ID: 977314363

View in Genome Browser
Species Human (GRCh38)
Location 4:95426680-95426702
Sequence CACAGAACGTTTTAGTGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 516
Summary {0: 1, 1: 1, 2: 8, 3: 95, 4: 411}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977314360_977314363 26 Left 977314360 4:95426631-95426653 CCAGTGAACACACGAATGAAAAG 0: 1
1: 28
2: 329
3: 628
4: 744
Right 977314363 4:95426680-95426702 CACAGAACGTTTTAGTGGTCTGG 0: 1
1: 1
2: 8
3: 95
4: 411
977314361_977314363 -9 Left 977314361 4:95426666-95426688 CCTCATTGTTGATACACAGAACG 0: 1
1: 0
2: 0
3: 10
4: 99
Right 977314363 4:95426680-95426702 CACAGAACGTTTTAGTGGTCTGG 0: 1
1: 1
2: 8
3: 95
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977314363 Original CRISPR CACAGAACGTTTTAGTGGTC TGG Intronic
902948528 1:19862000-19862022 CACAAAACTTCTGAGTGGTCAGG - Intergenic
906269815 1:44467636-44467658 GACAGAAAGTTTTAGTGGTCTGG - Intronic
906703618 1:47878017-47878039 AAAAGAACGTGTTTGTGGTCGGG + Intronic
906838898 1:49114435-49114457 TGGAGAAAGTTTTAGTGGTCTGG - Intronic
907858801 1:58330188-58330210 TAGAGAAAGTTTTAGTGGTCTGG + Intronic
908396781 1:63732450-63732472 CACAGAACATTTCAGAGGTCTGG + Intergenic
908464916 1:64384079-64384101 TAGAGAAAGTTTGAGTGGTCTGG + Intergenic
908668865 1:66523361-66523383 GACACAAAGTTTTAGAGGTCAGG - Intergenic
908689629 1:66763799-66763821 TGGAGAAAGTTTTAGTGGTCTGG - Intronic
909164542 1:72202568-72202590 TAAAGAGTGTTTTAGTGGTCTGG + Intronic
909379276 1:74979410-74979432 CACAGAAGGTTTTATGGGCCAGG + Intergenic
909695057 1:78458570-78458592 TGGAGAAAGTTTTAGTGGTCTGG + Intronic
909964356 1:81889370-81889392 TGGAGAAAGTTTTAGTGGTCTGG + Intronic
910072032 1:83228274-83228296 TAGAAAACATTTTAGTGGTCTGG + Intergenic
910269845 1:85382251-85382273 TGGAGAAAGTTTTAGTGGTCTGG + Intronic
910298345 1:85676008-85676030 GGGAGAAAGTTTTAGTGGTCTGG - Intronic
910918188 1:92314045-92314067 TAGAGAAAGTTTTAGTGGTCTGG - Intronic
911402417 1:97393000-97393022 TGGAGAACATTTTAGTGGTCTGG - Intronic
911591380 1:99752122-99752144 TGGAGAAAGTTTTAGTGGTCTGG - Intronic
911955726 1:104232518-104232540 TGCAGAAAGTTTTAGTGGTCTGG - Intergenic
912234335 1:107833251-107833273 CAGTGAAAGTTTTCGTGGTCTGG + Intronic
912523900 1:110266618-110266640 CACAGAACCTTTAAGTGGCAGGG + Intronic
912902485 1:113667545-113667567 TGGAGAAAGTTTTAGTGGTCTGG - Intronic
914415177 1:147473769-147473791 TGGAGAAAGTTTTAGTGGTCTGG + Intergenic
914774544 1:150724436-150724458 TGCAGAAAGTTTGAGTGGTCTGG - Intergenic
914847679 1:151291871-151291893 CACAAACAGTTTTAATGGTCTGG - Exonic
915032155 1:152890017-152890039 TGAAGAAAGTTTTAGTGGTCTGG - Intergenic
916250072 1:162729407-162729429 CACAGAATTTTTCAGTGGTTTGG + Intronic
916831877 1:168501483-168501505 CAGAGAAAGTTCGAGTGGTCTGG - Intergenic
916947873 1:169747215-169747237 TGAAGAAAGTTTTAGTGGTCTGG - Intronic
917115390 1:171598079-171598101 GATATAAAGTTTTAGTGGTCTGG + Intergenic
917503567 1:175607624-175607646 CACAATACGTTACAGTGGTCAGG + Intronic
917901636 1:179548630-179548652 CAAAGAACATTGTAGTGGCCAGG + Intronic
918130671 1:181625675-181625697 CAGAGAACGTCTGAGTGGTCTGG - Intronic
918361359 1:183762056-183762078 TGCAGAAAGTTTTAGTGGTCTGG - Intronic
918795556 1:188890165-188890187 GATAGAACATATTAGTGGTCAGG - Intergenic
919054977 1:192559306-192559328 TGGAGAAAGTTTTAGTGGTCTGG - Intergenic
919448797 1:197745110-197745132 TGGAGAAAGTTTTAGTGGTCTGG - Intronic
919487845 1:198166131-198166153 CAGAGAAAGTTTTAGCGGTCTGG - Intronic
919548871 1:198959536-198959558 GGGAGAAAGTTTTAGTGGTCTGG - Intergenic
920081442 1:203376617-203376639 GATAGAAAGTTTTAGTGGTCTGG - Intergenic
920799740 1:209174739-209174761 TAAAGAAAGTTTTAGTGGTCTGG + Intergenic
921408268 1:214806014-214806036 TGAAGAAAGTTTTAGTGGTCTGG + Intergenic
921897716 1:220417679-220417701 TGGAGAAAGTTTTAGTGGTCTGG + Intergenic
922624157 1:227020661-227020683 CAAAGAAAGTTTTAGTGATCTGG - Intronic
922659033 1:227413159-227413181 TAGAGAAAGTTTTAGTGGTCTGG - Intergenic
922959199 1:229631308-229631330 TGGAGAAAGTTTTAGTGGTCTGG - Intronic
923681987 1:236125818-236125840 CAATGAAAGTTTTAGTGGTCTGG - Intergenic
923952382 1:238971903-238971925 AGGAGAAAGTTTTAGTGGTCTGG - Intergenic
1062893884 10:1088184-1088206 CACAGGAAGTTTGAGTGGTGGGG - Intronic
1063512216 10:6656521-6656543 CACAGTAGGTTTTACTGGTAAGG + Intergenic
1064521765 10:16210115-16210137 CACCGCAGGTTTTAGTGTTCAGG - Intergenic
1064788349 10:18925277-18925299 TAGAGGACATTTTAGTGGTCTGG - Intergenic
1065546586 10:26827539-26827561 GGGAGAAAGTTTTAGTGGTCTGG - Intronic
1065687273 10:28299033-28299055 TAGAGAAGGTTTTAGTGGTCTGG - Intronic
