ID: 977313167

View in Genome Browser
Species Human (GRCh38)
Location 4:95412243-95412265
Sequence GTGGTGAAGAGGATTGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 391}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977313167 Original CRISPR GTGGTGAAGAGGATTGAGAA GGG (reversed) Intronic
902777286 1:18682907-18682929 GTGGAGAAGGGGATTGAGTGAGG - Intronic
902991090 1:20187367-20187389 GTGGTGAAGTGAACTGAGCAGGG + Intronic
903282658 1:22258827-22258849 GGGGAGAAGAGGAGGGAGAAAGG - Intergenic
903516375 1:23913681-23913703 GTGGTGAAGAGGCATTGGAATGG - Intergenic
903851840 1:26311937-26311959 GTGGTGATGTGGGTGGAGAAGGG - Intronic
905256565 1:36688818-36688840 GAGGTGAAGAGGTGTGTGAAGGG + Intergenic
905406149 1:37733725-37733747 TTGGGGGAGAGGAATGAGAAGGG - Intronic
905997553 1:42394601-42394623 GTTGTTATGATGATTGAGAATGG + Intronic
906922076 1:50075469-50075491 GTACTGAAGAGGAAGGAGAAGGG + Intronic
906950462 1:50331189-50331211 GTGGTGAAGAGGATGGATTCTGG - Intergenic
907464070 1:54623578-54623600 GTGGGGAAGAGGATTGGGGCGGG - Intronic
907475948 1:54705597-54705619 GAGGTGAAGAAGAGTGGGAAGGG + Intronic
909324594 1:74334415-74334437 GTGGTCAAGACAATTGAGAGGGG + Intronic
910107880 1:83651246-83651268 GTGATGGAGAGGAATGAGGAAGG + Intergenic
910650366 1:89559944-89559966 GGAGTGGTGAGGATTGAGAAGGG - Intronic
910832435 1:91474275-91474297 GTGCAAAAGAGGAATGAGAAGGG - Intergenic
913216872 1:116628107-116628129 GAAGTGGAGAGGATGGAGAAAGG + Intronic
913502356 1:119482981-119483003 GTGTTTAAGAAGATTGAAAAAGG - Intergenic
914258958 1:145982849-145982871 GAGGAGGAGAGGTTTGAGAATGG - Intergenic
915599985 1:156916040-156916062 GGGGTGCAGAGGCTGGAGAAAGG + Exonic
916687764 1:167162647-167162669 CTGGTGAAGTGGATTCAGAGGGG - Intergenic
917046232 1:170863805-170863827 CTGGTGATGATGATTCAGAATGG + Intergenic
917402929 1:174671364-174671386 GTGTTGAATAGAAGTGAGAATGG + Intronic
917510705 1:175667094-175667116 GTGGTGAAGAAGGATGAGGAAGG - Intronic
917651332 1:177080738-177080760 GTAGTGAAGGGGAAAGAGAATGG + Intronic
918667131 1:187165316-187165338 GCGGTGAAGAGTATTTAGGAGGG - Intergenic
919782188 1:201228300-201228322 GTGGTGAAGAAAACTCAGAATGG - Intronic
920081168 1:203373803-203373825 GTGGTGAAGAGGAAGGAGAGTGG - Intergenic
920432564 1:205928179-205928201 GTGGTGCTGAGGATTCAGACTGG - Intronic
920448594 1:206039471-206039493 ATGAGGAAGAGGATGGAGAAGGG + Intronic
920666441 1:207966051-207966073 GTGGTGAAGAGGGAGGATAAAGG - Intergenic
920928424 1:210364763-210364785 GTTGTGGAGAGCACTGAGAAGGG - Intronic
921068609 1:211640501-211640523 GTGGAGGGGAGGATTGGGAAGGG + Intergenic
921819115 1:219596437-219596459 CTGGAAAAGAGGAGTGAGAAGGG + Intergenic
922319427 1:224472630-224472652 CTGGGGAAAAGGATTGAGGATGG + Intronic
922322605 1:224501940-224501962 GTGGTGAGGAGGCTGGAGGAAGG + Intronic
923014101 1:230112654-230112676 GTGGGGATGAGGATGGCGAAGGG + Intronic
924669454 1:246108604-246108626 GTGGTGAATAGAATGAAGAATGG - Intronic
1063143625 10:3276666-3276688 ATGGTGAAGAATTTTGAGAAAGG - Intergenic
1063361612 10:5463686-5463708 GGGGTGCAGAGGATTCAGGATGG - Intergenic
1064088935 10:12366999-12367021 GTGGTCATGAGGATAGAGATGGG - Intronic
1064756120 10:18573040-18573062 ATGGAGAAGAGAATGGAGAATGG - Intronic
1065283657 10:24165997-24166019 GTGGGGAGGAGGATGGAGCATGG - Intronic
1066508825 10:36072791-36072813 GTGGTGGTGAGGATGGGGAAAGG + Intergenic
1067345091 10:45432041-45432063 GTGGTGAAGAGGAACTAAAAAGG + Intronic
1067731232 10:48812890-48812912 GTGGGAAAGAGGAGTGAGTAAGG - Intronic
1069136554 10:64773436-64773458 GTGGGCAAGAGGATGGGGAATGG + Intergenic
1069509786 10:69033442-69033464 GTGGTGGAGGGGAATGAGTAGGG - Intergenic
1070494825 10:77011915-77011937 TTGGGGAATAGGAATGAGAAAGG + Intronic
