ID: 977314557

View in Genome Browser
Species Human (GRCh38)
Location 4:95429522-95429544
Sequence CATTTAACTTTGAAAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 191}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977314557_977314561 13 Left 977314557 4:95429522-95429544 CCTCCCACTTTCAAAGTTAAATG 0: 1
1: 0
2: 0
3: 17
4: 191
Right 977314561 4:95429558-95429580 AGAAAAAAAATTATTCTTCCTGG 0: 1
1: 0
2: 9
3: 139
4: 1208
977314557_977314562 17 Left 977314557 4:95429522-95429544 CCTCCCACTTTCAAAGTTAAATG 0: 1
1: 0
2: 0
3: 17
4: 191
Right 977314562 4:95429562-95429584 AAAAAATTATTCTTCCTGGCAGG 0: 1
1: 0
2: 10
3: 85
4: 684

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977314557 Original CRISPR CATTTAACTTTGAAAGTGGG AGG (reversed) Intronic
902647846 1:17815767-17815789 CATTGAAGTTTCAAAGTGAGAGG - Intronic
903197719 1:21704862-21704884 CATTTAACTTTTAAACTGAATGG + Intronic
903355632 1:22745653-22745675 CCTTTATCTCTGAAAGGGGGTGG + Intronic
905237341 1:36559179-36559201 GAATTACCATTGAAAGTGGGAGG - Intergenic
905519096 1:38584299-38584321 CTTTTAGCTTTGAAATTTGGGGG - Intergenic
907765544 1:57406820-57406842 CATTTTATTTTTAAATTGGGAGG - Intronic
908077303 1:60534792-60534814 AATTTAACTTTAAAAATTGGTGG + Intergenic
908950122 1:69550828-69550850 CATTTAACTATGAAAGTTAATGG + Intergenic
909118692 1:71573050-71573072 CATGTAATTTTGTATGTGGGAGG - Intronic
909650356 1:77968860-77968882 CATTTAAGTTTGAAGGGGGGAGG - Intronic
910021588 1:82596657-82596679 AATTTTACTTTTAAAGTGGTGGG - Intergenic
911846851 1:102764208-102764230 CATTTATCTTTGATGGTGGGTGG + Intergenic
912617258 1:111115568-111115590 TATTTAACTTTTAAAGTAAGAGG - Intergenic
915100399 1:153495141-153495163 CTCTTAATTTAGAAAGTGGGTGG - Intergenic
915226479 1:154415398-154415420 AATGTAACTTTGAAAATTGGTGG - Intronic
917187637 1:172378532-172378554 AATTTAGCTTTGAATGTGGGAGG + Intronic
919277020 1:195433378-195433400 AATTTAAATTTTATAGTGGGTGG - Intergenic
919681319 1:200437592-200437614 CATTGAACCTTAAAAGTGGGAGG + Intergenic
921373312 1:214448051-214448073 TATTTAAATTTCAAAGAGGGAGG - Intronic
921797883 1:219369006-219369028 CATTTAACTTTGAACAGGGGTGG + Intergenic
921820824 1:219615060-219615082 CAGTAAATTTTGAAATTGGGTGG - Intergenic
922598635 1:226833325-226833347 CAATTGGCTTTGAAAGTCGGGGG - Intergenic
923006887 1:230057407-230057429 CAATTATCTTTGGAAGTGAGTGG + Intergenic
923236483 1:232038548-232038570 CATTAAACTTGGAAAGTTTGAGG - Intronic
924050252 1:240073400-240073422 CTTTTAAATGTGAAAGAGGGAGG - Intronic
924103002 1:240623462-240623484 CATTTGACTTTGAAATTCAGCGG + Intergenic
1065350377 10:24790351-24790373 CATTTCTCTTTGGAAGTTGGAGG - Intergenic
1065614674 10:27507700-27507722 CCTTTAACTTTGAAAATATGAGG + Intronic
1066991933 10:42523502-42523524 CATTTAGCTTTGAAATTTAGAGG - Intergenic
1073222555 10:101887865-101887887 CATTTAACTTTGAAAGAAGTTGG + Intronic
1074023700 10:109611901-109611923 TATTTGACTTCGAAAATGGGAGG + Intergenic
1074581776 10:114725996-114726018 CTTTTGCCTTTGAAAGTGGTGGG + Intergenic
1075091696 10:119447395-119447417 CGTTTGACTTAGAAAGCGGGAGG - Intronic