1067548157 10:47211533-47211555 TGGAGAAAGTTTTAGTGGTCTGG + Intergenic
1068678914 10:59797832-59797854 CACAGAACATTATATTGGACTGG - Intronic
1068870098 10:61934269-61934291 TGGAGAAAGTTTTAGTGGTCTGG - Intronic
1069207494 10:65710115-65710137 TGGAGAAAGTTTTAGTGGTCTGG - Intergenic
1069303997 10:66945513-66945535 TGGAGAACATTTTAGTGGTCTGG - Intronic
1070564735 10:77595048-77595070 AAAAAAAGGTTTTAGTGGTCGGG + Intronic
1071084601 10:81855067-81855089 CAAAGAAAGTTTTAGAGGTCTGG - Intergenic
1071763846 10:88639462-88639484 TGGAGAAAGTTTTAGTGGTCTGG - Intergenic
1072059559 10:91796808-91796830 CGAAGAACGTTTGAGTGGTCTGG - Intergenic
1073781099 10:106839333-106839355 TGGAGAAAGTTTTAGTGGTCTGG + Intronic
1073867247 10:107819051-107819073 CACAGAAGGTTTTAGGGCACTGG + Intergenic
1074725575 10:116305105-116305127 TAGAGAAAGCTTTAGTGGTCTGG - Intergenic
1074845907 10:117397863-117397885 CAGAGAGCATTTTAGTGGTAGGG - Intergenic
1074905238 10:117856512-117856534 TGGAGAAAGTTTTAGTGGTCTGG - Intergenic
1075841107 10:125504495-125504517 TAGAGAAGGTGTTAGTGGTCTGG + Intergenic
1076205951 10:128603081-128603103 TGGAGAAAGTTTTAGTGGTCTGG + Intergenic
1078193632 11:9115574-9115596 TGGAGAAAGTTTTAGTGGTCTGG - Intronic
1078784279 11:14472925-14472947 GATAGAAAGTTTGAGTGGTCTGG - Intronic
1079158437 11:17970723-17970745 TAGAGAAAGTTCTAGTGGTCTGG + Intronic
1079224883 11:18596385-18596407 CACAAAAAGCTTCAGTGGTCAGG + Intergenic
1079303650 11:19303109-19303131 TGGAGAACGTTCTAGTGGTCTGG - Intergenic
1079643920 11:22839604-22839626 CAGAAAAGGTTTTAGTGGTCTGG - Intergenic
1080064468 11:27994546-27994568 TAGAGAAAGTTTTAGTGGTTTGG + Intergenic
1080671023 11:34377930-34377952 TGAAGAAAGTTTTAGTGGTCTGG + Intergenic
1082200008 11:49355044-49355066 TGGAGAAAGTTTTAGTGGTCTGG - Intergenic
1082230037 11:49752550-49752572 CAGAGAAAGTTTTAGTGGTCTGG + Intergenic
1083016708 11:59461663-59461685 CACAGAACATTTTCATGGCCTGG + Intergenic
1083071421 11:59987209-59987231 TAGAGAAAGTTTTAGTGGTCTGG - Intergenic
1085302868 11:75468600-75468622 CATGGGAGGTTTTAGTGGTCTGG - Intronic
1085633250 11:78137331-78137353 TGGAGAATGTTTTAGTGGTCTGG - Intronic
1085724857 11:78945775-78945797 TGGAGAAAGTTTTAGTGGTCTGG + Intronic
1086034516 11:82400507-82400529 TGGAGAATGTTTTAGTGGTCTGG - Intergenic
1086620021 11:88876399-88876421 CAGAGAAAGTTTTAGTGGCCTGG - Intronic
1086655666 11:89351154-89351176 TGGAGAAAGTTTTAGTGGTCTGG + Intronic
1087375790 11:97337967-97337989 CATAGCACATTTTAGTAGTCAGG + Intergenic
1087421963 11:97940458-97940480 GATAGAAAGTTTAAGTGGTCTGG + Intergenic
1087540598 11:99513119-99513141 GAGAGAAAGTTTTGGTGGTCTGG + Intronic
1087577479 11:100007688-100007710 GAAAGAAAGTTTTAATGGTCTGG - Intronic
1088715083 11:112542129-112542151 CACAGATGATTGTAGTGGTCAGG + Intergenic
1089755580 11:120683976-120683998 GCCAGAAAGTGTTAGTGGTCTGG - Intronic
1090738032 11:129629294-129629316 TGCAGAAAGTTTGAGTGGTCTGG - Intergenic
1091427072 12:400269-400291 TAGAGAAAGTTTGAGTGGTCTGG - Intronic
1092382184 12:8005979-8006001 TGGAGAAAGTTTTAGTGGTCTGG + Intergenic
1092464965 12:8722971-8722993 TGGAGAAAGTTTTAGTGGTCTGG - Intronic
1092823970 12:12379739-12379761 CATAAAAAGTTTTAATGGTCTGG - Intronic
1093427569 12:19045703-19045725 TAGAGAAAGTTTTAGTGGTTTGG + Intergenic
1094112520 12:26876738-26876760 TGAAGAAAGTTTTAGTGGTCTGG + Intergenic
1094250379 12:28353284-28353306 TGCAGAAAGTTTTAGTGGTCTGG - Intronic
1094280083 12:28727231-28727253 TGGAGAATGTTTTAGTGGTCTGG - Intergenic
1095568105 12:43649908-43649930 CAGAGAACTGTTTAGTGGTAAGG - Intergenic
1095605958 12:44068202-44068224 TGGAGAAAGTTTTAGTGGTCTGG - Intronic
1095791196 12:46169263-46169285 GAGAGACAGTTTTAGTGGTCTGG - Intergenic
1096013282 12:48242162-48242184 GGGAGAACGTTTTAATGGTCTGG + Intergenic
1097518197 12:60634010-60634032 TGGAGAAAGTTTTAGTGGTCTGG + Intergenic
1098577885 12:72064681-72064703 CGGAGAAAGTTTTAGTGGTCTGG + Intronic
1098936750 12:76489023-76489045 TACAGCAAGTTTGAGTGGTCTGG + Intronic
1099119180 12:78666214-78666236 TAGAGAAAGTTTTATTGGTCTGG - Intergenic
1099745705 12:86701859-86701881 TGAAGAAAGTTTTAGTGGTCTGG + Intronic
1100618765 12:96251657-96251679 TGGAGAAAGTTTTAGTGGTCTGG + Intronic
1100695603 12:97089401-97089423 AGGAGAACATTTTAGTGGTCTGG - Intergenic
1100723451 12:97383795-97383817 TAGAGAAAGTTTTTGTGGTCTGG - Intergenic
1101048326 12:100834409-100834431 TAGGGAACGTTTTGGTGGTCTGG - Intronic
1103048154 12:117755900-117755922 CGGAGAAAGTTTTAGTGGTCTGG + Intronic
1105337693 13:19488723-19488745 TGGAGAATGTTTTAGTGGTCTGG - Intronic
1107143738 13:37034389-37034411 CAGAGGAAGTTTTAATGGTCTGG + Intronic
