ID: 977313386

View in Genome Browser
Species Human (GRCh38)
Location 4:95414219-95414241
Sequence ACCAGACCTATTTTTTGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977313386_977313391 25 Left 977313386 4:95414219-95414241 CCCCCACAAAAAATAGGTCTGGT 0: 1
1: 0
2: 0
3: 22
4: 145
Right 977313391 4:95414267-95414289 GCAGATAAGAAAAAAGAAGATGG 0: 1
1: 1
2: 6
3: 141
4: 1668
977313386_977313393 29 Left 977313386 4:95414219-95414241 CCCCCACAAAAAATAGGTCTGGT 0: 1
1: 0
2: 0
3: 22
4: 145
Right 977313393 4:95414271-95414293 ATAAGAAAAAAGAAGATGGAGGG 0: 1
1: 0
2: 15
3: 304
4: 3060
977313386_977313392 28 Left 977313386 4:95414219-95414241 CCCCCACAAAAAATAGGTCTGGT 0: 1
1: 0
2: 0
3: 22
4: 145
Right 977313392 4:95414270-95414292 GATAAGAAAAAAGAAGATGGAGG 0: 1
1: 0
2: 7
3: 156
4: 1612

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977313386 Original CRISPR ACCAGACCTATTTTTTGTGG GGG (reversed) Intronic
905441165 1:37997295-37997317 AGGAGACCCATTTTTTTTGGCGG + Exonic
908262098 1:62347128-62347150 ACCATAAGTATTATTTGTGGAGG - Intergenic
909280940 1:73752846-73752868 AATAGATCTATTGTTTGTGGGGG + Intergenic
911109912 1:94172395-94172417 ACCAGCCCTTTTTTTTCTGAAGG - Exonic
912250697 1:108009713-108009735 ACCAGCCCTAGTTTTTTTGCTGG + Intergenic
912758430 1:112344731-112344753 AGCATACGTATTGTTTGTGGAGG + Intergenic
917485161 1:175448872-175448894 ACCAGACCTGTTTTTTGGCATGG - Intronic
917493913 1:175522720-175522742 AACAGCTTTATTTTTTGTGGGGG - Intronic
918872869 1:189998802-189998824 ACACGTCCTATTTTTTGAGGGGG + Intergenic
919002376 1:191849044-191849066 ACCATACTAATTTTTTTTGGGGG + Intergenic
921601817 1:217114191-217114213 ACCAGAATTTTTTTTTGTGTTGG - Intronic
1063380289 10:5580810-5580832 TCCAGAACCATTTTTTGGGGAGG + Intergenic
1067457075 10:46426592-46426614 CCCAGACCAACCTTTTGTGGGGG - Intergenic
1067630128 10:47958046-47958068 CCCAGACCAACCTTTTGTGGGGG + Intergenic
1070310616 10:75271060-75271082 CACAGACATATCTTTTGTGGGGG + Intergenic
1076012802 10:127003958-127003980 ACCTGGCCTTTTTTTTGGGGGGG - Intronic
1077600989 11:3574569-3574591 CCCAGACTTATTTTTTTTTGTGG - Intergenic
1081091707 11:38877572-38877594 TACAGACTGATTTTTTGTGGGGG - Intergenic
1083914836 11:65735019-65735041 ACCTGACTAATTTTTTTTGGGGG - Intergenic
1086484184 11:87279914-87279936 AGCAGACCTTTATTATGTGGAGG + Intronic
1087189470 11:95237587-95237609 AGCAGATCCAGTTTTTGTGGGGG + Intergenic
1087409675 11:97775784-97775806 ACCTAATCTATTTTTGGTGGTGG - Intergenic
1090567179 11:128007131-128007153 ACCAGACTGATTTTTTGGGCAGG + Intergenic
1091086092 11:132723403-132723425 AACCGACCTATATTATGTGGTGG - Intronic
1095683916 12:45010671-45010693 ACATGACACATTTTTTGTGGGGG - Intergenic
1095782319 12:46073245-46073267 ACAAGACCAATTTTTTTTTGAGG - Intergenic
1098377261 12:69830172-69830194 ACCAGACCTATTCCTGGAGGAGG - Intronic
1099293472 12:80801667-80801689 CACATACTTATTTTTTGTGGTGG + Intronic
1106669044 13:31885518-31885540 TCCAGACCTATATTTTGGGGAGG + Intergenic
1107053576 13:36078826-36078848 ATCAGACCTATTTTTTTTGTAGG - Intronic
1109822693 13:67679312-67679334 AACAGACTTATTTGTTGTGGAGG - Intergenic
1113092946 13:106633847-106633869 AGTTGACCTATTGTTTGTGGGGG + Intergenic