1076055273 10:127367674-127367696 CATATGACTTTGAAGGTAGGAGG - Intronic
1080196848 11:29621325-29621347 CATTTAACTTTTTGAGTGGTGGG - Intergenic
1084590468 11:70087126-70087148 CATTTAATTTTTAATTTGGGTGG + Intronic
1086867807 11:92001428-92001450 CATTTGACTCAGAAAGTGGCAGG + Intergenic
1086888730 11:92231111-92231133 AAGTTACCTTTGAAATTGGGGGG - Intergenic
1087768200 11:102179104-102179126 CATTTCACTATGAAATTTGGAGG + Intronic
1090131557 11:124147411-124147433 CTTTTCACTCAGAAAGTGGGTGG + Exonic
1091880615 12:3974491-3974513 AATTGAACTTAGAAAGGGGGAGG - Intergenic
1093356961 12:18178137-18178159 AAGTTAAGTTTAAAAGTGGGAGG - Intronic
1093409595 12:18848524-18848546 CATGGGACTTTGACAGTGGGAGG - Intergenic
1094346970 12:29481201-29481223 CATGTAACTTTCCATGTGGGTGG + Intronic
1094430103 12:30359127-30359149 AATTTAACTGTGCAAGTGGCTGG + Intergenic
1097618420 12:61910702-61910724 CACATAACTATGAAAGTGGCAGG + Intronic
1098011866 12:66061777-66061799 CGTCTAACTTTAAAGGTGGGTGG - Intergenic
1098843444 12:75506046-75506068 CATTTAAATTTTATAGTGGGAGG + Intronic
1101662203 12:106775415-106775437 CATATAATGTTGTAAGTGGGTGG + Intronic
1101908353 12:108844624-108844646 CCTTTCTCTTTGAATGTGGGAGG + Intronic
1109060628 13:57615058-57615080 AATATAAATTTGGAAGTGGGTGG - Intergenic
1110634130 13:77746071-77746093 CCTTTGACTTTAAAAGTTGGGGG + Intronic
1113011222 13:105768569-105768591 CATATGACCTTCAAAGTGGGAGG + Intergenic
1114768048 14:25397180-25397202 CATTTAACTTTGCAAATAGAAGG - Intergenic
1115545919 14:34464632-34464654 CAGTTAAGTTTGAAAGTAGGAGG - Intergenic
1115819114 14:37195011-37195033 AATTTAACATGGAAAGTGGTGGG - Intergenic
1116422988 14:44754811-44754833 CATTTAATTTTGCAAGTGCTAGG + Intergenic
1116948118 14:50854996-50855018 CATATAAAATTGTAAGTGGGCGG + Intergenic
1119334792 14:73823892-73823914 CATTGATCTTTGTAAGTTGGGGG + Intergenic
1120703384 14:87723253-87723275 CATTTAACTCTGAAATGGGATGG + Intergenic
1121162426 14:91756629-91756651 CATTTAACTATTGAAGTGGTTGG + Intronic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1122925514 14:104897737-104897759 CATTTGAGTTTGCAAGGGGGTGG + Intergenic
1125392891 15:39214031-39214053 CATTTAACTTTTGAAGTGTGGGG + Intergenic
1126855556 15:52835677-52835699 CATTAAAAGTTCAAAGTGGGTGG + Intergenic
1127035877 15:54917236-54917258 CTTTTAACTATGTAAGTGGCGGG - Intergenic
1127518145 15:59716110-59716132 CATTTAACTTTGAAACTATAAGG - Intergenic
1127674209 15:61225427-61225449 TCTTTGACTTTGAAAGTGCGTGG - Intronic
1129889018 15:79058737-79058759 TATTTATCTTTAAAAGTGGGTGG - Intronic
1134195121 16:12153965-12153987 AGTTTAACTTTCAAAGCGGGAGG - Intronic
1138944457 16:61831012-61831034 CTTTTTTCCTTGAAAGTGGGGGG + Intronic
1139019711 16:62732456-62732478 CATTCAAATTTGAAAGTGAAAGG + Intergenic
1140990067 16:80202130-80202152 CATTAAACTTTGAAAAGCGGTGG + Intergenic
1144232018 17:13216979-13217001 TAAGTAACTTTGAAAATGGGTGG + Intergenic
1146671331 17:34740176-34740198 CTTTTTACCCTGAAAGTGGGTGG + Intergenic
1152363255 17:79842007-79842029 CATTTCACTTTCAAAGTCGTTGG - Intergenic
1155049425 18:22133662-22133684 CATTTAAATATGAATGTTGGTGG + Intergenic