1070502539 10:77085044-77085066 ATGGTGCAGATGGTTGAGAAAGG - Intronic
1070577960 10:77694172-77694194 GTGGTGAGGAGAATTGAAAGGGG + Intergenic
1073483370 10:103800990-103801012 GTGGTGAAGAGGCGGGAGGATGG - Intronic
1074111999 10:110429332-110429354 GTGGTGAAGATGAAAGAAAAAGG - Intergenic
1074532494 10:114306641-114306663 GTGGTCCAGAGGATTGTGACGGG - Intronic
1078403437 11:11047299-11047321 CTGGTGAAGAGGGTTGGGAAGGG + Intergenic
1079132719 11:17757170-17757192 GTGGTTATGAGGATTAAAAAGGG + Intronic
1080741129 11:35065253-35065275 GTGAGGAGGAGGATTAAGAAAGG - Intergenic
1080749282 11:35138149-35138171 GTGGAGAAGAGGATGGTGGATGG + Intergenic
1081106872 11:39080856-39080878 GAGAAGAAGAGGATTGAGAGAGG + Intergenic
1081716798 11:45256232-45256254 GTGGAGAAGAGGAGGGAGGAAGG - Intronic
1082044074 11:47710744-47710766 CTGGTGTAGTGGAGTGAGAAAGG + Intronic
1083414046 11:62513814-62513836 GTGGTGGGTAGGATGGAGAAGGG - Intronic
1085178163 11:74508729-74508751 GTGGAGAACAGGCTTGAGGAAGG + Intronic
1085249187 11:75130945-75130967 GTGGAGAACAGGTGTGAGAATGG + Intronic
1085318644 11:75561445-75561467 GGGGTGACAAGGATTGAGGAAGG + Intergenic
1085836886 11:79966562-79966584 GTGGTGAGCAGGATAGGGAAAGG + Intergenic
1086077793 11:82872942-82872964 GTGGTGAACAAGAGAGAGAATGG + Intronic
1086274507 11:85109905-85109927 TTGGTAAAGAGGATTAATAATGG - Intronic
1087550601 11:99642735-99642757 GGGGAGAAGAGGATGGAGAAAGG - Intronic
1088972713 11:114787792-114787814 GTTGAGGAGAGGCTTGAGAAAGG - Intergenic
1089625576 11:119748814-119748836 GTGGTGAGAAGGACAGAGAAGGG + Intergenic
1090097213 11:123754129-123754151 GTGGTGAAGGGGATTGCAGATGG + Exonic
1090373892 11:126275737-126275759 GTGCTGAAGAGGAATGAAATGGG - Intronic
1090829331 11:130410062-130410084 GTGGTGGAAAGGTGTGAGAAGGG - Intronic
1091553204 12:1552508-1552530 GGGGTGAAAAGGACGGAGAATGG - Intronic
1091652530 12:2320587-2320609 GTGGTATAGAGGAAGGAGAAGGG + Intronic
1092127919 12:6088165-6088187 GTGGTGAAGTTTCTTGAGAAAGG + Intronic
1092202210 12:6592818-6592840 CTGGTGAAGCAGATGGAGAAAGG + Intronic
1093511188 12:19930309-19930331 GTGGAGAAGAGGCATAAGAAAGG - Intergenic
1095208160 12:39462100-39462122 GAGCTGAAGGGGATTGAGATGGG + Intergenic
1095262116 12:40108754-40108776 GTGGGAAAGACGATTGAGAAGGG - Intergenic
1096665366 12:53160658-53160680 ATGGTAAAGAGAATAGAGAAAGG + Intronic
1096705182 12:53416460-53416482 GTATTGAAGAGGGTTGGGAATGG + Intergenic
1096798213 12:54091671-54091693 GTGGTAAGGAGGATTGAGGCTGG + Intergenic
1096980450 12:55725648-55725670 GGGGTGGAGAGGAGTCAGAAGGG + Intronic
1097591058 12:61575925-61575947 GTGGTGAAGAGGAAGGGAAAAGG + Intergenic
1098823368 12:75261462-75261484 GTGCAGAAAAGGATTGTGAAAGG - Intergenic
1099305440 12:80949129-80949151 GCATTTAAGAGGATTGAGAATGG - Intronic
1099311583 12:81032878-81032900 GAGGTGAATAGGATTGGGAAAGG + Intronic
1099391775 12:82089592-82089614 TTGTTGAAGTGGATTCAGAATGG - Intergenic
1099855314 12:88157226-88157248 GTGGTTAAGAGGATAAAGAGAGG - Intronic
1100181960 12:92095624-92095646 GTGGTGGATTGGATGGAGAATGG - Intronic
1100414774 12:94360232-94360254 GTGTTGAATAAGATTGACAAGGG - Intronic
1101050907 12:100863058-100863080 GGGGTGAAGAGGAGCTAGAAAGG + Intronic
1101413832 12:104491781-104491803 GTGCTGAAGTGTTTTGAGAAGGG - Intronic
1101799824 12:108011508-108011530 GTGGTGAACAGGAGTGAGGAAGG - Intergenic
1101998323 12:109540894-109540916 GTGGTGAGGAGGTATGAGAGCGG + Intergenic
1103733572 12:123044220-123044242 GAGGTGACCAGGAGTGAGAAAGG - Intronic
1104062579 12:125281068-125281090 GGGGTGGAGAGGGGTGAGAAAGG + Intronic
1104263635 12:127209748-127209770 GTGGTGAGGAGGAGGGAGAGAGG + Intergenic
1104793189 12:131496932-131496954 GTGGAGCAGAGAACTGAGAAAGG + Intergenic
1105683338 13:22752233-22752255 GTGGGGAAGAGAGTGGAGAATGG - Intergenic
