ID: 977316135

View in Genome Browser
Species Human (GRCh38)
Location 4:95450218-95450240
Sequence GATCCCATCTTCAAGGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977316135_977316142 20 Left 977316135 4:95450218-95450240 CCAACCCCCTTGAAGATGGGATC 0: 1
1: 0
2: 0
3: 13
4: 123
Right 977316142 4:95450261-95450283 GAGTGCAGTAGCACAATCATAGG 0: 3
1: 70
2: 285
3: 835
4: 1945
977316135_977316140 -6 Left 977316135 4:95450218-95450240 CCAACCCCCTTGAAGATGGGATC 0: 1
1: 0
2: 0
3: 13
4: 123
Right 977316140 4:95450235-95450257 GGGATCTTGCTCTGTCACCTAGG 0: 9
1: 219
2: 3486
3: 26483
4: 76912

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977316135 Original CRISPR GATCCCATCTTCAAGGGGGT TGG (reversed) Intronic
900997355 1:6129828-6129850 GCACCCATTTTGAAGGGGGTGGG - Intronic
901010313 1:6197670-6197692 GATTCCATCTTCTACAGGGTGGG + Exonic
904171500 1:28594675-28594697 GATCCCACCTTGAAGGGAGGTGG + Exonic
904287556 1:29461978-29462000 AATCCCAGCTTCAAGGAGGAGGG - Intergenic
905304389 1:37007461-37007483 GATCCGATCTTGATGGGTGTTGG + Intronic
908266784 1:62387107-62387129 GTTCCTATCTTCAAGGAAGTTGG + Intergenic
910501402 1:87895485-87895507 TTGCCCATCTTCAAGGGGTTGGG - Intergenic
915585483 1:156841688-156841710 GATCCCATCTTTGAGGGACTCGG + Exonic
915754767 1:158249170-158249192 GACCCCATATTCAACGGTGTAGG + Intergenic
916201079 1:162272235-162272257 TGTCCCAGCTTCAAGGAGGTGGG - Intronic
921264133 1:213408350-213408372 CATCTCATCTTCCAGGGTGTGGG + Intergenic
921929165 1:220740931-220740953 GATCCTTTCTTCATGGGAGTTGG + Intergenic
922230971 1:223685785-223685807 GATCCCCTTTTCAAGGTGGGAGG - Intergenic
923306986 1:232697418-232697440 GGTCCCATCTGCCATGGGGTGGG - Intergenic
923709794 1:236378103-236378125 GATCCCACCTAAAGGGGGGTGGG - Intronic
1069175537 10:65284987-65285009 GAACCCATCTTAAAGCTGGTTGG + Intergenic
1069971780 10:72177025-72177047 GATCCCATACTCTAGGGTGTGGG - Intronic
1070911866 10:80126017-80126039 GATTCCATATTCTACGGGGTGGG - Intergenic
1071044933 10:81361945-81361967 AATCCCAGCTACTAGGGGGTAGG - Intergenic
1073595779 10:104798682-104798704 GATCCCATTTTCAATGTGTTTGG - Intronic
1073597008 10:104811254-104811276 GGTCCCAGCTTCATGGGAGTGGG + Intronic
1075394265 10:122115242-122115264 GCCCCCACCTTCAAGGAGGTAGG + Intronic
1077487809 11:2847106-2847128 GATGCTTTCTGCAAGGGGGTGGG - Intronic
1083636350 11:64122927-64122949 GCTGCCATTTTCAAGGGGGAGGG - Intronic
1084173348 11:67410908-67410930 GATTCCCTCTTCCAGGGGTTAGG - Intronic
1087033877 11:93735790-93735812 AATCCCCTCTTCAAGATGGTTGG + Exonic
1087560945 11:99789862-99789884 GATCCCATCATCCAGGTAGTGGG + Intronic
1089336231 11:117725721-117725743 AACCCCATCTTCCAGGGGTTGGG + Intronic
1093781457 12:23142056-23142078 AATCCTGTCTTCAAGGGGGATGG + Intergenic
1097731187 12:63130476-63130498 TAGCCCAGATTCAAGGGGGTGGG + Intergenic
1100214287 12:92431517-92431539 CACCCCATATTCAAGGGGATAGG + Intergenic
1102888453 12:116539207-116539229 GACCCCATCTGCAAGGCCGTGGG - Intergenic