1155527724 18:26734234-26734256 CATTTAACTCTGAGACTAGGTGG + Intergenic
1157735197 18:50041814-50041836 CATTTGACTTTGCAAATGGTAGG - Intronic
1159332786 18:67022023-67022045 CCTATAATTTTGAAAGTAGGTGG - Intergenic
1159561253 18:69997417-69997439 AATGTAAATGTGAAAGTGGGTGG + Intergenic
1163333774 19:16658666-16658688 CATCTAATTTTAAAAGTGGCAGG + Intronic
1168515066 19:57004075-57004097 TATTTAATTTTGAAAGTGCATGG - Intergenic
925120308 2:1413147-1413169 TATTTAACTGTGAAAGTAAGAGG + Intronic
927374934 2:22402738-22402760 CATTTCACCTTCAAAGTGGAGGG - Intergenic
927767445 2:25824930-25824952 CTTTTAACTTTGAAAGTTGATGG - Intronic
928265792 2:29810600-29810622 CAGTCAACGTTGAAACTGGGAGG - Intronic
931154367 2:59611078-59611100 AATTTAACTTTTAAATTCGGGGG + Intergenic
935735329 2:106102341-106102363 GATTTAATATTGAAACTGGGGGG + Intronic
937247629 2:120503701-120503723 CATTTAATTTTTATAGTGGAGGG + Intergenic
939162505 2:138606883-138606905 CATGTAACTTTCCTAGTGGGAGG - Intergenic
939198144 2:138998918-138998940 TATTTACCTTGCAAAGTGGGTGG + Intergenic
939775333 2:146379924-146379946 CATCTAACTTTAAAAGAGGTGGG + Intergenic
940120855 2:150264116-150264138 GACCTAACTTTGAAAATGGGTGG + Intergenic
940550483 2:155149427-155149449 CATTTTTCCTTGACAGTGGGTGG + Intergenic
940807956 2:158208900-158208922 CATATAATTTTGAAACTGGGAGG - Intronic
941181240 2:162261885-162261907 TATTAAGCTTTGCAAGTGGGAGG - Intergenic
941377114 2:164745412-164745434 AATTGAAATTTGAAATTGGGGGG - Intronic
941584415 2:167339577-167339599 CATTTACTTTTTAAGGTGGGTGG + Intergenic
942301869 2:174570822-174570844 GATTCAATTTTAAAAGTGGGTGG + Intronic
942584616 2:177461800-177461822 CATGGAAATTTTAAAGTGGGAGG + Intronic
943086762 2:183321764-183321786 CAATTGACTTTGATAGTTGGTGG - Intergenic
943518254 2:188913343-188913365 AACTTAACTTTGACTGTGGGGGG - Intergenic
943934853 2:193903420-193903442 TAGTTAACTATGTAAGTGGGAGG + Intergenic
944325903 2:198403482-198403504 CATTTAACTCGAAAATTGGGTGG - Intronic
945699938 2:213156817-213156839 CATTTGACTTTGGAATTGGGAGG + Intergenic
1169332430 20:4726825-4726847 GTTTTAACATTGAAAGTGAGCGG + Exonic
1169404171 20:5309504-5309526 TCTTTAACTGTGAAAGAGGGAGG - Intronic
1173549854 20:43925234-43925256 CATTTAAATTTGTAAATGGGAGG + Intronic
1174333383 20:49839214-49839236 CATTTCACATTGAAAATGGGTGG + Intronic
1174896736 20:54457412-54457434 CATTTAACTATGTAAGTGTAAGG + Intergenic
1175197976 20:57258729-57258751 CATTGATCTCTGAAAGAGGGAGG + Intronic
1182290839 22:29278388-29278410 CATTTAACAGTGAAATTGGCTGG + Intronic
1182357000 22:29726743-29726765 CATTTGCCTTTGGGAGTGGGGGG - Intronic
1183994013 22:41620115-41620137 CAATTAACTTAGAAACTGTGGGG + Intronic
1184969722 22:48007688-48007710 CATGTAACTTTGGAAGTCAGTGG - Intergenic
1184990351 22:48164191-48164213 TATTTAACTTATAAAGTAGGAGG + Intergenic
949365706 3:3278313-3278335 CATTTTACTTTGAAAGGAGAGGG - Intergenic
950183335 3:10930173-10930195 CATATGAGTTGGAAAGTGGGGGG - Intronic
951437613 3:22682991-22683013 CATTTAACTTGTAAAGTTTGGGG - Intergenic
952189600 3:31008763-31008785 CATGTAAATGTGTAAGTGGGAGG + Intergenic
