ID: 977303774

View in Genome Browser
Species Human (GRCh38)
Location 4:95298366-95298388
Sequence CAGTGTGTGCAGTTGGCATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977303774_977303780 10 Left 977303774 4:95298366-95298388 CCCTATGCCAACTGCACACACTG 0: 1
1: 0
2: 1
3: 15
4: 199
Right 977303780 4:95298399-95298421 TAGCCCAGGCCTTACCTTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 254
977303774_977303784 22 Left 977303774 4:95298366-95298388 CCCTATGCCAACTGCACACACTG 0: 1
1: 0
2: 1
3: 15
4: 199
Right 977303784 4:95298411-95298433 TACCTTTCTGGCTGCATCTGTGG No data
977303774_977303777 -4 Left 977303774 4:95298366-95298388 CCCTATGCCAACTGCACACACTG 0: 1
1: 0
2: 1
3: 15
4: 199
Right 977303777 4:95298385-95298407 ACTGCTCCCATCTTTAGCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977303774 Original CRISPR CAGTGTGTGCAGTTGGCATA GGG (reversed) Intronic
900920503 1:5667441-5667463 CACTGTGTGCAGGTTGCACAAGG - Intergenic
901850639 1:12012640-12012662 CAGTGACTGCAGTTGGCCAAGGG + Exonic
902319586 1:15651790-15651812 GAGTGTGCCCGGTTGGCATATGG + Exonic
908643208 1:66247999-66248021 CTGTGTGTGCAGTTTTCATGAGG + Intronic
908676660 1:66612135-66612157 CAGTGTGTGCAGAGGTCACATGG + Intronic
909753095 1:79189291-79189313 CTGTGAATGCAGTTGGCATAAGG - Intergenic
909782801 1:79568638-79568660 CACTCTGTGCTGTTTGCATACGG - Intergenic
911666888 1:100563539-100563561 CAGTGTCAGGAGTTGGCACAAGG - Intergenic
912334643 1:108850890-108850912 GAGTGTGAGAAGTTGGCGTAAGG + Intronic
913544191 1:119851181-119851203 CAGTGTGTGCAGAGATCATATGG + Intergenic
913868728 1:123920924-123920946 CTTTTTGTGCAGTTGGCAAATGG + Intergenic
913991590 1:143618097-143618119 CAGTGTGTGCAGAGATCATATGG + Intergenic
915146115 1:153796576-153796598 CAGTGTGGGCACTGGGCAGAGGG + Intergenic
915535155 1:156530925-156530947 CAGTGTGTGAAGTGGGGAGAGGG + Intronic
915957508 1:160234158-160234180 TTTTGTGTGAAGTTGGCATAAGG - Intronic
916788985 1:168108124-168108146 CAGTGTATGCAGATCACATAAGG + Intronic
916981690 1:170144799-170144821 CTGTGGGTGCACATGGCATAGGG + Intergenic
917966364 1:180181474-180181496 CAGTATGTGCAGTAGTCAGAGGG - Intronic
919277154 1:195435025-195435047 CATTGTGTCCGGTTGCCATAGGG + Intergenic
921955826 1:220982371-220982393 CAGAGTGGGCACTTGGCATCTGG + Intergenic
922596403 1:226816941-226816963 CAGTGTGGGGAGTTGGCTCAAGG - Intergenic
924234694 1:241990905-241990927 CAGGGTTTTTAGTTGGCATATGG + Intergenic
1065045855 10:21747185-21747207 GAGTGTGGACAGTTGGCAGAGGG + Intergenic
1065198759 10:23293475-23293497 CAGTGTGGGCAGATGGCAGAAGG - Intronic
1066629494 10:37445045-37445067 CAGTGTGTGCAGAGATCATATGG - Intergenic