1108770646 13:53696561-53696583 ATAAGAAAGTTTTAGTGGTCTGG + Intergenic
1108801634 13:54103726-54103748 TGGAGAAAGTTTTAGTGGTCTGG - Intergenic
1109521881 13:63524113-63524135 CACAGAACGTAATAGTGGCAAGG - Intergenic
1111211872 13:85090043-85090065 TAGAGAAAGTTTTAGTGGTCTGG - Intergenic
1111278438 13:85984836-85984858 TAGAGAAAGTTTTAGTAGTCTGG - Intergenic
1111617612 13:90681041-90681063 TGCGGAAAGTTTTAGTGGTCTGG - Intergenic
1112728839 13:102336303-102336325 TGGAGAAAGTTTTAGTGGTCTGG + Intronic
1113713035 13:112483310-112483332 CGGAGAAAGTTGTAGTGGTCTGG - Intergenic
1113803468 13:113098571-113098593 CACAGAACGTCTCAGCAGTCGGG + Intronic
1114625679 14:24128309-24128331 TGGAGAAAGTTTTAGTGGTCTGG - Intronic
1114813722 14:25930378-25930400 CTCAAAAGGTTTTAGTCGTCTGG + Intergenic
1114950092 14:27739455-27739477 CAGAGAAAAATTTAGTGGTCTGG + Intergenic
1115109965 14:29809737-29809759 GGGAGAAAGTTTTAGTGGTCTGG - Intronic
1115249725 14:31332678-31332700 CAGAGACAGTTTTAGTGATCTGG + Intronic
1115258799 14:31431536-31431558 TGGAGAAAGTTTTAGTGGTCTGG + Intronic
1115280478 14:31656254-31656276 CAGAGAAAGCTTTATTGGTCTGG - Intronic
1115568450 14:34645472-34645494 TAGAGAAAGTTTTAGTGGTCTGG - Intergenic
1115803010 14:37017000-37017022 CAGAGAAAGTTTTAGTAGTCTGG - Intronic
1116091693 14:40315886-40315908 TGGAGAAAGTTTTAGTGGTCTGG + Intergenic
1116277303 14:42851984-42852006 CATAGAAAGTTTTAGTAGTCTGG - Intergenic
1116607152 14:47014759-47014781 TGGAGAAGGTTTTAGTGGTCTGG - Intronic
1117169272 14:53075343-53075365 AGGAGAAAGTTTTAGTGGTCTGG + Intronic
1117201719 14:53396594-53396616 CAGAGAAAGTTTGAGTGGCCTGG + Intergenic
1117926756 14:60788869-60788891 CAGAGAAAGTTTCAGTGGTCTGG - Intronic
1117935432 14:60900389-60900411 TGGAGAAAGTTTTAGTGGTCTGG + Intronic
1118037863 14:61887824-61887846 TGAAGAATGTTTTAGTGGTCTGG - Intergenic
1118959937 14:70519941-70519963 TACAGAATGTTTGAGTGGTCTGG + Intergenic
1119308357 14:73626100-73626122 TGGAGAAAGTTTTAGTGGTCTGG + Intergenic
1119816450 14:77572937-77572959 GAGAGAAAGTTTTAGTGGTCTGG - Intronic
1120910081 14:89658401-89658423 CACAGAAAGTTTTATTGGAGAGG + Intergenic
1123009541 14:105341108-105341130 CACAGTGCGTTTCTGTGGTCAGG + Intronic
1123171271 14:106374773-106374795 CACAGAAATGTTTAGAGGTCAGG - Intergenic
1123194971 14:106607229-106607251 CACAGAAGTGTTTAGAGGTCAGG - Intergenic
1123631789 15:22266176-22266198 CCCAGGACGTTTTAAGGGTCAGG + Intergenic
1124461050 15:29892138-29892160 TGGAGAAAGTTTTAGTGGTCTGG + Intronic
1125236723 15:37523360-37523382 TGGAGAACGTTTCAGTGGTCAGG - Intergenic
1125367473 15:38933249-38933271 CAGAGAAAGATTTAGTTGTCTGG - Intergenic
1125981385 15:44004972-44004994 TGCAGAAAGTTTTAGTGGTCTGG + Intronic
1126697598 15:51339483-51339505 CACAGAACGTTTGAGTTGGGAGG + Intergenic
1126971641 15:54119805-54119827 TAAAGAAAGTTTTAGTGATCTGG + Intronic
1127307692 15:57724056-57724078 TGGAGAAAGTTTTAGTGGTCTGG + Intronic
1128395237 15:67218310-67218332 CACAGCACTTGTTAGTGCTCAGG + Intronic
1128969508 15:72095292-72095314 TGGAGAAAGTTTTAGTGGTCTGG + Intronic
1131042788 15:89287457-89287479 TGAAGAAAGTTTTAGTGGTCTGG - Intronic
1132475313 16:133156-133178 TATGGAAAGTTTTAGTGGTCTGG - Intronic
1134272953 16:12750122-12750144 TGGAGAAAGTTTTAGTGGTCGGG - Intronic
1137416193 16:48283003-48283025 TGAAGAAAGTTTTAGTGGTCTGG + Intronic
1137465854 16:48708517-48708539 TGAAGAAAGTTTTAGTGGTCTGG + Intergenic
1139082053 16:63534261-63534283 CGGAGAAAGTTTGAGTGGTCCGG - Intergenic
1139473437 16:67190342-67190364 CCCAGAACCTCTTAGTGCTCAGG + Intergenic
1140595622 16:76406665-76406687 CGAAGACAGTTTTAGTGGTCTGG + Intronic
1141971204 16:87484232-87484254 CCCAGGACGTTTTAAGGGTCAGG - Intronic
1142908738 17:3068783-3068805 TGGAGAAAGTTTTAGTGGTCTGG - Intergenic
1142925826 17:3235462-3235484 TGGAGAAAGTTTTAGTGGTCTGG + Intergenic
1143442884 17:6989132-6989154 TGGAGAAAGTTTTAGTGGTCCGG + Intronic
1144530769 17:16036802-16036824 CACAGAAGATTTTAGTGGTCTGG - Intronic
1145806406 17:27736322-27736344 CAGAGAAAGTTTTAGCAGTCTGG + Intergenic
1146412643 17:32600737-32600759 CGGAGAAAGTTTGAGTGGTCTGG - Intronic
1146538762 17:33676496-33676518 TAGAGAACGTTTCAGTGGTCTGG + Intronic
1146578779 17:34017679-34017701 TTCAGAAAGTTTTGGTGGTCTGG + Intronic
1150468112 17:65412483-65412505 TAGAGAAAGTTTAAGTGGTCTGG - Intergenic
1151178335 17:72307352-72307374 CACATAAGGTCTTACTGGTCAGG - Intergenic
1151219024 17:72597968-72597990 CACAGAACATTCTATTGGACAGG + Intergenic
1151859100 17:76746157-76746179 CGGAGAAAGTTTTAGTGGTCTGG + Intronic
1152979019 18:255420-255442 CAGAGAAAGTCTGAGTGGTCTGG + Intronic