1106671683 13:31912797-31912819 GAGGTCAAAAGGATTGAGAGAGG - Intergenic
1106847713 13:33754322-33754344 GTGGTGAAGAGCATGGACACTGG - Intergenic
1107340586 13:39400892-39400914 GTAGTGAAAAGGAATGATAAAGG - Intronic
1107663786 13:42667722-42667744 GTGTTGAAGAGGAATGGTAAGGG - Intergenic
1108563144 13:51666510-51666532 GTGGAGAAGAGGATGGAGGGAGG + Intronic
1108732148 13:53246327-53246349 GTGAAGAAGAGGAGAGAGAAAGG - Intergenic
1109342651 13:61080703-61080725 GAAGTGAAGTGGATTGAAAAGGG + Intergenic
1110234401 13:73201315-73201337 AGGGTGAAGAGGTTTGTGAAAGG + Intergenic
1110871404 13:80456577-80456599 GTGGGGAAGGGGGTTGAGATGGG - Intergenic
1111137896 13:84073942-84073964 GTGGTGAATATTATTGGGAAAGG + Intergenic
1112503511 13:99959533-99959555 GTGGTCAAAAGGAGCGAGAAGGG + Intergenic
1112739109 13:102454108-102454130 GTGGCGATGAGAATTAAGAAGGG + Intergenic
1113198144 13:107833593-107833615 GTAATGGAAAGGATTGAGAAGGG - Intronic
1114311664 14:21473152-21473174 GTGGTGAGGAGCATTGGGGAGGG + Intronic
1114712645 14:24794153-24794175 GATGTGAAAAGGAGTGAGAATGG - Intergenic
1115172276 14:30522915-30522937 TTGGTCAAGAGGAGTGAGAATGG + Intergenic
1115637170 14:35301138-35301160 GCAGTGAAGAAGATTGAGAAGGG + Intronic
1116414780 14:44667021-44667043 CTGGAGAAGAGGCATGAGAATGG + Intergenic
1116657569 14:47672579-47672601 GGGGTGATGAGAAGTGAGAAAGG - Intronic
1120129331 14:80786711-80786733 GTGATGAAGATTAGTGAGAAAGG + Intronic
1122416562 14:101552496-101552518 CTGGTGAGGAGGATTGAGTTGGG + Intergenic
1122519592 14:102334070-102334092 GTGGTGCAGAGGATGGGGCAGGG - Intronic
1123892392 15:24794540-24794562 GTGCTGAGGAGGAGTGAGAGTGG + Intergenic
1124863440 15:33465751-33465773 GTGGTGAAGAGGATGCAAGATGG + Intronic
1125413427 15:39428567-39428589 ATGGTGAAGTGGAATGATAATGG - Intergenic
1125434947 15:39634639-39634661 GTGGTGAAGACAATGAAGAAAGG - Intronic
1125499633 15:40231340-40231362 GTGGTGAGATGGATTTAGAAAGG + Intergenic
1127649595 15:60994435-60994457 GTTTTGAATAGGCTTGAGAATGG - Intronic
1127730736 15:61799996-61800018 GTGGTGAAAAGGAGAGAGAGGGG - Intergenic
1128179144 15:65585870-65585892 GGGCTGAAGAGGGTTGACAAAGG - Intronic
1128224857 15:65994513-65994535 GTGGGAAAGAGGAGTGAGAGAGG + Intronic
1129922247 15:79329234-79329256 CTGGTGATGTGTATTGAGAAGGG - Intronic
1131382909 15:91978997-91979019 CAAGTGAAGAGAATTGAGAATGG - Intronic
1131417613 15:92274264-92274286 GATGTGAAGAGGATTGAAAGAGG - Intergenic
1131442547 15:92469871-92469893 ATGGTGAGGAAGACTGAGAAAGG - Intergenic
1134594407 16:15484306-15484328 GTGGTCAAGAGGCAGGAGAAGGG - Intronic
1134887721 16:17808702-17808724 GGGGTGATGAGAATTTAGAAGGG + Intergenic
1135633553 16:24055184-24055206 GTGGAGAAGATGATTGTGAAAGG - Intronic
1136626900 16:31466848-31466870 GTGGTGATGGGGATTGAGTTGGG + Exonic
1137292431 16:47061094-47061116 GTGGTGGAGAGGCTTGAAATGGG - Intergenic
1138207427 16:55135101-55135123 GAGGTGATGAGGATTCTGAAGGG - Intergenic
1139333169 16:66210052-66210074 GTGGAGAAGAGGATTCAAAGTGG - Intergenic
1140143338 16:72281170-72281192 ATGGGGAAGAGGTTGGAGAAGGG + Intergenic
1140846027 16:78888975-78888997 GTGGTGAGGAGGACTGACCAGGG - Intronic
1140997627 16:80276861-80276883 GTGATTAAGAAGATTGAGATGGG + Intergenic
1141275453 16:82583662-82583684 GAGATGAAGAGGATGGAGACAGG - Intergenic
1143186849 17:5015141-5015163 GTGGTGAACAAGATCAAGAAGGG - Intronic
1143377278 17:6474266-6474288 GTGGGGAAGAGGAGGGAGAGAGG - Intronic
1145217994 17:21066575-21066597 GTGGTGCAGAGGAGAGAGGAGGG + Intergenic
1147448973 17:40491966-40491988 GTGTTGGAGAGGATAAAGAAAGG + Intronic
1147607549 17:41782760-41782782 GGGGAGAAGAGAATTCAGAAGGG - Intronic
1148550388 17:48546791-48546813 GGGGAGAGGAGGATGGAGAAAGG + Intergenic