1066636147 10:37503620-37503642 CTGTGTGTGCAATTGTCACATGG + Intergenic
1070851058 10:79561764-79561786 CATTGTGTACATTTTGCATAGGG - Intergenic
1070977645 10:80618037-80618059 CAGTCTGTGCAGTTCCAATAGGG - Intronic
1072156878 10:92731557-92731579 CATTGTGTGCCATTGCCATATGG - Intergenic
1072605809 10:96981741-96981763 CTTTGTGTACAGCTGGCATAGGG - Exonic
1074318691 10:112381210-112381232 CAGTGTGTGCAGTGAGCTCATGG - Intronic
1074352277 10:112749239-112749261 CTGTCTGTGAATTTGGCATATGG + Intronic
1075102394 10:119515672-119515694 CTGTGTGTGCAGATAGCACAAGG - Intronic
1077399246 11:2345487-2345509 CAGTGTGTGCAGAGGTCACATGG + Intergenic
1077910297 11:6567097-6567119 CAGGTTCTGCAGTTGGCTTAGGG - Exonic
1082965968 11:58966477-58966499 CAGTGTGTGGAGTGGGAATCAGG - Intronic
1084424296 11:69076351-69076373 CAGTGTGGGCAGGTGGCCTTTGG + Intronic
1085233599 11:74993767-74993789 CAGAGTCTGGAGGTGGCATAGGG + Intronic
1085299427 11:75449713-75449735 CAGTGTCCCCAGTTGGCAGATGG - Intronic
1087415631 11:97851863-97851885 GAGTGTGTGCAGTCTGCACACGG + Intergenic
1088865481 11:113843750-113843772 GACTGTGTGCTGCTGGCATAAGG + Intronic
1088903852 11:114139250-114139272 CAGTGTGAGCAATTGGCAATGGG - Intronic
1089125564 11:116174232-116174254 CTGTGTGTGCAGTTGGGTTGGGG + Intergenic
1091010138 11:131993593-131993615 CAGTGTGTGCAGATTTCCTAGGG + Intronic
1095050701 12:37551810-37551832 CAGAGGGGGCAGTTTGCATAAGG - Intergenic
1095371557 12:41473575-41473597 CAGTGTGTGCAGTTTCCATGGGG - Intronic
1102661085 12:114529170-114529192 TAGTGTGGGCAGCTGGCATTTGG - Intergenic
1104908074 12:132225951-132225973 CAGTGTGTGGGGTGTGCATATGG - Intronic
1108092870 13:46867698-46867720 CTGTGTCTGTAGTTGCCATATGG + Intronic
1108590915 13:51912225-51912247 CAGTGTGTGCAGCAGGTATTCGG + Intergenic
1112428908 13:99332492-99332514 CAGCTTCTGCTGTTGGCATATGG + Intronic
1114073139 14:19131613-19131635 CAGTGTGCCCAGTGGGCATGGGG - Intergenic
1114089127 14:19268370-19268392 CAGTGTGCCCAGTGGGCATGGGG + Intergenic
1117233870 14:53751557-53751579 CAGTCTGTGCACTTGACAGACGG + Intergenic
1118528858 14:66678848-66678870 CAGTGTCTGCAGTTTCCCTAGGG + Intronic
1118968074 14:70606868-70606890 CAGTGTGTGCAGTGGTGATTTGG - Intergenic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1126126984 15:45303599-45303621 CAGTGTGAGGTATTGGCATAAGG - Intergenic
1127836721 15:62796454-62796476 CTGTGTTTACAGTTGGCAAAGGG - Intronic
1132093122 15:98961594-98961616 CAGTGTGAGCTGCTGGCAGAAGG - Exonic
1132777539 16:1603949-1603971 CTGTGTTTCCAGTTGGCACAAGG - Intronic
1133908199 16:10040715-10040737 GAGTGTGTGCAGTGTGCCTATGG - Intronic
1135490195 16:22902488-22902510 CAGTATTTGCAGTTGACATGAGG - Intronic
1139094777 16:63692268-63692290 CAGTGTTTACATTTGGCATTTGG + Intergenic