1104011757 12:124935765-124935787 GATTCCATCTTCTACGGGGTGGG + Intergenic
1108086928 13:46803522-46803544 GATCCCAACTTGAAGCAGGTAGG - Intergenic
1110844200 13:80175317-80175339 CATCCCATACTCAAGAGGGTGGG - Intergenic
1114042514 14:18692107-18692129 GATTCCATCTTCCACAGGGTGGG - Intergenic
1117524261 14:56581238-56581260 CAACCCATATTCAAGGGGGAAGG + Intronic
1118254243 14:64191388-64191410 GATCCCATCTTCCTGGGATTAGG + Intronic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1119720487 14:76886652-76886674 GATTCCATCTTCTACAGGGTGGG + Intergenic
1120304440 14:82750501-82750523 TCTCCCATCTTGAAGGAGGTGGG - Intergenic
1122634973 14:103125556-103125578 GATCCCATTTGGGAGGGGGTGGG + Intronic
1125546928 15:40512691-40512713 GATCCCAGATTCAAGGGAGGTGG - Intergenic
1127077172 15:55338255-55338277 TAGCCCATGTTCAAGGGGGAGGG - Intronic
1134875804 16:17697647-17697669 GATGCCATCCCCTAGGGGGTGGG - Intergenic
1135487739 16:22880641-22880663 GAGCCCATCTCCATGGGGGGAGG - Intronic
1140791151 16:78392348-78392370 AATCCCATCTTGAAGGTGATGGG - Intronic
1142746212 17:1959877-1959899 AATACCATCTTCATAGGGGTGGG + Intronic
1143113952 17:4570402-4570424 GATCACATCTTGAAGAGAGTTGG - Intergenic
1151775403 17:76197948-76197970 CCTCCCATCTTCAAGGGAGAGGG - Intronic
1158585843 18:58733894-58733916 GATCCCAACTCCATGGGTGTTGG - Intronic
1160432812 18:78823576-78823598 GTTCCCATCTTTGAGGGGGAGGG - Intergenic
1162779777 19:13000981-13001003 GATTCCAGCTTCATGGGGGTGGG - Intronic
1164108711 19:22134638-22134660 GATCCAATCCACAAGTGGGTTGG + Intergenic
927959630 2:27233027-27233049 TATCCCATCTGCAAGAGGGAGGG - Exonic
935752343 2:106247445-106247467 GATTCCATCTTCTATGGGGTGGG - Intergenic
935912757 2:107914985-107915007 GATTCCATCTTCTATGGGGTGGG - Intergenic
936120379 2:109737424-109737446 GATTCCATCTTCTATGGGGTGGG + Intergenic
936224315 2:110634022-110634044 GATTCCATCTTCTATGGGGTGGG - Intergenic
939965939 2:148610433-148610455 CATCCCAGGTTCAAGGGGGGTGG + Intergenic
940336961 2:152539325-152539347 GACTCCATCTTCTAGAGGGTGGG + Intronic
941438684 2:165506329-165506351 GAACCCATCTGGAAGGGAGTAGG - Intronic
944892943 2:204136228-204136250 TATCCCCTCCTCATGGGGGTTGG + Intergenic
945121940 2:206466800-206466822 GATGCCAGCTCCAAGGGGGATGG + Intronic
1173469118 20:43308979-43309001 GACCCCAACTGCAAGGAGGTAGG - Intergenic
1174552184 20:51369991-51370013 GATCCCATCTTGATGGTGGGTGG - Intergenic
1176166357 20:63676075-63676097 GACCCCATCTCCAAAGGGGTGGG - Intronic
1177411802 21:20739083-20739105 GATGCCATCCTCTAGGAGGTAGG + Intergenic
1183145432 22:35986612-35986634 GAGGCCTTCTTAAAGGGGGTGGG - Intronic
949555818 3:5151722-5151744 GATCCTATCTCCAAGGGGGGGGG - Intronic
955970169 3:64431098-64431120 GATCCCATCATCCAGGTAGTGGG - Intronic
956438003 3:69253251-69253273 GTTGCCATGTTCAAGGGGATTGG - Intronic
958478483 3:94616056-94616078 TATCCCATTTTCAATGTGGTAGG + Intergenic
961349453 3:126290369-126290391 GACCCCCTCTTCCAGGGGCTGGG - Intergenic