952256993 3:31704237-31704259 CAGGTCAGTTTGAAAGTGGGTGG + Intronic
952773118 3:37020265-37020287 CAATTACCTTAGATAGTGGGAGG - Intronic
953103147 3:39849901-39849923 CATTTAAGTTTGTTAGAGGGAGG - Intronic
953596902 3:44324472-44324494 CATATAACTGTGCAACTGGGGGG + Intronic
955284642 3:57627531-57627553 CATTAAATTTTGAAAATGGAAGG + Exonic
955472784 3:59303338-59303360 CTTTTAATTTTGAACATGGGTGG - Intergenic
957949009 3:87100140-87100162 CTTTAAACTTTGAAAATCGGCGG + Intergenic
958437956 3:94121340-94121362 CCTTTATCATTGAAAGAGGGAGG - Intronic
959206136 3:103309302-103309324 AATTCAATTTTGAAAGTGGCTGG - Intergenic
959554431 3:107700308-107700330 AAATAAACTTTGAAAGTGGCAGG + Intronic
962606730 3:137038240-137038262 CATTGAAATATGAAAGTTGGAGG - Intergenic
963135009 3:141894785-141894807 CAGTTAACTTTGTAAGTAGAAGG + Intronic
963201960 3:142595500-142595522 CAATGAACTATGAAAGTAGGTGG - Intergenic
963516041 3:146309104-146309126 AATTAATCTTTGAAAGTCGGGGG + Intergenic
964204294 3:154154648-154154670 CATTTATCTAAGAAAGTGAGGGG - Intronic
964392335 3:156210842-156210864 AAAATAACTTTGAAAGTGGAAGG - Intronic
964447392 3:156774416-156774438 CATTTGACTTTGGGAGTGGAGGG - Intergenic
964505376 3:157393122-157393144 CAGTTATCTTTGCAAGTGTGAGG + Intronic
965930408 3:174035899-174035921 CATGTAACTTGGAATGAGGGGGG - Intronic
967974067 3:195021586-195021608 CATTTATTTTTGAAAGTGCTAGG + Intergenic
970745452 4:19289325-19289347 TTTTTAACTTTTAAAGTTGGGGG + Intergenic
971234327 4:24827591-24827613 CATTTATCTTTCAAACCGGGTGG - Intronic
973590841 4:52439588-52439610 GGTTTTACTTTGAAAGTGTGTGG - Intergenic
973691374 4:53436860-53436882 CACTTAAATGTAAAAGTGGGTGG - Intronic
977314557 4:95429522-95429544 CATTTAACTTTGAAAGTGGGAGG - Intronic
979606259 4:122642090-122642112 AATATGACTGTGAAAGTGGGTGG + Intergenic
980980454 4:139650436-139650458 CATATGACTTTGGAAGTGGGAGG - Intergenic
981718997 4:147780092-147780114 CATATTACTTTGAAAATGAGGGG - Intronic
982473906 4:155826965-155826987 CATTCCACTTTGAAGGTGGTAGG + Intergenic
983120834 4:163882632-163882654 CATTAAAATTTTAAAGTGAGAGG - Intronic
986980114 5:13437630-13437652 CATATGAATTTGAAAGTGAGAGG + Intergenic
988130610 5:27099247-27099269 CATTTAGCTTTGCAACTGAGTGG - Intronic
989703802 5:44302901-44302923 CATTTAATTTTGGTTGTGGGTGG + Intergenic
991611565 5:68454974-68454996 CAATTAACCTTCAGAGTGGGAGG + Intergenic
994528666 5:100937518-100937540 CATTTAGCTTTGAGGGTGGTGGG + Intergenic
994943694 5:106358217-106358239 CATTTAAATATTAATGTGGGTGG - Intergenic
998952132 5:147402972-147402994 AATTTAACTGTGGAAGTTGGAGG - Intronic
1000182000 5:158820675-158820697 CATTTCACTGTGTAAGTGGTTGG - Intronic
1003882976 6:10495028-10495050 CATTGATTTTTGAAAGTGTGTGG + Intronic
1004652999 6:17630186-17630208 CAGTTACATTTGGAAGTGGGAGG + Intronic
1004982071 6:21035959-21035981 CATTTAACTGTGCAATTGAGTGG - Intronic
1006048013 6:31315558-31315580 CATTTCACTGTGAATGTGGAAGG + Intronic
1006231366 6:32589814-32589836 CCTATAACTTGGAATGTGGGTGG - Exonic
1007257580 6:40539594-40539616 CATTCAAGTTTCAAGGTGGGAGG + Intronic