1149552320 17:57549392-57549414 GTGGTTGAGAGTATGGAGAAGGG + Intronic
1150815672 17:68390246-68390268 GTGGCGAGGAGGATGCAGAAAGG - Intronic
1152002148 17:77653698-77653720 GTGGTGAAGAAGGTGGAGAGAGG - Intergenic
1153779239 18:8479474-8479496 GTGGTGCAAAGGAGAGAGAAAGG - Intergenic
1155433791 18:25790035-25790057 GTTGAGAAGAATATTGAGAAAGG + Intergenic
1157069958 18:44394741-44394763 GGGCTGAAGTGGTTTGAGAAAGG + Intergenic
1157112163 18:44831651-44831673 GTTATGAAGAGGAGTGAGTAAGG + Intronic
1157966068 18:52209754-52209776 GTGGAGAAGAGGAGGGTGAAAGG - Intergenic
1159067877 18:63589798-63589820 CTGGGGAAAAGGACTGAGAAAGG + Intronic
1161200831 19:3013873-3013895 GTCGGGAGGAGGATAGAGAAGGG - Intronic
1162246595 19:9406764-9406786 CTGATGAAGAGGCTTGGGAAAGG + Intergenic
1164441576 19:28283809-28283831 GTGGAGAAGAAGGTGGAGAAAGG - Intergenic
1164579834 19:29428046-29428068 GTGGTGGGGAGGATAGAGGAAGG - Intergenic
1165750026 19:38253773-38253795 GTGGTGAAGGGGCTTCAGCAAGG + Intronic
1166139889 19:40799998-40800020 GTGGTGTGGAGGAGTGGGAAAGG - Exonic
1166917708 19:46206959-46206981 GTGGGTGAGAGGATTGAGATGGG - Intergenic
1167789379 19:51663615-51663637 GTGGTGAGGAGGAAAAAGAAAGG - Intergenic
925869932 2:8261302-8261324 GTGGTGAGATGGAATGAGAAAGG + Intergenic
926351006 2:11994297-11994319 GTGGTCCAGAGGACAGAGAATGG + Intergenic
926355275 2:12035763-12035785 GAGGTGATGAGGGGTGAGAAGGG - Intergenic
926382289 2:12302611-12302633 TTGGCTAAGAGGATGGAGAAGGG - Intergenic
927241876 2:20926333-20926355 GTGGAGAACAGGATTGTGATGGG + Intergenic
927642750 2:24855745-24855767 GTGGGGTAGAGAGTTGAGAAGGG + Intronic
929279358 2:40061257-40061279 GTGAGGAGGAGGATTGAGGACGG - Intergenic
929918544 2:46155783-46155805 GTGGGGAGAAGGATGGAGAAAGG - Intronic
930389866 2:50747097-50747119 GTGGTAAAGAAGATAGAGACCGG + Intronic
930590445 2:53320728-53320750 GGAGTGAAGTGGATTGATAAGGG - Intergenic
931019511 2:58027539-58027561 GTGGTGAAAAGGGTTGGAAAGGG + Intronic
931155650 2:59625846-59625868 GTGTTGAGGAGGAGTGATAAAGG - Intergenic
931265163 2:60653979-60654001 GAGGAGAAGAAGATGGAGAAAGG + Intergenic
931774296 2:65527022-65527044 GTGGCAAATAGGATTGGGAAAGG - Intergenic
933039033 2:77437866-77437888 GAGGTGAGGAGGAATGAGTAGGG + Intronic
934730325 2:96652486-96652508 GTGGCGGAGAGGACTCAGAAGGG + Intergenic
935711003 2:105898293-105898315 CTGGTGAAGAAGATTGAAACTGG - Intergenic
935755067 2:106270463-106270485 GGGGTGATCAGGATTGGGAAGGG - Intergenic
936286714 2:111186911-111186933 GTGGTGTAGAGGGATGAGCATGG + Intergenic
936406848 2:112212419-112212441 TTGGTGAAGAGGATGGCGAGGGG + Exonic
936693446 2:114920141-114920163 GGGGTGGAGAGGATTGACAGTGG + Intronic
939320208 2:140610109-140610131 TAGGTGAAGAGGATGGACAAAGG - Intronic
940992302 2:160110445-160110467 GAGGTGATGAGGATAGAAAAGGG - Intronic
942694073 2:178619047-178619069 GGAGAGTAGAGGATTGAGAATGG + Intronic
943521223 2:188951275-188951297 GTGGTGGAGGGGATTGGGAGGGG - Intergenic
943896052 2:193361473-193361495 GTAGTCAAGAGGATAGAAAATGG - Intergenic
944472535 2:200069833-200069855 ATGTTGAAGAGAAATGAGAATGG - Intergenic
944544892 2:200789428-200789450 ATGGTGAAGATGATTGAGTCAGG + Intergenic
944584017 2:201157833-201157855 GTGGTGAGGTGGAGTGGGAAGGG - Intronic
945285997 2:208082312-208082334 GTGGGGAAGGGGCTTGAGATGGG - Intergenic
945639142 2:212400246-212400268 GTGGGGAAGAGGATTTGGAAGGG + Intronic
946056646 2:216908624-216908646 GTGTTGAGGAGGCTTGAGAAAGG - Intergenic
946555116 2:220847831-220847853 ATGATGGAGAGGAATGAGAAGGG + Intergenic
946800337 2:223408764-223408786 GGAGAGAAGAGGATTGGGAAGGG - Intergenic
947348863 2:229221805-229221827 GTGGTTAAGAGGAATGGGGAGGG - Intronic
1168984619 20:2037601-2037623 GTGGTTAAGAGCATGGAGTATGG - Intergenic
1169047120 20:2542278-2542300 GTGGAGAAGAAGCTTGACAAAGG + Intronic