1139385563 16:66566792-66566814 CAGTGTGTGCAGAGGGCGTGGGG - Exonic
1139710287 16:68770772-68770794 CAGTGTGTGGAGTGGGCAAGAGG + Intronic
1142023939 16:87802218-87802240 CAGTGTGTGCAGATGGCAGATGG - Intergenic
1142735805 17:1898627-1898649 CGGTGTCTGCCGTTGACATAGGG + Exonic
1146051796 17:29560057-29560079 CAGTGGGTGCATCTGGCACAAGG + Intergenic
1146501672 17:33370076-33370098 CAGTGCCTGCTGATGGCATAAGG + Intronic
1149766758 17:59285328-59285350 CAGTAAGTACATTTGGCATATGG - Intergenic
1156730348 18:40186717-40186739 CAGTTTGTGAAATTGGAATATGG - Intergenic
1158907991 18:62032451-62032473 ACGTGTGTGCAGTTGGCTTGGGG - Intergenic
1159009709 18:63047017-63047039 CTTTGTGTTCAGTTGGCACAAGG - Intergenic
1160055677 18:75477669-75477691 CAGTGTTTGCATTTGGGAGATGG - Intergenic
1160512964 18:79462850-79462872 CAGTGTGTGCAGTTGGAAGCTGG + Intronic
1163351572 19:16779443-16779465 CTGTGTGTCCAGTTAGCATGTGG - Exonic
1165423722 19:35734351-35734373 CAGTGAGAGCAGGTGGCACAGGG + Intronic
1165721730 19:38083648-38083670 CAGTGTCTGCAATTTGCACATGG - Intronic
1166410256 19:42552020-42552042 CGGTGTGTGCAGGTGGGATAAGG + Intronic
925164908 2:1709988-1710010 CAGTGTGTGCTGTTTGCATTGGG - Intronic
926748667 2:16181089-16181111 GAGTGTGTGCAGCTGGGATGTGG - Intergenic
928446314 2:31336678-31336700 CAGTGGGTGAAGGAGGCATATGG - Intronic
931675312 2:64689002-64689024 CATTGTGTGGTGTTGGGATATGG - Intronic
933159275 2:79006639-79006661 CAGTGTGTGTTGTTGGCCCAGGG + Intergenic
933941797 2:87251280-87251302 TGCTGTGTGCAGTTGGCATGTGG - Intergenic
935264781 2:101384925-101384947 CAGTGTGTGCAGTGATCACATGG - Intronic
935381244 2:102453032-102453054 CAGTGTGGGCACTTCGCATGAGG - Intergenic
935673942 2:105578322-105578344 CAGTGTTTGCAGTTGGGGTGAGG - Intergenic
936084269 2:109455889-109455911 CAGTGTGTGCAGGTGACAGCAGG - Intronic
936338427 2:111610289-111610311 TGCTGTGTGCAGTTGGCATGTGG + Intergenic
937782263 2:125852591-125852613 CTGTGTGTGCAGGTGGCAGCAGG - Intergenic
938241656 2:129747055-129747077 CAGTGTGTGCAGATTATATATGG + Intergenic
940749796 2:157612536-157612558 CAGTGTGTGGAGTTGGGAAGGGG + Intronic
943416901 2:187619032-187619054 CAGTGTGTGCAGAGATCATATGG + Intergenic
948629011 2:239289817-239289839 CAGTGTGTACAGTAGGGAAACGG - Intronic
1170327265 20:15170750-15170772 CAGTGTTTTCAGTTGTCACAGGG + Intronic
1171816201 20:29787856-29787878 CACTGTGTGCAGGTTGCACAAGG + Intergenic
1171881626 20:30621685-30621707 CAGTGAGTGAGGTTGGCATCTGG - Intergenic
1171902163 20:30868184-30868206 CACTGTGTGCAGGTTGCACAAGG - Intergenic
1173114568 20:40228489-40228511 CAATGTGTGCATTTGGTATTTGG + Intergenic
1173502542 20:43564729-43564751 CAGTGTGTGTGGTGTGCATATGG - Intronic