1008943062 6:57068459-57068481 CATTTTGATTTGAAAGTGGCAGG + Intergenic
1010716757 6:79239116-79239138 CATTTAGCCTTGAAAGGGTGTGG - Intergenic
1013878651 6:114866155-114866177 CAATTGACTTTAAAAGAGGGAGG + Intergenic
1013882402 6:114920644-114920666 CTATTAACTTTGGAAGTGAGTGG - Intergenic
1020625789 7:10577876-10577898 CATTTTAGTTTGAAACTGTGAGG - Intergenic
1021363694 7:19749383-19749405 CATGTAACCTATAAAGTGGGTGG + Intronic
1024053241 7:45642820-45642842 CATTTGACTTTGCAAGGTGGAGG + Intronic
1024334475 7:48192259-48192281 CTTTTAACTTTGAAAATTTGAGG + Intronic
1024711302 7:52018285-52018307 CATTTATCTCTGAAAGTTGATGG + Intergenic
1025797418 7:64752491-64752513 CATGTAAACTTGAAAATGGGAGG - Intergenic
1026193353 7:68149776-68149798 CATTCAAATTTGACAATGGGAGG - Intergenic
1028799692 7:94948635-94948657 CATGTAACTTGGAAAGAGAGGGG - Intronic
1031358812 7:120822213-120822235 TAAATAACTTTAAAAGTGGGGGG - Intronic
1031516325 7:122703429-122703451 CATTTAATGTGGGAAGTGGGTGG - Intronic
1032322059 7:130894620-130894642 CTTTTCCCTTTGAGAGTGGGAGG - Intergenic
1035908870 8:3543495-3543517 CAATTAACTGTGGAAATGGGAGG + Intronic
1037694896 8:21215034-21215056 AAATTAACTTTGAAAGTGTTTGG + Intergenic
1039167928 8:34707188-34707210 GATTTATTTTTGAAGGTGGGGGG + Intergenic
1039776169 8:40739125-40739147 CATTTAATGTGGAACGTGGGTGG + Intronic
1041536626 8:58933553-58933575 GATTAAACTTTGAAGGGGGGTGG + Intronic
1041919171 8:63164061-63164083 CATTTAATTGTGAAATTTGGAGG - Intergenic
1042231288 8:66557472-66557494 CTTTTAACTTTGAATTTGGTTGG - Intergenic
1042258434 8:66831160-66831182 CATTTATTTTTTAAAGAGGGAGG + Intronic
1042439427 8:68808982-68809004 CACTTAACTTTCTCAGTGGGAGG + Intronic
1042684085 8:71418151-71418173 TCTTTAAGTTGGAAAGTGGGAGG - Intronic
1044105660 8:88203037-88203059 AATTAAACTTGCAAAGTGGGGGG + Intronic
1044340193 8:91038198-91038220 CATTTCAGGTTGAAAGTCGGTGG - Intronic
1045761171 8:105609556-105609578 CATGTAACTTTGGCAATGGGAGG - Intronic
1046409600 8:113822985-113823007 CATTTTATTTTAAAATTGGGTGG + Intergenic
1046864060 8:119126300-119126322 AAGTTAACTGTGAAACTGGGAGG - Intergenic
1047050254 8:121103483-121103505 CTTTTAACTTTTAAATTTGGGGG - Intergenic
1049261157 8:141639964-141639986 AATTGAACTCTGCAAGTGGGAGG - Intergenic
1056453220 9:86736511-86736533 CATTTAATTTTGAGAGTGAAGGG + Intergenic
1059299327 9:113299394-113299416 CATTTCTCTTCGAAAGTGGCTGG + Exonic
1060131168 9:121100974-121100996 GATCTAACATTGACAGTGGGGGG - Intronic
1060191180 9:121593967-121593989 CAGGTTACTATGAAAGTGGGAGG - Intronic
1061536885 9:131255825-131255847 GAAGTGACTTTGAAAGTGGGAGG + Intergenic
1188167893 X:26885212-26885234 CATGTAAACTTGAAAATGGGAGG - Intergenic
1189108931 X:38266783-38266805 CACTTTACTTTGAGTGTGGGTGG + Intronic
1191976585 X:66878501-66878523 CATTTCACATTGAAAGGGGCAGG - Intergenic
1192781896 X:74302951-74302973 CATTATACTTTGAAATTGGGAGG - Intergenic
1196245766 X:113397661-113397683 TATGTAACTTTGAAAATGAGTGG - Intergenic
1197749563 X:129955198-129955220 CATTTATTTTTGAAAGCAGGAGG + Intergenic
1198719414 X:139599574-139599596 CAAGTACCTCTGAAAGTGGGAGG + Intronic