1153896358 18:9565611-9565633 TGCAGAAAGTTTGAGTGGTCTGG + Intronic
1154961164 18:21309987-21310009 CACAGAAAGTTCTACTGGACAGG - Intronic
1155266092 18:24095312-24095334 CGAATAAAGTTTTAGTGGTCTGG - Intronic
1155816350 18:30316172-30316194 CACTGAACATTTTAGAAGTCTGG + Intergenic
1156085829 18:33400696-33400718 CGAAGAAAGTTTTAGTGGTCTGG - Intronic
1156572228 18:38269388-38269410 TGCAGAACATTTTAGTGGTCTGG - Intergenic
1156711555 18:39952986-39953008 TGGAGAAAGTTTTAGTGGTCTGG - Intergenic
1157473103 18:48004664-48004686 CTCAGAACGTTTGAGTGGCAAGG - Intergenic
1159656884 18:71040605-71040627 CAGAGAAAGTTTTAGCAGTCTGG + Intergenic
1159700467 18:71620457-71620479 TGCAGAAAGTTTTAGTGGTCTGG - Intergenic
1159980741 18:74776428-74776450 GACAGAAATATTTAGTGGTCCGG + Intronic
1160320545 18:77889418-77889440 TGGAGAACGTTTGAGTGGTCTGG - Intergenic
1162843830 19:13375936-13375958 TGGAGAAAGTTTTAGTGGTCTGG + Intronic
1164901174 19:31925670-31925692 TGGAGAAAGTTTTAGTGGTCAGG - Intergenic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1165686569 19:37826473-37826495 TGGAGAAAGTTTTAGTGGTCTGG + Intergenic
925854082 2:8112836-8112858 TGAAGAAAGTTTTAGTGGTCTGG + Intergenic
925939932 2:8807397-8807419 CACAGAAAGTTCTACTGGACAGG - Intronic
926836269 2:17025320-17025342 AAGAGAAAGTTTTAGTGGTCTGG - Intergenic
928657259 2:33465204-33465226 TGAAGAAAGTTTTAGTGGTCTGG + Intronic
928726605 2:34181030-34181052 TGCAGAAAGTTTTAGTGGTCTGG + Intergenic
929749942 2:44700255-44700277 TGGAGAAAGTTTTAGTGGTCTGG - Intronic
929866823 2:45724688-45724710 CAGAGAAAGTTTGAGTGGTCTGG + Intronic
930471728 2:51824312-51824334 TAGAGAAAGTTTTAGTGGTCTGG + Intergenic
930507186 2:52298163-52298185 TGGAGAAAGTTTTAGTGGTCTGG + Intergenic
930948701 2:57110106-57110128 ATATGAACGTTTTAGTGGTCTGG - Intergenic
931498037 2:62833081-62833103 CAGAGAAAGCTTTAATGGTCTGG + Intronic
931683873 2:64776159-64776181 TGGAGAACGTTTGAGTGGTCTGG - Intergenic
932951001 2:76293319-76293341 GGGAGAAAGTTTTAGTGGTCTGG - Intergenic
933182013 2:79237895-79237917 TGGAGAAAGTTTTAGTGGTCTGG - Intronic
933465934 2:82651669-82651691 GTGAGAAGGTTTTAGTGGTCTGG - Intergenic
933630144 2:84646610-84646632 TGGAGAAAGTTTTAGTGGTCTGG + Intronic
934625069 2:95840237-95840259 TGAAGAAAGTTTTAGTGGTCTGG + Intronic
935168882 2:100594289-100594311 TGGAGAAAGTTTTAGTGGTCTGG - Intergenic
935289078 2:101593982-101594004 TGGAGAAAGTTTTAGTGGTCTGG - Intergenic
936257032 2:110925648-110925670 TGGAGAAAGTTTTAGTGGTCTGG - Intronic
936846839 2:116844704-116844726 CAAAGAATGTTTTATTGGCCAGG - Intergenic
936920207 2:117680859-117680881 TGGAGAAAGTTTTAGTGGTCTGG + Intergenic
937540530 2:122946611-122946633 CGAAGAAAGTTTTGGTGGTCTGG - Intergenic
937563250 2:123251121-123251143 TGAAGAAAGTTTTAGTGGTCTGG - Intergenic
937621652 2:123994991-123995013 CAGAGATAGATTTAGTGGTCTGG + Intergenic
939324002 2:140663656-140663678 TGGAGAAAGTTTTAGTGGTCGGG - Intronic
939973341 2:148687329-148687351 CAGAGAAAGTTTCAGTGGTCTGG - Intronic
940049346 2:149445757-149445779 CAGAGAAAGTTTGAGTGGTCTGG - Intronic
940126810 2:150335133-150335155 CAGAGAAAGTTTTAATGGTCTGG + Intergenic
940126876 2:150336038-150336060 CAGAGAAAGTTTTAGTGGCCTGG + Intergenic
940979698 2:159987388-159987410 CACAAAACGTTTTAGTCGTCTGG - Intronic
941077503 2:161022586-161022608 CGGAGAAAGTTTGAGTGGTCTGG + Intergenic
941386192 2:164855395-164855417 GATAGAAAGTTTTAGTGGTCTGG - Intergenic
942999293 2:182304349-182304371 CGGAGAAAGTTTTAGTTGTCTGG - Intronic
943012644 2:182469522-182469544 TGGAGAAAGTTTTAGTGGTCTGG - Intronic
943034514 2:182725528-182725550 TAGAGAATGTCTTAGTGGTCTGG + Intronic
943851261 2:192725491-192725513 CGGAGAAAGTTTTAGTGGTCTGG - Intergenic
943935475 2:193909972-193909994 TGAAGAAAGTTTTAGTGGTCTGG + Intergenic
944449262 2:199824385-199824407 TGAAGAAAGTTTTAGTGGTCTGG - Intronic
945189353 2:207170196-207170218 TGGAGAACGTTTTAGTGGTGTGG + Intergenic
945346084 2:208718409-208718431 TGGAGAAAGTTTTAGTGGTCTGG - Intronic
945442836 2:209900830-209900852 TGGAGAAAGTTTTAGTGGTCTGG + Intronic
946464591 2:219900506-219900528 CAGAGAAAGTTTTAGTGATCTGG - Intergenic
946575254 2:221068629-221068651 TGAAGAATGTTTTAGTGGTCTGG + Intergenic
947035461 2:225848925-225848947 TGAAGAAAGTTTTAGTGGTCTGG - Intergenic
947234640 2:227927345-227927367 TGGAGAAAGTTTTAGTGGTCTGG + Intergenic
947754148 2:232549616-232549638 TGGAGAAGGTTTTAGTGGTCTGG - Exonic
948249304 2:236512859-236512881 CACAAATCATTTTAATGGTCTGG + Intergenic
1169936770 20:10892015-10892037 CACAGAAGGTTCTACTGCTCTGG - Intergenic
1170088829 20:12567534-12567556 GACAGGACGCTTTAATGGTCTGG + Intergenic
1170237810 20:14127190-14127212 TAGAGAACGTTTTATTGGTCTGG + Intronic