1175223671 20:57432635-57432657 CAGTGTGTGTGGCTGGCCTAGGG - Intergenic
1176370842 21:6060626-6060648 CAGGCTGTGCAGTTGGCCTGGGG + Intergenic
1177780308 21:25615035-25615057 CAGTGGGTGCAGGTGGCTTTTGG - Intergenic
1178409929 21:32354745-32354767 GACTGTGTGCACTTGGCCTAGGG + Intronic
1179272683 21:39863675-39863697 CAGAGTGTATAGTTGGCATCGGG + Intergenic
1179480321 21:41672785-41672807 GTGTGTGTGTAGTTTGCATATGG - Intergenic
1179752677 21:43477915-43477937 CAGGCTGTGCAGTTGGCCTGGGG - Intergenic
1180335537 22:11574119-11574141 CACTGTGTGCAGGTTGCACAAGG - Intergenic
1180491580 22:15853966-15853988 CAGTGTGCCCAGTGGGCATGGGG - Intergenic
1180593015 22:16956614-16956636 CTGTGTGGGCAGTTCCCATAGGG - Intergenic
1180841429 22:18960635-18960657 CCCTGTGTGCAGATGGCAGATGG - Intergenic
1181060067 22:20278159-20278181 CCCTGTGTGCAGATGGCAGATGG + Intronic
1181408252 22:22700449-22700471 CAGTGTGTGCAGATGTCAATGGG + Intergenic
1181727551 22:24821933-24821955 CAGAGTCTGCAGTTGACATCGGG + Intronic
1183811618 22:40262361-40262383 AAGTGTGTGCTCTTGGCATAAGG + Intronic
949523312 3:4877435-4877457 CAGTTTGCACAGTTTGCATAGGG + Intronic
949837639 3:8286530-8286552 CAATCTGTGGAGTGGGCATAGGG + Intergenic
951492455 3:23286941-23286963 GATTGTTTGCTGTTGGCATATGG + Intronic
953280262 3:41548024-41548046 AAGTGTGTTCAGTGGGCCTAGGG + Intronic
953444918 3:42955027-42955049 CAGTGTTTCCAGTAGGCATAAGG + Intronic
953551356 3:43906334-43906356 TACTGTGTGCAGGTGGCAGAGGG + Intergenic
953697891 3:45173771-45173793 CAGAGTGTGCAGATGACATGAGG + Intergenic
954834160 3:53450450-53450472 CATTGTGGGCAGGTGTCATAGGG + Intergenic
954883880 3:53855216-53855238 GTGTGTGTGCACTTGGCAAAGGG + Intronic
955437119 3:58913252-58913274 CAGTGGGTGGAGGTGGCAAATGG + Intronic
956237324 3:67088400-67088422 GATTGTTTGCTGTTGGCATATGG - Intergenic
956479499 3:69659902-69659924 CACTGTGTGCACTGTGCATAAGG - Intergenic
958998566 3:100935175-100935197 CAGTTTCTGCTTTTGGCATATGG + Intronic
959454894 3:106547387-106547409 CAGAGGCTGCAGTTGGGATAGGG - Intergenic
959806284 3:110557900-110557922 GATTGTTTGCTGTTGGCATATGG + Intergenic
960467135 3:118010306-118010328 CACTCTGTGAAGTTGGCATTTGG - Intergenic
961270799 3:125686445-125686467 CAATCTGTGCAGTTGACATAAGG + Intergenic
961941792 3:130645955-130645977 CAGTATGTGTAGTAGGCATTAGG + Intronic
962500575 3:135987352-135987374 CTGTGTGTGCAGGTGTCATCTGG - Intronic
963015198 3:140817269-140817291 CAGTGGGGGCAGGGGGCATATGG + Intergenic
966192211 3:177281519-177281541 CAGTGTGTGCAGAGGTCACATGG + Intergenic
966861351 3:184232633-184232655 CAGTGTGTGCAGTGTGCAAATGG + Intronic
971349320 4:25842582-25842604 GAGTGTGTGCAGTGGCCCTAGGG + Intronic