1120744780 14:88143528-88143550 ATCAGACCAATTTTTTCTAGAGG + Intergenic
1125036400 15:35129532-35129554 ACCAGACATTTTTTTTGCGGGGG + Intergenic
1125696156 15:41639003-41639025 ACCTGACCTTTTTTTGATGGGGG + Intronic
1126181207 15:45786950-45786972 ACCAGAACTGTTTTTTGTGAAGG - Intergenic
1127724288 15:61733031-61733053 ACCAGTTGTATTTTTAGTGGAGG - Intergenic
1132047737 15:98578907-98578929 ACCACACCTATTTTTTTTAAGGG - Intergenic
1133309373 16:4833947-4833969 ACCTGACCTACTTTTTCTGAAGG - Intronic
1134603672 16:15553010-15553032 ACCAGACATTTTTTTTGAGATGG + Intronic
1140364807 16:74373004-74373026 ACCAAACTTATTTTTTAAGGTGG + Intergenic
1140595168 16:76400288-76400310 ACCTCACATATTTTTTGTGGTGG + Intronic
1143617689 17:8063765-8063787 ACCGGACTAATTTTTGGTGGAGG - Intergenic
1146245025 17:31272935-31272957 ACAAGACCTATTTTCTATTGAGG + Intronic
1147865658 17:43550388-43550410 AGCAGATTTTTTTTTTGTGGAGG + Intronic
1148672766 17:49424275-49424297 AACAAACCTATTTTTAGTGGTGG + Intronic
1162319623 19:9963544-9963566 ACCATGCCTGTTTTTTTTGGGGG + Intronic
1162642524 19:12022853-12022875 ACCAGATCTTTCTTTTCTGGAGG + Intronic
1163826269 19:19526554-19526576 ACTAGACACATTTTTTGGGGTGG - Intronic
1165574768 19:36805657-36805679 TCCAGACCTCTTTTCTTTGGTGG + Intergenic
1167849050 19:52188262-52188284 ACCCGGCCTTTTTTTTGAGGCGG - Intergenic
1167891436 19:52542943-52542965 CCCAGATCTTTTTTTTGGGGGGG + Intronic
926179204 2:10625719-10625741 CCCAGGCTTTTTTTTTGTGGGGG - Intronic
926191973 2:10735172-10735194 ACTAGACCTTTTTTTTGAGATGG + Intronic
927349801 2:22096454-22096476 ACCAGACCTATTTGTTATAGTGG - Intergenic
927443013 2:23132901-23132923 CCCAGGGCCATTTTTTGTGGGGG - Intergenic
928819434 2:35342884-35342906 ATCAGACCAATTTTTCCTGGAGG + Intergenic
929386903 2:41419518-41419540 ATGCTACCTATTTTTTGTGGGGG - Intergenic
929706343 2:44216356-44216378 ACCAGACAATTTTTTTGTTGTGG - Intronic
932527346 2:72485095-72485117 AGCATTCCTATTTCTTGTGGAGG + Intronic
933444644 2:82364427-82364449 ACCTGGCATATTTTTTGTGGTGG + Intergenic
935547298 2:104414457-104414479 AACAGAACTTTTTTTTGGGGGGG + Intergenic
936785668 2:116091284-116091306 ATCAGATCTAAATTTTGTGGTGG + Intergenic
937778735 2:125812182-125812204 ACCAAACCTATCTTTTTTGGGGG - Intergenic
938947422 2:136225832-136225854 ACCTGACTGATTCTTTGTGGAGG + Intergenic
940137158 2:150450835-150450857 ACCTGACCTTTTTTTTGTTGTGG + Intergenic
940689720 2:156900539-156900561 AACAGACATCTTTTTTGGGGAGG - Intergenic
942600745 2:177638713-177638735 AGCAGCCTTTTTTTTTGTGGAGG + Intronic
944654771 2:201866653-201866675 TCCAGACCTATTATTTTTAGAGG + Intronic
944898665 2:204191938-204191960 AGGAGACCTATTTTTTTTGGTGG + Intergenic
947952828 2:234162700-234162722 TCCAGACCTGTTTGTTGTGGAGG - Intergenic
1169432370 20:5549453-5549475 AACAAACCTATTTTTAGTGGTGG - Intronic
1169505676 20:6208840-6208862 CCCAGAGCTATTTTTTGTTCAGG + Intergenic
1169982180 20:11396899-11396921 TCCATTCCTTTTTTTTGTGGGGG - Intergenic
1170306738 20:14946824-14946846 ACGTGATTTATTTTTTGTGGAGG + Intronic
1173153513 20:40587971-40587993 ACCAAACATATTTTTTATGGTGG - Intergenic
1174922211 20:54716172-54716194 ACCAGACACATTTCTGGTGGGGG - Intergenic
