ID: 977306963

View in Genome Browser
Species Human (GRCh38)
Location 4:95335763-95335785
Sequence TGTATGTTAGATCTATTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977306961_977306963 -6 Left 977306961 4:95335746-95335768 CCTGCTGTGTGCCAGGCTGTATG 0: 1
1: 1
2: 27
3: 222
4: 1184
Right 977306963 4:95335763-95335785 TGTATGTTAGATCTATTGACTGG 0: 1
1: 0
2: 1
3: 11
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977306963 Original CRISPR TGTATGTTAGATCTATTGAC TGG Intronic
909670770 1:78185883-78185905 TTTATGTGACATCTAGTGACTGG + Intergenic
911109357 1:94166057-94166079 TGTGTGTCAGATCTAATGATGGG - Intronic
917462478 1:175244360-175244382 TGTATGTCAGATCTAATGGTGGG + Intergenic
918958020 1:191236170-191236192 TGTATGTCAGATCTATCGGTGGG + Intergenic
921766004 1:218973264-218973286 AGAATGGTAGATCTACTGACAGG + Intergenic
921909762 1:220535049-220535071 CGTATGTTAGTTCTATTGTTGGG + Intronic
922072909 1:222214130-222214152 TGTGTGTTAGATATGTTCACCGG - Intergenic
922149843 1:222990283-222990305 TGTATTTTATATCTCTTTACAGG + Intronic
923135334 1:231112331-231112353 TGAATGTTAGATCTTTTGTTAGG - Intergenic
923292283 1:232557907-232557929 TGTATGATTTATCTATGGACTGG - Intronic
1068537371 10:58255325-58255347 TGGATGTTTGATCTTTTCACTGG - Intronic
1072367293 10:94725731-94725753 TATATATTATATCTATAGACAGG - Intronic
1072511601 10:96131233-96131255 TGCATGTTAGATCTAGTTACTGG + Intronic
1074640487 10:115373799-115373821 TGTTTATTAGAGATATTGACTGG + Intronic
1076927660 10:133501088-133501110 TGTATGTCAGATCTAATGGTGGG - Intergenic
1077605112 11:3604526-3604548 TGTATGTGTGCTCTACTGACTGG - Intergenic
1079694210 11:23458501-23458523 TGTATTTCAGACCTATTCACAGG + Intergenic
1081394586 11:42571123-42571145 AGCAAGTTAGCTCTATTGACAGG - Intergenic
1086664590 11:89464724-89464746 TGTATCTTAGATACCTTGACAGG - Intronic
1087373815 11:97318884-97318906 TGTATGTCAGATCTAATGGTGGG + Intergenic
1093125129 12:15319619-15319641 TGTTTCTTTGAGCTATTGACTGG - Intronic
1095856470 12:46865542-46865564 TGTATGTCAGATCTAATAATGGG - Intergenic
1099661459 12:85568480-85568502 TGGACATAAGATCTATTGACAGG + Intergenic
1103035323 12:117651859-117651881 TGTATGTCAGATCTAATGGTAGG + Intronic
1105844059 13:24279663-24279685 TGTATGTTTTATCTATTCAGAGG - Intronic
1106906123 13:34411036-34411058 GGTGTGTTAGGACTATTGACTGG - Intergenic
1108790093 13:53959452-53959474 TATATGTTAGATCTATAAAAGGG + Intergenic
1109361226 13:61298022-61298044 TGTTTGTTAGATTTATTAATGGG - Intergenic
1110881251 13:80575590-80575612 TGTATGTGAAATATATTGAGCGG + Intergenic
1111642666 13:90989658-90989680 TATATATTAGATCTTTTGATAGG - Intergenic
1112221788 13:97498441-97498463 TCTATTTCAGATCTCTTGACAGG + Intergenic
1113240645 13:108333123-108333145 TGTATAGTAGAGCTATTGATCGG - Intergenic
1114758511 14:25285733-25285755 TGTATGTCAGATCTAATGGTGGG - Intergenic
1115903731 14:38183936-38183958 TGTAAGCTAGATCTCTTGAGGGG + Intergenic
1118177737 14:63458822-63458844 TTTATTTTAGATCTTTTGAATGG - Intronic
1119107821 14:71940718-71940740 TGTATGTCAGATCTAATGGTGGG - Intronic
1124081577 15:26503346-26503368 TGTATCTTAGATTTATTAAAAGG + Intergenic
1125273209 15:37963222-37963244 TGTATCTCAGATGTTTTGACAGG + Intronic
1127627735 15:60796619-60796641 TCTATGTTTGATTTATTGAGGGG - Intronic
1132213015 15:100039632-100039654 TGCTTGTTAGATTTATTTACTGG + Intronic
1132417872 15:101637067-101637089 TGCATCTTACATGTATTGACTGG - Intronic
1135506206 16:23038648-23038670 TGCACGTTAGATATTTTGACAGG + Intergenic