1170316966 20:15052947-15052969 TGGAGAAAGTTTTAGTGGTCTGG + Intronic
1170502096 20:16984796-16984818 TGGAGAAAGTTTTAGTGGTCTGG + Intergenic
1171236665 20:23532455-23532477 TAGAGAAAGTTTTAATGGTCTGG - Intergenic
1171381103 20:24734803-24734825 CACAGAAAGTTATACTGGGCTGG + Intergenic
1171558370 20:26098141-26098163 CACAGAAGGTTTCATTGGACTGG + Intergenic
1172471274 20:35198363-35198385 CAGAGAAAGTTGTAGAGGTCTGG + Intergenic
1173001170 20:39106779-39106801 CACAGGAGGTTTTTGTGGACTGG + Intergenic
1173125918 20:40335975-40335997 CACAGAACGTTTAACAGGCCTGG + Intergenic
1173882651 20:46428719-46428741 CAGAGAAAGTTTGAGTGGTCTGG + Intronic
1173942048 20:46919631-46919653 CAGAGAAAGTCTGAGTGGTCTGG - Intronic
1174745915 20:53062672-53062694 TGGAGTACGTTTTAGTGGTCTGG - Intronic
1175250413 20:57606203-57606225 TGGAGAAAGTTTTAGTGGTCTGG + Intronic
1176946069 21:14983304-14983326 TACAGAAAGCTTTTGTGGTCTGG + Intronic
1177413723 21:20767594-20767616 TTGAGAAAGTTTTAGTGGTCTGG - Intergenic
1178152310 21:29809559-29809581 TAAAGAAAGTTTTAGTGGTCTGG - Intronic
1181504423 22:23342201-23342223 CTCATAACTTTTTAGTAGTCAGG + Intergenic
1181655540 22:24294813-24294835 CTCATAACTTTTTAGTAGTCAGG + Intronic
1181709419 22:24672431-24672453 CTCATAACTTTTTAGTAGTCAGG + Intergenic
1182065252 22:27426739-27426761 CACAGAACCACTTAGTGTTCTGG + Intergenic
1182514306 22:30844657-30844679 GATAGAAAGTTTTAGTGGTCTGG - Intronic
1183533278 22:38376201-38376223 TGGAGAATGTTTTAGTGGTCTGG - Intronic
1185084361 22:48731091-48731113 GATAGAAAGTTTTAATGGTCTGG + Intronic
949623206 3:5839187-5839209 TAAAGAAGGTTTGAGTGGTCTGG - Intergenic
949809826 3:7994699-7994721 CAGAGAAAGTTTGAGTGGTCTGG + Intergenic
949813520 3:8033776-8033798 CGGAGAAAGTTTTATTGGTCCGG - Intergenic
950246313 3:11422548-11422570 CAGAGAAAGTTTTAGTGATCTGG - Intronic
950817903 3:15726409-15726431 CAGAGAAAGTACTAGTGGTCTGG + Intronic
950988891 3:17409676-17409698 CAGAGAAAGTTTGAATGGTCTGG + Intronic
951313197 3:21155718-21155740 TGGAGAAAGTTTTAGTGGTCTGG - Intergenic
951333071 3:21388540-21388562 TGGAGAAAGTTTTAGTGGTCTGG + Intergenic
951373334 3:21880870-21880892 CGAAGAAAGTTTTGGTGGTCTGG + Intronic
951667129 3:25139412-25139434 CGGAGAAAGTTTTAGTGGTGTGG + Intergenic
952044993 3:29308029-29308051 TATAGAAAGTTTTAGTGGTGAGG - Intronic
952084163 3:29797448-29797470 TGGAGAAAGTTTTAGTGGTCTGG - Intronic
952201161 3:31129258-31129280 TGGAGAAAGTTTTAGTGGTCTGG - Intergenic
952515624 3:34102025-34102047 GAGAGAAAGTTTTAGTAGTCTGG - Intergenic
952639283 3:35572803-35572825 TGGAGAAAGTTTTAGTGGTCTGG + Intergenic
952774935 3:37036155-37036177 TAAAGAAAGTTTTAGTGGTCTGG + Intronic
953211842 3:40882697-40882719 TGAAGAAAGTTTTAGTGGTCTGG - Intergenic
953646428 3:44760216-44760238 CAGAGAAAGTTTTAGTGGTCTGG - Intronic
954020058 3:47732330-47732352 CTGAGAAAGTTTCAGTGGTCTGG - Intronic
957476653 3:80734161-80734183 CAGAGAAGGTTTTTGTGGTCTGG + Intergenic
957996747 3:87699583-87699605 TGGAGAAAGTTTTAGTGGTCTGG + Intergenic
958075706 3:88675025-88675047 TAGAGAAAGTTTTAGTGGTCTGG + Intergenic
958494457 3:94826556-94826578 TGGAGAAAGTTTTAGTGGTCTGG - Intergenic
958661643 3:97076311-97076333 TGGAGAAAGTTTTAGTGGTCTGG + Intronic
959830225 3:110852937-110852959 CACAGCATGTTTTATTGCTCTGG - Intergenic
960045022 3:113188497-113188519 TGAAGAAAGTTTTAGTGGTCTGG + Intergenic
960097954 3:113706244-113706266 CAGAGAACGTTTTAATGATCTGG - Intergenic
960603550 3:119481726-119481748 TACAGAAAGGTTTAGTGATCTGG + Intronic
960648057 3:119911899-119911921 CAGGGAAAGTTTTAGTGGTTTGG - Intronic
961613175 3:128157104-128157126 TAGAGAAAGTTTTAGTGGTCTGG + Intronic
961733151 3:128982451-128982473 CAGAGGAAGTTTTAATGGTCTGG - Intronic
962157399 3:132962597-132962619 GGGAGAAAGTTTTAGTGGTCTGG - Intergenic
962157403 3:132962628-132962650 GGGAGAAAGTTTTAGTGGTCTGG - Intergenic
962711863 3:138093867-138093889 TGGAGAAAGTTTTAGTGGTCTGG - Intronic
963183812 3:142390614-142390636 TGGAGAAAGTTTTAGTGGTCTGG - Intronic
963195250 3:142520542-142520564 TAGAGAAAGTTTTAGTGGTCTGG + Intronic
963293199 3:143514806-143514828 TAGAGAAAGTTTTAGTGGTCTGG - Intronic
964035323 3:152188702-152188724 GAGAGAAAGTTTTAGTGGTCTGG + Intergenic
964185948 3:153942801-153942823 CAGAGAAAGTTTTAGTGGTCTGG - Intergenic
964324496 3:155531913-155531935 GAGAGAAAGTTTGAGTGGTCTGG - Intronic
964439961 3:156698036-156698058 TAGAGAAAGTTTTAGTGATCTGG + Intronic
965352287 3:167628462-167628484 TGAAGAAAGTTTTAGTGGTCTGG + Intronic
965886681 3:173454764-173454786 CAGAGAAAATTTTAGTAGTCTGG - Intronic
966214300 3:177486091-177486113 CAGAGAAAGTTTTAGAGATCTGG - Intergenic