1169173145 20:3483024-3483046 ACGGTGAAGAGGATTAAGAAGGG - Intronic
1169651321 20:7870892-7870914 GTGGAGAAGAGGGAAGAGAAGGG - Intergenic
1170355281 20:15485730-15485752 GTGGTTAAGAGGAATGAGCCAGG + Intronic
1170460249 20:16571142-16571164 GAGGTGAACAGGTTTGAGGAAGG - Intronic
1170496449 20:16929757-16929779 ATTGTGAAGGGGATTGTGAAGGG + Intergenic
1170879094 20:20278668-20278690 GTGCTGCTAAGGATTGAGAATGG + Intronic
1171798192 20:29582670-29582692 GTGGTAAGGAGGATTGAGGCTGG - Intergenic
1171850044 20:30301491-30301513 GTGGTAAGGAGGATTGAGGCTGG + Intergenic
1172149857 20:32782430-32782452 GAGTTGAAGTTGATTGAGAAAGG + Intronic
1172292132 20:33784120-33784142 ATGGGGAAGAGGAGGGAGAAGGG - Intronic
1172298357 20:33830158-33830180 GTGGTGAAGAGGAAGATGAAAGG + Intronic
1173826894 20:46053549-46053571 GCGATGAAGGGGATTCAGAAAGG - Intronic
1174151439 20:48489071-48489093 GTGGAGCAGAGGAATCAGAAGGG + Intergenic
1174985282 20:55444656-55444678 GAGGAGGAGATGATTGAGAAGGG + Intergenic
1176051272 20:63120845-63120867 TTGGGGAGGAGGATGGAGAATGG - Intergenic
1176791963 21:13328452-13328474 ATGGTGAACAGGAATGGGAATGG - Intergenic
1177265853 21:18782767-18782789 GTGGTGAAGAGGCTTGATAAAGG - Intergenic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178021665 21:28415281-28415303 GTGGTGGAGAGGAAAGAGAATGG + Intergenic
1180626870 22:17199425-17199447 GAGGGGAAGAGGATAGAGGAGGG - Intronic
1180861083 22:19083388-19083410 GTGAAGAAGAGGAATGAGGAGGG - Intronic
1182108585 22:27706652-27706674 GTGGAGAAGGGGGTTGGGAAAGG - Intergenic
1183237832 22:36632921-36632943 GTGGCAAAGAAGATTGGGAAGGG - Intronic
1183394242 22:37562163-37562185 GGGGTGAAGACGATGGGGAATGG - Intronic
950290924 3:11783763-11783785 GTGGTTAAGAGCACTGAGACCGG + Intergenic
951719906 3:25687582-25687604 GATTTGAAGAGGATGGAGAAGGG - Intergenic
952676918 3:36043677-36043699 GAGGTGAAGATATTTGAGAATGG + Intergenic
954081549 3:48215138-48215160 GTGGTAAAGAGGCTTGCAAACGG + Intergenic
954429143 3:50459958-50459980 GTGCTGAAGAGGATGGAGGGTGG - Intronic
955997934 3:64696724-64696746 GTGGAGGAGATGATTTAGAATGG + Intergenic
956537394 3:70291678-70291700 GTGTTGAAGAGGATTCTGAGTGG - Intergenic
956622426 3:71234741-71234763 GTGGATAAGATGATTGAAAATGG + Intronic
956921573 3:73935290-73935312 GAAGTGAGGAGGATTGGGAATGG + Intergenic
957396915 3:79652316-79652338 GTGTGGAAGAGGTCTGAGAATGG - Intronic
957491842 3:80937479-80937501 CTAGGGAAGAGGATTGTGAATGG - Intergenic
957736294 3:84207826-84207848 GTGATTAAGAGCATTGACAATGG + Intergenic
957944377 3:87043931-87043953 GTGGAAAAGAGGGATGAGAAAGG + Intergenic
958487591 3:94731845-94731867 TTGGGGAAGAGGTATGAGAATGG - Intergenic
958861335 3:99448377-99448399 TGGCTGAAGAGGATGGAGAAGGG - Intergenic
958945954 3:100362257-100362279 GTAGTGAAGGGTCTTGAGAAGGG - Intergenic
960001310 3:112734927-112734949 GTGGTGAAGTGGAGTGAAACTGG - Intergenic
961001999 3:123380259-123380281 GTGGTGAACAGGCTTGAGTAGGG + Intronic
961054607 3:123777617-123777639 GAGGCGAAGAGCAGTGAGAAGGG + Intronic
961824242 3:129590463-129590485 GTGGTGCAGAGGAGTGAAAAGGG + Intronic
962035507 3:131647387-131647409 GTGGAGAAGAGCATTGGCAAAGG + Intronic
962599632 3:136981822-136981844 GTGGTGAATGGTTTTGAGAATGG + Intronic
963618128 3:147569764-147569786 GTGTTGAATAGAAGTGAGAATGG + Intergenic
963670195 3:148241828-148241850 GTGGTGAAGAAGAGAAAGAAGGG + Intergenic
965147895 3:164929330-164929352 GTGGGGAAGGGGATAGAGAGAGG - Intergenic
965936218 3:174116199-174116221 GTGGTGTACAGCAATGAGAATGG - Intronic
967477053 3:189934219-189934241 GTGGTGAAGGGGAGTGATCAGGG - Intergenic
967493171 3:190116489-190116511 GAGGTGTAGAGGCTTTAGAATGG - Intronic
968227672 3:196985322-196985344 GTGGGGAAGAGGAATGAAACAGG + Intergenic