1182821728 22:33222422-33222444 TATAGACATATTTTTTGTGGGGG - Intronic
1183008026 22:34919475-34919497 GCCAGAGCTCTTTTTAGTGGAGG - Intergenic
1183884408 22:40865674-40865696 ACCACACTCTTTTTTTGTGGGGG + Intronic
950305426 3:11912575-11912597 CACATACGTATTTTTTGTGGGGG - Intergenic
951045222 3:18030197-18030219 ACCAGAACTATTATTTTAGGCGG + Intronic
957614855 3:82513639-82513661 ACCAGAACTTTTTTTTATAGGGG + Intergenic
958669929 3:97190704-97190726 CACATACTTATTTTTTGTGGAGG + Intronic
963361720 3:144282299-144282321 ATCTTACCTATTTTTTATGGTGG - Intergenic
966664825 3:182460423-182460445 AACAAACCTATTTTCAGTGGTGG + Intergenic
967797624 3:193614775-193614797 ACCAGATGTAGTTTTTGTAGTGG - Exonic
969897584 4:10319719-10319741 ATCTCACCTATTTTCTGTGGGGG - Intergenic
972502964 4:39695316-39695338 ACCAGACCTTTTTTTGGAGAGGG + Intergenic
972592424 4:40500314-40500336 TCCAGCCCTTTTTTTTTTGGGGG - Intronic
973207565 4:47577382-47577404 ACCAAACCACTTTTTAGTGGTGG - Intronic
973649021 4:52979051-52979073 ACCAGGCCTTTTTTTGGGGGGGG + Intronic
973940509 4:55905272-55905294 AGAAGAACAATTTTTTGTGGTGG + Intergenic
974007534 4:56573783-56573805 ACCACACATATCTTTTGAGGGGG - Intronic
977177351 4:93833771-93833793 ACCAGCACTTTTATTTGTGGAGG + Intergenic
977313386 4:95414219-95414241 ACCAGACCTATTTTTTGTGGGGG - Intronic
977443702 4:97101747-97101769 TCCAGATCTTTTTTTTCTGGAGG - Intergenic
977595958 4:98881034-98881056 AACAAACCTATTTTTAGTGGTGG + Exonic
977985198 4:103374867-103374889 TGCAGAGCTATTCTTTGTGGGGG + Intergenic
978358247 4:107900801-107900823 ACCACACCTATATTTGGTGAGGG - Intronic
978562253 4:110045537-110045559 ACCAGAGCAATTTTTTTGGGGGG - Intergenic
981141877 4:141278437-141278459 AGGATACCTTTTTTTTGTGGTGG + Intergenic
981368610 4:143932201-143932223 ACGATACCTATTTTTTGTTTGGG - Intergenic
984899580 4:184573232-184573254 TCCAGACCTCTTTTCTTTGGTGG - Intergenic
987574070 5:19703549-19703571 TCCAGATCTTTCTTTTGTGGAGG + Intronic
991592477 5:68267647-68267669 ACAAGAGCTTTTTTTTTTGGAGG - Intronic
993726689 5:91376331-91376353 ACCAGATCTGTTTTTTGTTATGG + Intronic
994504458 5:100623939-100623961 CCCAGAACTATTTTTGATGGAGG + Intergenic
995077854 5:108008437-108008459 ATCAGTCCTATTTTATGTTGAGG - Intronic
995872896 5:116761220-116761242 TCCAGACCTTCTTTTTGTGGCGG + Intergenic
996582285 5:125044779-125044801 TCCAGACTTATTTTGTGTGTAGG + Intergenic
997139608 5:131364570-131364592 AACATACCTATTTTTTCTAGTGG + Intronic
998558370 5:143147980-143148002 AGTAGACCTAGTTTCTGTGGAGG - Intronic
1000629987 5:163581670-163581692 ACCAGGCTAATTTTTTGTAGAGG + Intergenic
1002198327 5:177513086-177513108 ACCTGACCTGATCTTTGTGGTGG - Intronic
1002404661 5:179020826-179020848 ACCCGGCCTTTTTTTTTTGGGGG + Intergenic
1004075351 6:12339765-12339787 TCCAGTGCTATCTTTTGTGGAGG + Intergenic
1005966729 6:30731738-30731760 AGCTGACTTATTTTTTGTGGGGG + Intronic
1006292364 6:33148739-33148761 ACCTTACATATTTTTTGTGTTGG - Intergenic
1012350186 6:98240648-98240670 GCCAGGCCAATTTTTTGTAGAGG - Intergenic
1015660433 6:135568138-135568160 ACAAGACCTGTTTTTTTGGGGGG + Intergenic
1016417146 6:143844606-143844628 ACAGGACCTACTTTTTGTGTGGG - Exonic
1017731558 6:157321840-157321862 AGCAGAAATATATTTTGTGGTGG - Intronic