966750843 3:183320655-183320677 TGGAGAAAGTTTTAGTGGTCTGG - Intronic
968417335 4:451737-451759 CACAGAACATTTTGGGTGTCAGG + Intronic
968766288 4:2471708-2471730 GGGAGAAAGTTTTAGTGGTCTGG + Intronic
969152723 4:5183968-5183990 CGGAGAAAGTTTGAGTGGTCTGG - Intronic
970390380 4:15604007-15604029 TGGAGAAAGTTTTAGTGGTCTGG - Intergenic
970945181 4:21682443-21682465 TAAAGAATGTTTTAGTGGTCCGG - Intronic
971609770 4:28708137-28708159 GATAGAAAGTTTTCGTGGTCTGG + Intergenic
971638337 4:29094343-29094365 CACATAAAGATTAAGTGGTCTGG - Intergenic
971977842 4:33713596-33713618 CAAAGAAAGTTTTAGTCATCTGG - Intergenic
972022941 4:34337690-34337712 CTAAGAAAGTTTTAATGGTCAGG + Intergenic
972383680 4:38543019-38543041 CGGAGAAAGTCTTAGTGGTCTGG - Intergenic
972455753 4:39252972-39252994 AACAGAACATTTTAGTGGGATGG + Intronic
972776247 4:42243726-42243748 CGGAGAAAGTTTGAGTGGTCTGG + Intergenic
973583671 4:52370349-52370371 CAGAGAACGTTTTAATCGTAAGG + Intergenic
974656236 4:64826176-64826198 TGGAGAATGTTTTAGTGGTCTGG - Intergenic
974997055 4:69174546-69174568 CGGAGAAAATTTTAGTGGTCTGG + Intronic
975010021 4:69339508-69339530 CGGAGAAAATTTTAGTGGTCTGG + Intronic
975407672 4:74010044-74010066 CCGAGAAAGTTTTAGTGGTCTGG + Intergenic
976646980 4:87396845-87396867 TAAAGAAAGTTTTAGTGGTCTGG - Intergenic
976885331 4:89976368-89976390 TGGAGAAAGTTTTAGTGGTCTGG - Intergenic
976934632 4:90614555-90614577 TGGAGAAAGTTTTAGTGGTCTGG + Intronic
977104038 4:92857457-92857479 TAGAGAAAGTTTTAGTGGTCTGG + Intronic
977314363 4:95426680-95426702 CACAGAACGTTTTAGTGGTCTGG + Intronic
977368849 4:96108362-96108384 TGGAGAAAGTTTTAGTGGTCTGG + Intergenic
978204177 4:106059923-106059945 CAGGGAAAGTTTTTGTGGTCTGG + Intronic
978212099 4:106149193-106149215 TGGAGAAAGTTTTAGTGGTCTGG - Intronic
978260508 4:106751908-106751930 TGGAGAACGTTTTAGAGGTCTGG - Intergenic
978304117 4:107303486-107303508 TAAAGAAAGTTTTAGTGGTCTGG - Intergenic
978686290 4:111448195-111448217 TGCAGAAAGTTTTAGTGGTCTGG - Intergenic
978778111 4:112522546-112522568 TAAAAATCGTTTTAGTGGTCGGG + Intergenic
980952847 4:139398718-139398740 GAGAAAAAGTTTTAGTGGTCTGG - Intronic
981493038 4:145361505-145361527 GAGAGAAAGTTTGAGTGGTCTGG + Intergenic
981575873 4:146204764-146204786 TAGAGAAAGTTTTAGTGGTCTGG + Intergenic
981683471 4:147426855-147426877 CGGAGAAAGTTTGAGTGGTCTGG + Intergenic
981764505 4:148233028-148233050 TGGAGAAAGTTTTAGTGGTCTGG - Intronic
981995385 4:150968475-150968497 TGGAGAAAGTTTTAGTGGTCTGG + Intronic
982021748 4:151211671-151211693 TGAAGAAAGTTTTAGTGGTCTGG + Intronic
982169945 4:152651645-152651667 TAGAGAAAGTTTCAGTGGTCTGG - Intronic
982247819 4:153371681-153371703 TAGAGAAAGTTTTAGTGGTCTGG - Intronic
982344614 4:154343724-154343746 GTCAGAAAGTTTGAGTGGTCTGG - Intronic
982488136 4:155993836-155993858 CGGAGAAAGTTTCAGTGGTCTGG - Intergenic
982681721 4:158439092-158439114 TGAAGAAAGTTTTAGTGGTCTGG + Intronic
982946112 4:161625858-161625880 TAGAGAAAGTTTGAGTGGTCTGG + Intronic
983124648 4:163935649-163935671 TGGAGAAAGTTTTAGTGGTCTGG - Intronic
984258579 4:177416692-177416714 CGCAGAAAGTGTGAGTGGTCTGG - Intergenic
984637114 4:182123197-182123219 CAGAGAATGTTGTAGTGGTCTGG - Intergenic
986408430 5:7450331-7450353 TAGAGAAAGTTTGAGTGGTCTGG + Intronic
986506178 5:8454430-8454452 TGCGGAAAGTTTTAGTGGTCTGG + Intergenic
987058663 5:14220648-14220670 TGCAGAAAGTTTTAGTGGTCTGG + Intronic
987088920 5:14493869-14493891 CAGAGAAAGTTTGAGTGGTCTGG + Intronic
987124516 5:14799092-14799114 CGGAGAAAGTTTGAGTGGTCTGG + Intronic
988855173 5:35221376-35221398 CACAGAAAATTTTAGTGATGAGG + Intronic
989228027 5:39053162-39053184 CAGAGAAAGTTTTATTGGTTAGG - Intronic
989762078 5:45027967-45027989 CACAGAAAGTTTGAGTGCTCTGG + Intergenic
990835910 5:60019756-60019778 TAGAGAAAGTTTTAGTGGTCTGG - Intronic
991359593 5:65805468-65805490 TGGAGAAAGTTTTAGTGGTCTGG + Intronic
993599787 5:89907508-89907530 CAGAGAAAGATTTAGTGGTCTGG - Intergenic
993709318 5:91208621-91208643 TAAAGAAAGCTTTAGTGGTCTGG - Intergenic
994736798 5:103565856-103565878 TGGAGAAGGTTTTAGTGGTCTGG + Intergenic
995886974 5:116906214-116906236 CAGAGAAAGTGTTATTGGTCTGG + Intergenic
995989621 5:118221548-118221570 TGGAGAACGTTTTAGTGGTCTGG - Intergenic
996807418 5:127472305-127472327 GAGAGAAAGTTTGAGTGGTCTGG - Intergenic
997483966 5:134212799-134212821 CGGACAAAGTTTTAGTGGTCTGG + Intronic
998579280 5:143354203-143354225 CGAAGAAAGTTTTAGTGGTCTGG - Intronic
998719222 5:144924666-144924688 TAGGGAAAGTTTTAGTGGTCTGG + Intergenic
999159970 5:149487347-149487369 CACAGAGCTTTTTAGTGGCAGGG - Intergenic
