCCTGTCTAACATGG - Intronic
1193509493 X:82382425-82382447 CACCACCTGCATATGTCACCTGG - Intergenic
1200954058 Y:8927718-8927740 CCTCTCCAGGATGTGTCACCTGG - Intergenic