1022317687 7:29260773-29260795 ACCGGACCTGTTTTATGAGGTGG + Intronic
1022826194 7:34016795-34016817 AAAAAACCTTTTTTTTGTGGGGG + Intronic
1023492995 7:40764084-40764106 ACCACACTTTTTTTTGGTGGGGG - Intronic
1024904930 7:54366737-54366759 GCCAGACATATTATTTGTGTTGG - Intergenic
1026764171 7:73149280-73149302 ACAACAGCTATTTTTTGGGGGGG + Intergenic
1027040637 7:74959050-74959072 ACAACAGCTATTTTTTTTGGGGG + Intergenic
1027082999 7:75243307-75243329 ACAACAGCTATTTTTTTTGGGGG - Intergenic
1027131273 7:75592962-75592984 ACTACAGCTATTTGTTGTGGTGG + Intronic
1027615689 7:80421329-80421351 AACAGACCTATTTTTAGCTGTGG - Intronic
1029305422 7:99616456-99616478 ATCGGAGCTGTTTTTTGTGGGGG - Intergenic
1031529923 7:122864129-122864151 TCCAAACTTATTTTTTCTGGAGG - Intronic
1032697515 7:134350141-134350163 AACACACCTTTTTTTTGGGGGGG - Intergenic
1035791875 8:2313817-2313839 AGCAGACATTTATTTTGTGGAGG + Intergenic
1035800930 8:2407888-2407910 AGCAGACATTTATTTTGTGGAGG - Intergenic
1036085627 8:5610070-5610092 GCCAGACCTACTTCTTGTTGAGG - Intergenic
1037046385 8:14309646-14309668 AACAAACCTATTTTTAGTGGTGG - Intronic
1037444780 8:18954557-18954579 ACCAGAACTCTTTTTTGTGATGG - Intronic
1037731563 8:21529384-21529406 ACCAGACCAATTTTTAGTATAGG + Intergenic
1038641505 8:29332645-29332667 ACCAGACTAATTTTTTTTTGAGG - Intergenic
1041045598 8:53883090-53883112 TCCAAACCTAATTTTTTTGGGGG + Intronic
1041196303 8:55404998-55405020 ACCAGACATTTTTTTCGTTGTGG - Intronic
1044411174 8:91885114-91885136 ACCACACCAATTTATTTTGGAGG - Intergenic
1045738689 8:105326922-105326944 ATAACACCTAGTTTTTGTGGAGG + Intronic
1048190895 8:132287674-132287696 ACCAGACATATTTTATGTCTTGG - Intronic
1051226531 9:14905244-14905266 ACCAGACCTATTTTTTAAAATGG + Intronic
1053248250 9:36553098-36553120 ACCAGGCCTTTTTTTTTTGTGGG - Intergenic
1057208805 9:93188482-93188504 ACCTGCACTGTTTTTTGTGGGGG + Intronic
1057437324 9:95053872-95053894 ACCACACCTAATTTTGGGGGTGG + Intronic
1058413374 9:104759500-104759522 AACAGAACTATTTTTTGAAGTGG - Exonic
1058833077 9:108836714-108836736 ACCAGTCGTCTTTTATGTGGAGG - Intergenic
1059870003 9:118562212-118562234 AACAGATTTATTTTCTGTGGGGG + Intergenic
1060167817 9:121433992-121434014 ACCAAACATATTTTTATTGGGGG - Intergenic
1203714764 Un_KI270742v1:133628-133650 ACCAGATCTTTCTTTTCTGGAGG - Intergenic
1186161393 X:6780760-6780782 ACCCGGCCTGTTTTTGGTGGTGG - Intergenic
1187022462 X:15398426-15398448 ACCACAGATATTTGTTGTGGAGG + Intronic
1188257266 X:27977908-27977930 ACCACACCATTTTTTTGGGGAGG - Intergenic
1190269338 X:48850767-48850789 ACTAGACCTATTCTCTGTGGTGG - Intergenic
1190928620 X:54930271-54930293 ACCAGCCCTAGTTTTTGTGATGG + Exonic
1194530243 X:95038759-95038781 ACAAGGCTTTTTTTTTGTGGGGG + Intergenic
1196017607 X:110956435-110956457 ACCAGAAATATTTTCTGGGGTGG - Intronic
1197281773 X:124545279-124545301 AATAAACCTATTTCTTGTGGTGG - Intronic
1198249903 X:134870069-134870091 ACCAGACTCTTTTTTTGTGATGG - Intergenic
1198511395 X:137355179-137355201 GCCAATTCTATTTTTTGTGGTGG + Intergenic
1199645160 X:149902174-149902196 ACCAAATTTTTTTTTTGTGGGGG - Intergenic
1202110906 Y:21418833-21418855 ACCAGATGTATTTTATGTGTTGG - Intergenic