971572250 4:28228385-28228407 AAGTCTGTGCTGTTGGGATATGG - Intergenic
973160795 4:47013608-47013630 TCGTGTGTGCAGTTGTCATTTGG + Intronic
976394266 4:84539051-84539073 CAGTGTGTGATGTTTGCATAAGG - Intergenic
976811418 4:89104885-89104907 CACTGTAGGCAGTTGGGATATGG - Intronic
977303774 4:95298366-95298388 CAGTGTGTGCAGTTGGCATAGGG - Intronic
980146430 4:128990778-128990800 CAGACTGTTCAGTTGGCATATGG - Intronic
982178840 4:152731496-152731518 CAGTGTATCCAATTGGCATCTGG - Intronic
982797800 4:159666228-159666250 CAGTGTGCTCTGTTGACATATGG + Intergenic
982830395 4:160052901-160052923 CAGTGTGTGCAGAGATCATATGG + Intergenic
985253061 4:188042447-188042469 CAGGGTGTGCAGTTGGGGTGTGG - Intergenic
985661203 5:1157528-1157550 CAGCGTGGGCAGGTGGCACAGGG - Intergenic
986768599 5:10950693-10950715 CAGTGTGTGCAGAGATCATATGG + Intergenic
986878320 5:12138253-12138275 CATTGTGGGGATTTGGCATAAGG - Intergenic
991116668 5:62963145-62963167 CAGTGTGTGCAGAAGTCACATGG + Intergenic
992321152 5:75614256-75614278 CTGTGTGTGCAGGTGTCATTTGG - Intronic
992337429 5:75786795-75786817 GATTGTTTGCTGTTGGCATATGG - Intergenic
992709537 5:79436500-79436522 AAGTGTGTGCCTTTGGCATGTGG - Intronic
993145770 5:84091614-84091636 CAGTGTCTGCTGTGGACATAAGG + Intronic
995897778 5:117034579-117034601 CAGTGTGTGCACTTAGCCTCTGG + Intergenic
997267117 5:132501345-132501367 CAGGGGGTGCTGTTGCCATAGGG - Intergenic
998108796 5:139485484-139485506 TACTCTGTGCAGTTGGAATATGG + Intergenic
999521728 5:152357856-152357878 TGGTGTGTGCAGATGGCAGATGG - Intergenic
1001026054 5:168225230-168225252 CAATTTGTGCAGGTGGCATTTGG + Intronic
1001601170 5:172929491-172929513 CAGTGTCTCCAGTGGGCATTTGG + Intronic
1002673452 5:180889525-180889547 CAGTGGGTGCAGTTGGTGGAGGG + Intergenic
1002978320 6:2109233-2109255 CAGTGAATGCAGTGGGCATGGGG - Intronic
1003667111 6:8121682-8121704 CAGTGTGGGCAGCAGGCACATGG - Intergenic
1004952092 6:20684475-20684497 CATTGTGTGCAGTTTTTATATGG + Intronic
1004952974 6:20694926-20694948 CAGTGTGTGCAGGGGTCACAGGG - Intronic
1005131549 6:22514185-22514207 CAGAATGTGCAGTTGGAAGAAGG + Intergenic
1005358841 6:25010917-25010939 AAGTGTGTGCAAGTAGCATAGGG + Intronic
1007341915 6:41196043-41196065 CAGAGTTTGTAGTTGGAATAAGG + Intronic
1010042084 6:71396805-71396827 CAGTGTGTGTATTTGGGATACGG - Intergenic
1010811141 6:80300078-80300100 CAGTCTGGGCAGTGGGAATATGG - Intronic
1011535603 6:88372741-88372763 CTGTGTGTGCAGGTGTCATTTGG + Intergenic
1012920975 6:105220911-105220933 CAGAGTGTGCAGTGGGGAAAGGG - Intergenic
1013432629 6:110068710-110068732 CAGTCTCTGAAGTTGGCAGAAGG + Intergenic
1014231345 6:118905945-118905967 TAGTTTGCCCAGTTGGCATAAGG - Intronic