1137259373 16:46811611-46811633 TGTAAGTTAGATCTAAGGGCTGG - Intronic
1137790276 16:51169215-51169237 AGTATGGTAAATATATTGACTGG - Intergenic
1138390101 16:56663945-56663967 TGTATGTTAAATACAGTGACTGG + Intronic
1139197292 16:64934346-64934368 TGTTTGTTATATCTATTTATTGG - Intergenic
1146270868 17:31484853-31484875 TGTATTTTAGAACTATTGTGAGG - Intronic
1149382704 17:56109760-56109782 TGTTTATTAGAACTGTTGACAGG - Intergenic
1150503753 17:65677177-65677199 TGTATGTGAGATTTACAGACAGG - Intronic
1153676004 18:7456136-7456158 TGAATGTGAGATCTATAGGCTGG - Intergenic
1154367363 18:13723480-13723502 TGTAGGGTAGATCTACAGACAGG + Intronic
1155532780 18:26784116-26784138 TGTATGTCAGACCTACTGAAGGG + Intergenic
1158795595 18:60842237-60842259 TGTATTTTTGATCTTTTGAATGG - Intergenic
1161941978 19:7410860-7410882 ATTATGTTAGTTCTATTGACTGG - Intronic
1162279485 19:9684000-9684022 TGAATGTTGGATAAATTGACTGG - Intergenic
1165097507 19:33417604-33417626 TGTATGTTAAATCATTCGACTGG - Intronic
1165271348 19:34710480-34710502 TGTCTGTTAGATGAATTGAAGGG - Intergenic
925741790 2:7011343-7011365 TGTATGTTATATCTCTAAACTGG + Intronic
925819114 2:7782214-7782236 TTTTTGTTATATCTATTGCCAGG + Intergenic
927082060 2:19640341-19640363 TGTATGGTTGTTCTATTGACTGG + Intergenic
927302870 2:21536147-21536169 AGAATGGTAGATCTATTGACAGG + Intergenic
933110137 2:78387934-78387956 TGAATGTGAGACCTATTGACTGG + Intergenic
934506920 2:94902160-94902182 TGGATGTTAGATATATTTACAGG + Intergenic
935132724 2:100273041-100273063 TGGAAGTTAAATCTAATGACTGG + Intergenic
937785443 2:125889594-125889616 TGTATGTCAGATCTCATGATGGG - Intergenic
938610986 2:132947595-132947617 TGTATGTGAAATCTACTGCCTGG + Intronic
939908977 2:147956200-147956222 TTTATGTTAGATCTCTCAACTGG - Intronic
941118792 2:161504429-161504451 TCTATTTTAGAACTATTGAAAGG + Intronic
946528112 2:220541842-220541864 TGTATGTCAGATCTAATGGTGGG - Intergenic
1170829951 20:19831314-19831336 TGTATGTTAGAAGTATTTAGTGG + Intergenic
1171894493 20:30747485-30747507 TGGATGTTAGAGATATTTACAGG + Intergenic
1177506199 21:22020741-22020763 TGTATGTTAGTTCTATAAAATGG + Intergenic
1178888149 21:36498412-36498434 TGTATTTTACATCTCTTGTCTGG + Intronic
1181868445 22:25878091-25878113 TGTATGTGAGATCTGTTTAATGG + Intronic
951449524 3:22820516-22820538 TCTATGTTAGATATATTCTCTGG - Intergenic
952591101 3:34955054-34955076 TGTATTTTGGATATATTCACTGG + Intergenic
955537357 3:59938462-59938484 TGTATGTTAGATCTCTAGACTGG - Intronic
958990239 3:100834927-100834949 TGTATTTTTGGTCTACTGACAGG + Intronic
960349323 3:116574112-116574134 TGTATGTCAGATCTAATGGTGGG + Intronic
961947763 3:130712149-130712171 TGTATGTTAAGTCTATTAACTGG + Intronic
963220821 3:142809892-142809914 TGTATTTTAGATTTTTTGTCTGG - Intergenic
965085818 3:164096247-164096269 TCTAAGTTAAATCTATTGAATGG + Intergenic
965406151 3:168272263-168272285 TATTTTTTAGATCAATTGACTGG - Intergenic
969874737 4:10127756-10127778 TGTATGTTCCATCTACTGATAGG - Intergenic
977306963 4:95335763-95335785 TGTATGTTAGATCTATTGACTGG + Intronic
980346091 4:131621859-131621881 TGTATTTTATCTCTAGTGACAGG + Intergenic
982077846 4:151756373-151756395 TGTATTTTAAATCTATTTAGAGG + Intronic
984534842 4:180961552-180961574 TTTATCTTAGATCTACAGACAGG - Intergenic
984614422 4:181880289-181880311 TATATGTTAGATTAATTGATAGG + Intergenic
987562342 5:19540380-19540402 AGAATGGTAGATCCATTGACAGG - Intronic
988169430 5:27634698-27634720 TGTATGTCAGATCTAATGGTAGG - Intergenic
993799922 5:92319855-92319877 AGAATGGTAGATCTACTGACAGG + Intergenic
994836889 5:104866272-104866294 TGTATGTCAGATCTAATGGTGGG + Intergenic