968263562 3:197344324-197344346 GGAGTGAAGAGGAGAGAGAATGG - Intergenic
968535491 4:1125222-1125244 GTGGAGAAAAGGATGAAGAAGGG + Intergenic
969347716 4:6579724-6579746 GTGGTGATGATGATTGTGGAGGG - Intronic
970073056 4:12184227-12184249 GTGATCATGAGGATTGTGAATGG - Intergenic
970415784 4:15855601-15855623 ATGGAGAAGAGGGTAGAGAATGG + Intergenic
971605335 4:28651350-28651372 CTGGTGAGGAGTTTTGAGAAAGG + Intergenic
972229466 4:37054583-37054605 GTGGAGAAGAGTTTGGAGAAAGG - Intergenic
972337405 4:38119731-38119753 GTCATGAAGAGGAGTGAGGATGG + Intronic
972465148 4:39348575-39348597 GAATTGAAGAGGATGGAGAAAGG + Intronic
974099863 4:57404837-57404859 GTGGAGAAAGGGAATGAGAAGGG + Intergenic
975104615 4:70553763-70553785 GTGGTGAACAGGAAAGACAATGG - Intergenic
975949997 4:79758883-79758905 ATGGTGAAGAGGACTGGAAAGGG - Intergenic
976133937 4:81914289-81914311 GTGCTGAAGAGGATTAAAAGAGG - Intronic
976493139 4:85694425-85694447 GTGGTGAATAGGACAGATAAAGG - Intronic
977051687 4:92136186-92136208 GTGGGGAAGGGGATGTAGAAAGG + Intergenic
977103235 4:92845591-92845613 GAGGTAAAGGAGATTGAGAAGGG - Intronic
977313167 4:95412243-95412265 GTGGTGAAGAGGATTGAGAAGGG - Intronic
978324709 4:107539472-107539494 GTTGTGAAAAGGTTTTAGAATGG - Intergenic
979480776 4:121214447-121214469 GTGGAGAAGAGGCAAGAGAATGG + Intronic
979676417 4:123414496-123414518 GTGGTGATGATGATAGAGAAAGG + Intergenic
982235633 4:153249089-153249111 GTGGGGAAGAGGAGGGAGTAAGG - Intronic
983317845 4:166154836-166154858 GTGGCTAAGAGGAGAGAGAAGGG + Intergenic
983381332 4:166998289-166998311 GTGGTGGAGAGGGTTCAGAGGGG - Intronic
983689401 4:170450356-170450378 GTGGAGAATAGTATGGAGAAGGG - Intergenic
983715839 4:170780227-170780249 GAAGGGAAGAGGAGTGAGAAGGG + Intergenic
983922089 4:173357110-173357132 GTGGAGATTAGGATTGAGGAAGG + Intergenic
984296407 4:177860383-177860405 GAGGTGTAGAGGAGTGAGGAGGG + Intronic
985265768 4:188152768-188152790 GTTGAGAAGGGGATTGAGAGTGG + Intergenic
987134100 5:14884911-14884933 GTGGAGAAGAGGCTGGGGAAGGG + Intergenic
987209824 5:15669566-15669588 GTGGTGGAGAGGTGGGAGAAAGG - Intronic
987888623 5:23845553-23845575 GTGGGGAGGAGGATTAAGAGAGG + Intergenic
988562973 5:32297498-32297520 GTGAAGAAAAGGATTTAGAATGG - Intronic
990403660 5:55466158-55466180 GTGGTGAGGAGGACTGATATGGG - Intronic
994242781 5:97444240-97444262 TTGGTGAAGAGATTTGGGAACGG + Intergenic
994271700 5:97784911-97784933 GTGGAGAAGGGGATAGATAATGG - Intergenic
995259383 5:110084046-110084068 GTGGAGAGCAGGATGGAGAATGG - Intergenic
995707956 5:115004648-115004670 CTGGTGAGGAGGTTGGAGAAGGG - Intergenic
995873084 5:116762797-116762819 ATTGGGAAGAGGACTGAGAAAGG + Intergenic
996890115 5:128408814-128408836 AAGGAGAAGATGATTGAGAAAGG + Intronic
997876718 5:137555739-137555761 GTGGTGGAGAGGGTTTACAACGG - Intronic
999320903 5:150614449-150614471 GAGGTGAAGGGGAGGGAGAAGGG + Intronic
999541363 5:152576023-152576045 ATGGTGAGGAGGAATGGGAAGGG + Intergenic
1000368067 5:160509417-160509439 GTGGTAAAGATGATTGAGACTGG + Intergenic
1000705720 5:164508960-164508982 GTGGGGAAGAGGATCAAGAGCGG - Intergenic
1000787678 5:165566182-165566204 ACGGTGAAGAGTATTCAGAATGG - Intergenic
1001893340 5:175357794-175357816 GTGAGAAAGAGGATAGAGAATGG + Intergenic
1001932161 5:175680916-175680938 GTGTTGAAAAGGACTGAGGAAGG + Intronic
1003019059 6:2494247-2494269 GTGGTGAAGAGGATCTGAAAGGG + Intergenic
1003550580 6:7098997-7099019 GTGGAGAAGGGGTTTTAGAAGGG - Intergenic
1003679605 6:8238995-8239017 GTGGGGGAGATGATGGAGAAAGG + Intergenic
1003809824 6:9767497-9767519 GTGGTGAGGAGGAATGACAGTGG - Intronic
1004038131 6:11944435-11944457 GTGGTGATGGGGAATGAGACTGG + Intergenic
1004211625 6:13651906-13651928 GTGGTAGAGAGGAGTGAGGAGGG - Intronic
1004366749 6:15019405-15019427 GTGGTGTAGAAGGTTGACAAAGG + Intergenic