999497279 5:152111662-152111684 GATATAAAGTTTTAGTGGTCTGG - Intergenic
999509648 5:152235699-152235721 TAAAGAAAGTTTTAGTGATCTGG - Intergenic
999524626 5:152391061-152391083 CAAAGAAAGTTTGAGTGGTCTGG - Intergenic
1000549883 5:162647826-162647848 TTCAGAAGGTTTTAGTGGTCTGG - Intergenic
1005246790 6:23895331-23895353 AGCAGAAAGTTTTAGTGGTCTGG + Intergenic
1005365756 6:25075193-25075215 CGGAGAAAGTTTTAGTGGTCTGG - Intergenic
1005402215 6:25446561-25446583 TGCAGAAAGTTTTAGTGGTCTGG - Intronic
1006707678 6:36035727-36035749 TGGAGAAAGTTTTAGTGGTCTGG + Intronic
1007379655 6:41479923-41479945 CGGAGAAAGTTTGAGTGGTCTGG + Intergenic
1007884263 6:45208140-45208162 TGGAGAAAGTTTTAGTGGTCTGG + Intronic
1008824714 6:55679791-55679813 CACTGAAGGTTTTATTGGACAGG - Intergenic
1008831608 6:55770495-55770517 TGGAGAACGTTTGAGTGGTCTGG - Intronic
1008975095 6:57416907-57416929 TAAAGAAAGTTTTAATGGTCTGG - Intronic
1009163980 6:60318424-60318446 TAAAGAAAGTTTTAATGGTCTGG - Intergenic
1012012754 6:93811069-93811091 TGGAGAAAGTTTTAGTGGTCTGG + Intergenic
1012109040 6:95202932-95202954 CAGAGAATGTTTTAGTGGTCTGG - Intergenic
1012207836 6:96482941-96482963 TGGAGAAAGTTTTAGTGGTCTGG - Intergenic
1012304556 6:97636804-97636826 TAGAGAAAGTTTTAGTGGTCTGG + Intergenic
1012457638 6:99425157-99425179 CCAAGAACGTTGTAATGGTCCGG + Intronic
1013729733 6:113150859-113150881 TGGAGAAAGTTTTAGTGGTCGGG - Intergenic
1013796184 6:113891617-113891639 TAGAGAAAGGTTTAGTGGTCTGG + Intergenic
1014034908 6:116755294-116755316 TAAAAAACGTTTTAGTGGTCTGG + Intronic
1014130420 6:117825235-117825257 CAGAGAAAGTTTTAGTGGTCTGG - Intergenic
1014294095 6:119597051-119597073 CGGAGAAAGTTTTAATGGTCTGG - Intergenic
1014618007 6:123628010-123628032 TGGAGAAAGTTTTAGTGGTCTGG - Intronic
1014928409 6:127303427-127303449 TGAAGAAAGTTTTAGTGGTCTGG + Intronic
1014945223 6:127489618-127489640 TGCAAAAAGTTTTAGTGGTCTGG + Intronic
1015746495 6:136515299-136515321 CAAAGAAGATTTGAGTGGTCTGG - Intronic
1016490879 6:144600456-144600478 GTGAGAACATTTTAGTGGTCTGG + Intronic
1016867424 6:148781309-148781331 CCGAGAAAGTTTGAGTGGTCCGG + Intronic
1017855223 6:158344987-158345009 TGGAGAAAGTTTTAGTGGTCTGG + Intronic
1018843608 6:167537991-167538013 CGGAGAAAGTTTTAGTGGTCTGG - Intergenic
1020061647 7:5156959-5156981 CCCAGAAAGTTTGAGTGCTCTGG - Intergenic
1020162659 7:5784056-5784078 CACAGAGGGGTTCAGTGGTCCGG - Intergenic
1020166511 7:5811702-5811724 CCCAGAAAGTTTGAGTGCTCTGG + Intergenic
1020670847 7:11109140-11109162 CTCAGTAAGTTTTAGTGGTCTGG + Intronic
1022682387 7:32561560-32561582 TGCAGAAAGTTTGAGTGGTCTGG - Intronic
1022899333 7:34787401-34787423 TGGAGAAAGTTTTAGTGGTCTGG - Intronic
1022958881 7:35406225-35406247 CGGAGAAAGTTTCAGTGGTCTGG + Intergenic
1024257985 7:47552977-47552999 CAAAGAAAGTTTGAATGGTCTGG + Intronic
1025938457 7:66056241-66056263 TAGAGAAAGTTTGAGTGGTCTGG + Intergenic
1027289746 7:76693253-76693275 TAGAAAACATTTTAGTGGTCTGG + Intergenic
1027596078 7:80176172-80176194 TGGAGAAAGTTTTAGTGGTCTGG + Intronic
1027632012 7:80618621-80618643 TAGAGAAAGTTTGAGTGGTCTGG + Intronic
1028037681 7:86004982-86005004 TGGAGAAAGTTTTAGTGGTCCGG - Intergenic
1028870553 7:95767012-95767034 TGGAGAAAGTTTTAGTGGTCTGG + Intergenic
1030426023 7:109379455-109379477 TGGAGAAAGTTTTAGTGGTCTGG + Intergenic
1030827026 7:114170627-114170649 TGAAGAAAGTTTTAGTGGTCTGG + Intronic
1031336322 7:120537878-120537900 TGGAGAAAGTTTTAGTGGTCTGG - Intronic
1031815255 7:126425834-126425856 TAGACAAAGTTTTAGTGGTCTGG - Intergenic
1031827314 7:126582240-126582262 TGGAGAAAGTTTTAGTGGTCTGG + Intronic
1032180854 7:129676167-129676189 TGGAGAAAGTTTTAGTGGTCCGG - Intronic
1032235488 7:130118467-130118489 TGCAGAAAGTTTAAGTGGTCTGG - Intronic
1033388472 7:140902825-140902847 TAAAGAAAGTTTTAGTGATCTGG + Intronic
1034568868 7:151938521-151938543 CAGAGAAAGTTTGAGTGGTCTGG + Intergenic
1037120504 8:15280170-15280192 TGGAGAAAGTTTTAGTGGTCTGG + Intergenic
1037435595 8:18859840-18859862 TAGAGAAAGTTTTAATGGTCTGG - Intronic
1038025628 8:23586936-23586958 TGAAGAAAGTTTTAGTGGTCTGG - Intergenic
1039815197 8:41087576-41087598 CAGAGAAAGTTTGAGTGGTCTGG + Intergenic
1041822306 8:62050944-62050966 TGAAGAAAGTTTTAGTGGTCTGG + Intergenic
1042440998 8:68826435-68826457 TAGAGAAAGTTTTAATGGTCTGG - Intergenic
1042785825 8:72545896-72545918 TGGAGAAAGTTTTAGTGGTCTGG + Intronic
1042795477 8:72658285-72658307 TGTAGAAAGTTTTAGTGGTCTGG + Intronic
1043044326 8:75301945-75301967 CACAGAATGTTTTGGTGAACAGG + Intergenic
1043204212 8:77415888-77415910 TAAAGAAAGTTTGAGTGGTCTGG + Intergenic
1044030867 8:87235189-87235211 CTGAGAAAGTTTTACTGGTCTGG - Intronic