1018442166 6:163823415-163823437 CACTGTGAGCGGTTGGCAAATGG - Intergenic
1022514321 7:30965734-30965756 CAGACTGTGCAGTAGGCAGAAGG + Intronic
1023943131 7:44782821-44782843 CAGTGAGGGCAGATGGCAGAGGG + Intergenic
1024550741 7:50560832-50560854 CAGTGTGTGCAGGTGACACAGGG - Intronic
1025637432 7:63335305-63335327 CAGTGGGTGCAGGTTGCAGAGGG + Intergenic
1025645265 7:63412794-63412816 CAGTGGGTGCAGGTTGCAGAGGG - Intergenic
1027056240 7:75051781-75051803 ATGTGTGTGCAGTGTGCATATGG - Intronic
1028473124 7:91225774-91225796 CAGTGAGTGTATTTTGCATATGG - Intergenic
1033542476 7:142369624-142369646 CAGTCTGTGCATTTGGGTTAGGG - Intergenic
1035965940 8:4191934-4191956 CTGTGGGTGCAGTTGGTTTAAGG - Intronic
1036293477 8:7516380-7516402 CAGTGTGAACAGTTGGGATTTGG + Intergenic
1036329082 8:7804615-7804637 CAGTGTGAACAGTTGGGATTTGG - Intergenic
1038453009 8:27651773-27651795 CAGTGTCTGCAGTTTGCATTAGG - Intronic
1041113922 8:54515679-54515701 CTGTGTGTGGTGTTGGCAGAGGG + Intergenic
1044716513 8:95104696-95104718 TTGTGTGTGCAGTTGCCATTGGG + Intronic
1046671555 8:117062194-117062216 CAGAGTGTGGAGTTAGCAGACGG + Intronic
1046940766 8:119928877-119928899 CACTGTGTCCAGCTGGCATTTGG + Intronic
1047282868 8:123461001-123461023 CAGTGTTTGCAGGTGGTGTATGG + Intronic
1047392156 8:124461118-124461140 CAGTGTGTGCAAGTGCCATGTGG + Intronic
1048418292 8:134251064-134251086 CAGTGTGTCCATTGGGCACAAGG + Intergenic
1048537057 8:135306682-135306704 CAGTGTGAGTTGCTGGCATAAGG + Intergenic
1049696787 8:143987974-143987996 CAGGGTGTGCAGGGGGCATGGGG - Intronic
1051815820 9:21104227-21104249 GATTGTTTGCTGTTGGCATATGG - Intergenic
1052340821 9:27362649-27362671 CAGTGTCTGGAGTTGGCCTGGGG - Intronic
1056089054 9:83186568-83186590 CAGTGTTTGCAGCAGGCAGAAGG - Intergenic
1056320824 9:85433220-85433242 CAGTGGGTGCAGCTCGCAGAGGG + Intergenic
1056779515 9:89538858-89538880 CAGTGTGTGCAGTGGGGTGATGG + Intergenic
1057598744 9:96438870-96438892 CAGAGTGTGTAGTTGGCACTAGG - Intergenic
1058303523 9:103407454-103407476 CAGTGGGTGCAGATGACAAAGGG + Intergenic
1061456036 9:130698434-130698456 AAGAGGGAGCAGTTGGCATATGG + Intronic
1062121773 9:134837689-134837711 GAGGGTGTGCTGTTGGCATCTGG + Intronic
1203367876 Un_KI270442v1:274141-274163 CACTGTGTGCAGGTTGCACAAGG + Intergenic
1186297089 X:8161388-8161410 CAGTGTGTGGTGTTGTTATATGG + Intergenic
1186354912 X:8781185-8781207 CAGTGTGTGGTGTTGTTATATGG - Intergenic
1186377058 X:9015546-9015568 CAGTGTGTGGTGTTGTTATATGG - Intergenic
1188846254 X:35076271-35076293 CAGTGGTGGCAGTTGACATAGGG - Intergenic
1192809453 X:74536302-74536324 CAGAGTGTGGAGTGGGCATGGGG - Intergenic
1195648450 X:107259511-107259533 AAGTGTGTGGTATTGGCATAAGG - Intergenic