1004447396 6:15712637-15712659 GAGGAGGAGAGGATTGAGAAAGG + Intergenic
1004952662 6:20691608-20691630 GAGGTGAGGATAATTGAGAAAGG + Intronic
1005102851 6:22191970-22191992 GAGATCAAGAGGAGTGAGAATGG + Intergenic
1005688240 6:28276197-28276219 GAGGAGACAAGGATTGAGAATGG + Exonic
1006078876 6:31552629-31552651 GTATTAAAGAGCATTGAGAACGG + Intronic
1006109856 6:31737941-31737963 GTGATGAGGAGGATAGAGAAGGG - Intronic
1006398438 6:33801998-33802020 GGGGTGCAGAGCCTTGAGAAAGG + Intronic
1006556507 6:34871653-34871675 GTGCTGAAGAGGAGTGATGATGG + Exonic
1006640257 6:35485975-35485997 GTGGGGAAGGGGACTGAGGAGGG + Intronic
1009057353 6:58353005-58353027 AAGGTAAAGAGGATTGGGAATGG + Intergenic
1009233874 6:61098565-61098587 AAGGTAAAGAGGATTGGGAATGG - Intergenic
1009566551 6:65318248-65318270 CTGGAAAAGAGGAGTGAGAAGGG - Intronic
1012744616 6:103069654-103069676 GTGGTGGAGATGATTTATAAAGG - Intergenic
1013421379 6:109970156-109970178 GTTGAGAAGAGCAGTGAGAAAGG - Intergenic
1015720501 6:136236277-136236299 CTTGTGAAGAGGAAAGAGAAGGG + Intronic
1015720544 6:136236667-136236689 CTTGTGAAGAGGAAAGAGAAGGG - Intronic
1017570754 6:155741999-155742021 GGGGTGAAGAGGGATGAGAATGG - Intergenic
1017753472 6:157510314-157510336 GTTGTGAGGAGGAGTGAAAATGG - Intronic
1017998216 6:159553507-159553529 CTGGTGAAGAGTCTGGAGAAAGG - Intergenic
1018217466 6:161543430-161543452 ATGGTTAAGAGGATTTGGAAAGG + Intronic
1019372830 7:671951-671973 GTGGTGAAGGACATTGAGAGAGG - Intronic
1020606701 7:10346970-10346992 AAGGAGAAGAGGATTGGGAATGG + Intergenic
1021315537 7:19144126-19144148 GTGGCGAAGGGGAGGGAGAAAGG + Intergenic
1021664115 7:22957589-22957611 GTGGTGATGAGGATTGGGAAAGG - Intronic
1021992261 7:26150797-26150819 GTGGCAAAGAGGATGAAGAAAGG - Intergenic
1023372928 7:39530080-39530102 GTAGTGAGGAGGACGGAGAAGGG + Intergenic
1026525512 7:71150109-71150131 ATGGTGAACAGGAATGAGAAGGG - Intronic
1028797907 7:94925761-94925783 GGGGAGAAGAGGAAGGAGAAAGG - Intronic
1029671816 7:102038130-102038152 GATGTGAAAAGTATTGAGAACGG - Intronic
1030865655 7:114699070-114699092 GTGGTGATGATGATGGTGAAGGG - Intergenic
1031086235 7:117304409-117304431 GTGGAGGAGAGGATTGAAAGGGG - Intronic
1031973608 7:128080449-128080471 GAGGTGAGGAGGATGGAGAAAGG + Intronic
1032619335 7:133511922-133511944 GTGGTGGGAAGGAATGAGAAGGG - Intronic
1032620089 7:133520803-133520825 GTGGAGAAGGCGATAGAGAAAGG - Intronic
1033342869 7:140505584-140505606 GTGCTGTGGAGGATTGAGGAGGG + Intergenic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1033659508 7:143393842-143393864 GTTATGAAGAGCATTGAGGATGG - Exonic
1033785880 7:144729174-144729196 TTGATGAATAGGATTGGGAAGGG - Intronic
1035017982 7:155782818-155782840 GAGGTGAAGAGCATGAAGAATGG - Intergenic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1037178443 8:15974474-15974496 AGGGTGAAGGGAATTGAGAATGG - Intergenic
1037872091 8:22507866-22507888 GTGGTGAAGAGAATGGAGTCTGG - Intronic
1038077386 8:24091605-24091627 CTGGTGAAGTGGAGTGAGCAAGG + Intergenic
1038758883 8:30367867-30367889 GTGGTGGAGAGTAATGTGAAAGG + Intergenic
1040988770 8:53326554-53326576 GTTGTCAAGAGTATGGAGAAAGG - Intergenic
1041572512 8:59353248-59353270 GTGGAAAAGTGGAATGAGAAGGG + Intergenic
1043854560 8:85249882-85249904 GAAGTGAAGAGGATTGAAAAGGG + Intronic
1044061059 8:87636346-87636368 GTGGAGCAGATGATTGAAAAAGG - Intergenic
1044362295 8:91301256-91301278 ATGCTGAAAAGCATTGAGAAGGG - Intronic
1044591579 8:93917711-93917733 GGGGGGAAGAGGATGGAGGAGGG - Intronic
1044897713 8:96910344-96910366 ATGGTGACAAGGATGGAGAAAGG - Intronic
1045384340 8:101656957-101656979 AAGGTGAAGAGGCTAGAGAAAGG + Intronic
1045737422 8:105313060-105313082 CTGTGGAAGAGGATTGGGAATGG + Intronic