1044164277 8:88961859-88961881 TTGAGAAAGTTTTAGTGGTCTGG - Intergenic
1044414456 8:91920482-91920504 TGGAGAAAGTTTTAGTGGTCTGG + Intergenic
1044449385 8:92316143-92316165 TAAAGAAAGTTTGAGTGGTCTGG + Intergenic
1045381146 8:101627806-101627828 TGGAGAAAGTTTTAGTGGTCTGG + Intronic
1045948332 8:107823200-107823222 TAGAGAAAGTTTTAGAGGTCTGG - Intergenic
1046352094 8:113028628-113028650 CGGAGAAAGTTTTAGTGGTTTGG + Intronic
1046571725 8:115974623-115974645 TGGAGAAAGTTTTAGTGGTCTGG - Intergenic
1047827949 8:128598182-128598204 CAGAGAATGTTTTAGTAGTCTGG + Intergenic
1048129284 8:131675986-131676008 TAGAGAAAGTTTTAGTGGTCCGG - Intergenic
1049136664 8:140908169-140908191 CTGAGAAGGTTTTGGTGGTCTGG + Intronic
1049915332 9:311960-311982 CACAGCACGTTTAAGTGGCGGGG - Exonic
1050039325 9:1472318-1472340 CACAGAAAGTTTTATTGCACAGG + Intergenic
1050298686 9:4234098-4234120 CGGAGAAAGTTTGAGTGGTCTGG - Intronic
1051077404 9:13256278-13256300 TGGAGAAAGTTTTAGTGGTCTGG - Intronic
1051473513 9:17476598-17476620 CACAGAAAGTTTTAGTGGTCTGG + Intronic
1051542953 9:18241026-18241048 TATGGAAAGTTTTAGTGGTCTGG - Intergenic
1051601671 9:18881126-18881148 CGAAGAAAGTTTTAGTGGTCTGG - Intronic
1051770735 9:20576272-20576294 TGGAGAAAGTTTTAGTGGTCTGG - Intronic
1051852971 9:21530266-21530288 AAGAGAAAGTTTTAGGGGTCTGG - Intergenic
1052060511 9:23954856-23954878 TGGAGAAAGTTTTAGTGGTCTGG + Intergenic
1052380367 9:27764415-27764437 CACAGAACATTTTAAATGTCGGG + Intergenic
1054839445 9:69720287-69720309 TGGAGAACGTTTTAGTGCTCTGG + Intronic
1054994530 9:71370451-71370473 TGGAGAAAGTTTTAGTGGTCTGG + Intronic
1055377267 9:75662722-75662744 GGGAGAACATTTTAGTGGTCTGG + Intergenic
1055547532 9:77394970-77394992 TGGAGAACGTTTTAGTGGTCTGG - Intronic
1055557153 9:77486397-77486419 TGGAGAAAGTTTTAGTGGTCTGG - Intronic
1057539020 9:95947264-95947286 CGAAGAAAGTTTTAGTGGTCTGG + Intronic
1058196396 9:101982147-101982169 GATAGAATATTTTAGTGGTCTGG + Intergenic
1058260905 9:102830112-102830134 TAGAGAAAGTTTTAGTGGTCTGG + Intergenic
1059629051 9:116099873-116099895 CACAAAGCGTTTGAGTGGTTTGG - Intergenic
1059637933 9:116188721-116188743 CACAGAAAGTTCTGGTGGACAGG + Intronic
1059742629 9:117167369-117167391 AACATTACTTTTTAGTGGTCAGG + Intronic
1061494670 9:130965453-130965475 CGGAGAAAGTTTCAGTGGTCTGG + Intergenic
1062251871 9:135602040-135602062 CACAGAACATCTTTGTGGCCTGG + Intergenic
1186090575 X:6043533-6043555 CACAGGACTTTTTGGTGGTGTGG + Intronic
1187721599 X:22156512-22156534 TAAAGAAAGTTTTATTGGTCCGG - Intronic
1188405231 X:29799732-29799754 CACAGAAAGTTTTGTTGGGCAGG + Intronic
1188425180 X:30037989-30038011 TGGAGAAAGTTTTAGTGGTCTGG + Intergenic
1188967228 X:36569258-36569280 CACTGAAATATTTAGTGGTCTGG + Intergenic
1189768512 X:44396905-44396927 TAGAGAAAGTTTTAGTGGTCTGG + Intergenic
1190183578 X:48215704-48215726 TAGAGAAAGTTTGAGTGGTCTGG - Intronic
1190199552 X:48348770-48348792 TAGAGAAAGTTTGAGTGGTCAGG + Intronic
1190204344 X:48390680-48390702 TAGAGAAAGTTTGAGTGGTCAGG - Intronic
1190206192 X:48404723-48404745 TAGAGAAAGTTTGAGTGGTCAGG + Intronic
1190210182 X:48440330-48440352 TAGAGAAAGTTTGAGTGGTCAGG - Intergenic
1190362099 X:49659060-49659082 CATAAAACATTTTAGTGGCCAGG - Intergenic
1190660203 X:52647046-52647068 TAGAGAAAGTTTGAGTGGTCAGG + Intronic
1191813286 X:65215601-65215623 GTGAGAAAGTTTTAGTGGTCTGG - Intergenic
1191957750 X:66664555-66664577 GACAGAAAGTTTTATTGGTTTGG - Intergenic
1192667634 X:73104413-73104435 TGAAGAAAGTTTTAGTGGTCTGG + Intergenic
1193342861 X:80371797-80371819 TGGAGAAAGTTTTAGTGGTCTGG - Intronic
1193926649 X:87494616-87494638 TGGAGAAAGTTTTAGTGGTCTGG + Intergenic
1194364738 X:93001015-93001037 TAGAGAAAATTTTAGTGGTCTGG + Intergenic
1195553949 X:106200107-106200129 TATGGAAGGTTTTAGTGGTCAGG - Intronic
1195889487 X:109676824-109676846 CACAGAAAGTTCTATTGGTAGGG - Intronic
1196378318 X:115060287-115060309 TGAAGAAAGTTTTAGTGGTCTGG + Intergenic
1196504798 X:116428791-116428813 TGGAGAAAGTTTTAGTGGTCTGG + Intergenic
1197687394 X:129455676-129455698 TGGAGAAAGTTTTAGTGGTCTGG + Intronic
1198034640 X:132788784-132788806 TGGAGAACATTTTAGTGGTCTGG + Intronic
1198145115 X:133848355-133848377 CACAGAACGTTTTAGGAAGCAGG - Intronic
1198542928 X:137659476-137659498 TAAAGAAAGTTTTAGTGGTCTGG + Intergenic
1199048532 X:143207095-143207117 CACAGACCATTTATGTGGTCAGG + Intergenic
1199260193 X:145764243-145764265 TGGAGAAAGTTTTAGTGGTCTGG + Intergenic
1200355394 X:155544633-155544655 CACAGAAAGTATTAGTTGGCAGG - Intronic
1200672966 Y:6117276-6117298 TAGAGAAAATTTTAGTGGTCTGG + Intergenic
1202594161 Y:26519826-26519848 CGGAGAATGTTTTAGTGGTCTGG + Intergenic