995283226 5:110358180-110358202 AGAATGGTAGATCCATTGACAGG + Intronic
997893193 5:137693495-137693517 TGTATGTTTGATCTAGAGGCAGG - Intronic
1005441823 6:25877928-25877950 TGTTTGCTACATCTATTCACTGG + Intronic
1011675175 6:89725900-89725922 TGTATGTTAGAGATTTTGTCTGG + Intronic
1012539855 6:100349811-100349833 TGTATGTTAGAATTAATGGCAGG - Intergenic
1012820554 6:104081043-104081065 TGTATGTCAGATCTAATTATGGG + Intergenic
1014456083 6:121636440-121636462 TGTATGTCAGATCTAATGGTGGG - Intergenic
1014534448 6:122598506-122598528 TGTATGTCAGATCTAATGGTGGG - Intronic
1016384302 6:143515750-143515772 TGTGTGTTAGATCAATTCAGGGG + Intergenic
1016722082 6:147311055-147311077 TGTATTTTACAGTTATTGACAGG + Intronic
1017386618 6:153892116-153892138 TGTATGTGAGATTTATTAATTGG + Intergenic
1018769607 6:166959114-166959136 AGTGTGTTATTTCTATTGACTGG + Intergenic
1020723498 7:11779580-11779602 TGTAAGTTAGAAATATTAACTGG - Intronic
1021022810 7:15624709-15624731 TGTAGGTTAGAGATTTTGACTGG - Intronic
1022329519 7:29364057-29364079 TGTATGTTAGCTCTATGTCCTGG + Intronic
1025761924 7:64403624-64403646 TGTATGTCAGATCTAATGGTGGG + Intergenic
1026180280 7:68033449-68033471 TGTGTGTTAGATTTTTTAACTGG - Intergenic
1029918501 7:104237387-104237409 TTTTTGTTAGATCTATTCATGGG - Intergenic
1031232680 7:119129564-119129586 TGTTTATTAGATCTATTGTGGGG + Intergenic
1034201099 7:149283475-149283497 GGTGTGTAAGATCCATTGACTGG + Exonic
1039250518 8:35659214-35659236 TGTATATTAAATCTAATGAAGGG + Intronic
1040916391 8:52569720-52569742 TGTATGTCAGATCTAATGGTGGG - Intergenic
1040945114 8:52876112-52876134 TGTATGTGATTTCTATTGATGGG + Intergenic
1041283174 8:56232091-56232113 TTTATGTTAGAAATATTGGCAGG + Intergenic
1041995637 8:64053790-64053812 TATATGTTAGTGCTATTAACAGG + Intergenic
1042282453 8:67068955-67068977 TATATTTTAGATTTATTGAGTGG + Intronic
1046604252 8:116353327-116353349 TGTAAGTTATATTTATTGACTGG - Intergenic
1050171087 9:2817489-2817511 TGTTTGTGAGATTTATTGTCAGG - Intronic
1051441451 9:17087543-17087565 GGTATGTTACATCTATTCAGTGG - Intergenic
1051966169 9:22832353-22832375 TGTATGTCAGATCTAATGGTGGG + Intergenic
1054354151 9:64045284-64045306 TGGATGTTAGACATATTTACAGG - Intergenic
1055725212 9:79220382-79220404 TGTGTGTGTGTTCTATTGACTGG - Intergenic
1059358669 9:113721291-113721313 TGTATGATAGATCTCTTGAAAGG + Intergenic
1061523870 9:131141091-131141113 TAAATGTTATATTTATTGACAGG + Intronic
1203742485 Un_GL000218v1:14395-14417 TGGATGTTAGACATATTTACAGG - Intergenic
1203567615 Un_KI270744v1:105024-105046 TGGATGTTAGACATATTTACAGG + Intergenic
1186470023 X:9813968-9813990 TGTATGTCAGATCTAATGGTGGG - Intronic
1188102179 X:26102690-26102712 TGTATCTCAGATCTTTTGAAAGG + Intergenic
1192297959 X:69869874-69869896 TGTATGTCAGATCTAATGGTGGG - Intronic
1193177844 X:78415535-78415557 TTTATTTTAAATATATTGACAGG - Intergenic
1194767957 X:97864535-97864557 TTAATGTGAGATTTATTGACAGG - Intergenic
1195480850 X:105343014-105343036 GCTATGTTAGATCTATTGCCTGG - Intronic
1195782613 X:108481755-108481777 TGTATGTCAGATCTAATGGTGGG - Intronic
1196884957 X:120235613-120235635 TGTATCTTACATATATTGATCGG + Intergenic
1199536584 X:148909211-148909233 TGGATATGAGATCCATTGACAGG + Intronic
1199627327 X:149752481-149752503 TGTATGTCAGATCTAATGGTGGG - Intergenic
1200330005 X:155285631-155285653 TGTATATTAGATCTGTTGCCTGG + Intronic
1201156012 Y:11131869-11131891 TGGATGTTAGACATATTTACAGG - Intergenic
1202100197 Y:21299541-21299563 TGTATGTCAGATCTAACGGCAGG + Intergenic