1046833772 8:118776922-118776944 ATAGAGGAGAGGATTGAGAAGGG + Intergenic
1046914841 8:119668872-119668894 GAGGGAAAGCGGATTGAGAAAGG - Intronic
1047009066 8:120651532-120651554 GTGGTGAAAAGAGATGAGAATGG + Intronic
1047632671 8:126725452-126725474 CTGGAGAAGAGGCATGAGAATGG - Intergenic
1047681490 8:127258372-127258394 GAGGTGAGGAGGTCTGAGAAGGG + Intergenic
1048158858 8:131992684-131992706 GTAGTGAAGAGGATGACGAAGGG + Intronic
1048827151 8:138439392-138439414 ATGGTGTAGTGGAATGAGAATGG - Intronic
1049440288 8:142606469-142606491 GGGGTGAAGAGGGTGGACAAGGG - Intergenic
1050055926 9:1654332-1654354 GTGGTGGAAAGGGTTGAGAGAGG - Intergenic
1051432046 9:16989325-16989347 ATGATGAAGAGGAATGAGGAAGG - Intergenic
1052252215 9:26411866-26411888 ATGGTGCAGAGGATGCAGAATGG + Intergenic
1053054718 9:34987797-34987819 GGGGTGAGGAGGAGTGAGGAAGG - Intergenic
1053072801 9:35111177-35111199 GGGGAGGAGAGGAGTGAGAAGGG - Exonic
1053089156 9:35257798-35257820 GTGGTGAAGAGCATTTCAAATGG - Intronic
1053095595 9:35325250-35325272 GTTGTGAAGAGGAATGAGGGGGG + Intronic
1053787818 9:41664784-41664806 GTGGTAAGGAGGATTGAGGCTGG + Intergenic
1054157308 9:61649983-61650005 GTGGTAAGGAGGATTGAGGCTGG - Intergenic
1054176094 9:61876126-61876148 GTGGTAAGGAGGATTGAGGCTGG + Intergenic
1054477082 9:65580988-65581010 GTGGTAAGGAGGATTGAGGCTGG - Intergenic
1054661445 9:67704682-67704704 GTGGTAAGGAGGATTGAGGCTGG - Intergenic
1054719388 9:68589223-68589245 ATGTTGAATAGGAGTGAGAAAGG + Intergenic
1055654108 9:78436560-78436582 GTGGGGAGGAAGATTGAGGAAGG + Intergenic
1058377095 9:104335466-104335488 GGGGAGAAGGGGATGGAGAAAGG - Intergenic
1058501360 9:105621520-105621542 GAGGGGCAGAGGATGGAGAAAGG - Intronic
1058750326 9:108032996-108033018 GTTTTGATGAGGATGGAGAAGGG - Intergenic
1058750351 9:108033188-108033210 GTTTTGATGAGGATGGAGAAGGG - Intergenic
1059671795 9:116499046-116499068 GTGGTGCAGAGGATTCTAAAGGG - Intronic
1059763506 9:117361767-117361789 GAGGTTTAGAGGAGTGAGAAGGG - Intronic
1059838206 9:118181222-118181244 GTGGGGAAGAGGAGGGAGAAAGG - Intergenic
1060952028 9:127610067-127610089 GTGCTGAAGCAGATGGAGAAGGG - Intergenic
1061927963 9:133815485-133815507 GTGGTGAAGAACAGTCAGAAGGG - Intronic
1062069447 9:134547699-134547721 GGGGTGAAGGGAATTGAGAATGG - Intergenic
1187126765 X:16461713-16461735 GTGGTGCAGGGAATGGAGAATGG + Intergenic
1187965746 X:24609737-24609759 GGGGTGAAGAAGGTGGAGAAAGG + Intronic
1188648657 X:32601804-32601826 GTGGTTAAGAAGATTGAATAAGG + Intronic
1189359782 X:40340980-40341002 ATGGTGAAGAGAATCTAGAATGG - Intergenic
1190962430 X:55265847-55265869 GTGCTGAAGAGAAGTGAGTAGGG - Intronic
1190994514 X:55593275-55593297 GTAATAAAGAGGATTGAAAATGG - Intergenic
1191100050 X:56716988-56717010 GTGTTCAATAGGATTGAGAGAGG - Intergenic
1192195932 X:69028160-69028182 GTGGTGTAGAGGAAGGAGAAAGG + Intergenic
1193750827 X:85341312-85341334 GTGGTGAAGAGGGTAGGGACAGG + Intronic
1193985704 X:88238066-88238088 CTGGTGATGAGGATTGTGATCGG + Intergenic
1196690166 X:118550560-118550582 ATGGGGCAGAGGATTGAAAAGGG + Intronic
1197273235 X:124448871-124448893 GGTGTGAGGAGGATGGAGAATGG + Intronic
1197997395 X:132392739-132392761 ATGGTGAAGAGGAAAGAGGAAGG - Intronic
1198506365 X:137305008-137305030 GCAGAGAAGAGGACTGAGAAAGG - Intergenic
1198751399 X:139939590-139939612 GTGGAGAATAGTATTCAGAAAGG + Intronic
1199951364 X:152708678-152708700 TTGGGGAAGAGGATGGAGGAGGG + Intergenic
1199954011 X:152727902-152727924 TTGGGGAAGAGGATGGAGGAGGG + Intronic
1199955681 X:152740551-152740573 TTGGGGAAGAGGATGGAGAAGGG - Intergenic
1199958319 X:152759783-152759805 TTGGGGAAGAGGATGGAGGAGGG - Intergenic
1199995397 X:153021598-153021620 GTGGTGAACAGGAGGGAGGAGGG - Intergenic
1201258528 Y:12134541-12134563 GTTGTGGGGAGGATTGAAAAAGG + Intergenic