962750678 3:138432933-138432955 GATCCTGTCTCCAAGGGGTTTGG + Intergenic
963261055 3:143191335-143191357 GATACCATGTTCAAGTGGGAGGG - Intergenic
963810573 3:149772681-149772703 GATCCAAGCTTCAGGAGGGTGGG + Intronic
964428572 3:156579588-156579610 GATCTCATGATCAAGTGGGTGGG - Intergenic
968509124 4:987626-987648 GGTCCCATCTTCATGGGGAACGG - Intronic
971117198 4:23662410-23662432 GATGCCATTTTCAATGGAGTGGG + Intergenic
971148408 4:24005044-24005066 GATGAGGTCTTCAAGGGGGTGGG + Intergenic
977316135 4:95450218-95450240 GATCCCATCTTCAAGGGGGTTGG - Intronic
977999237 4:103536697-103536719 CAGCCCATATTCAAGGGGTTTGG + Intergenic
978367130 4:107994184-107994206 GTTTGCATCTTAAAGGGGGTTGG + Intronic
983567995 4:169174996-169175018 GATCAGATTTTCATGGGGGTAGG - Intronic
985848428 5:2371215-2371237 GATTCCACCTTCAAGGGGAGTGG - Intergenic
985872809 5:2570576-2570598 GCTCACATCTTCAGGGGCGTGGG + Intergenic
986332357 5:6726921-6726943 GGTCCCATCTTCCTGTGGGTGGG + Intronic
986977705 5:13411804-13411826 GATCCCAAATTCAATGGGGTTGG + Intergenic
991557710 5:67914262-67914284 GATTCCAGCTGCAAGGGTGTAGG + Intergenic
992929737 5:81630663-81630685 GATCCCTTCTTCCATGGCGTTGG - Intronic
996237644 5:121151997-121152019 GATCCCATCATCCAGGTAGTGGG + Intergenic
996953607 5:129157345-129157367 GATCCCATCTTGAAGCTAGTTGG + Intergenic
997454996 5:134010142-134010164 GTTCCCAGCATCAAGGGGGGTGG - Intergenic
998381978 5:141732131-141732153 GACCCCAGCTTCAAAGGGCTGGG - Intergenic
1000997184 5:167971313-167971335 GATGCCCTCTTCAGGGAGGTCGG + Intronic
1001707385 5:173751308-173751330 GGTCCCTTCTTCAAGGCTGTGGG - Intergenic
1003649967 6:7950531-7950553 GATCCCAGCTACAAGGGGACTGG - Intronic
1003674317 6:8189008-8189030 GATGCCATCTACAAGGAAGTGGG - Intergenic
1003714859 6:8635122-8635144 GATGCCATCTACAAGGAAGTGGG - Intergenic
1004217427 6:13715771-13715793 CATCCCATATTCAAGGGGAGGGG + Intergenic
1004398766 6:15269485-15269507 GGTCCCAGCTACTAGGGGGTGGG - Intronic
1005692558 6:28321494-28321516 TTTCCCATCTTCAAGTGGGAAGG - Intergenic
1007208768 6:40174336-40174358 AATCCCAGGGTCAAGGGGGTGGG - Intergenic
1009884120 6:69604079-69604101 GGCCCCGTCTTCAAGGGGGTTGG + Intergenic
1009915093 6:69985041-69985063 GATCCCAACTACAAGTGGGTAGG - Intronic
1010935649 6:81858110-81858132 ATGCCCATCTTCAAGGGGGTGGG - Intergenic
1013438843 6:110140447-110140469 GAACCCAACTTGAAGTGGGTAGG + Intronic
1015312630 6:131782224-131782246 CAGCTCATCTTCAAGGTGGTGGG - Intergenic
1015882443 6:137882607-137882629 TATCTCATCTCCAAGGAGGTAGG - Exonic
1018156560 6:160991386-160991408 GATCCCACCTTCCAGGAGGACGG - Intergenic
1018284464 6:162222409-162222431 GTTCACATCTTCAAAGCGGTCGG - Intronic
1020020658 7:4865704-4865726 GATTCCATCTTCTACGGGGTGGG + Intronic
1022538006 7:31109965-31109987 GAACCCAGCTTGGAGGGGGTGGG - Exonic
1023319719 7:38981116-38981138 CATCCTACCTTCAAGGGGTTAGG - Intronic
1027263216 7:76479507-76479529 GATCTCATCTTCAGGATGGTGGG + Intronic
1027349666 7:77298075-77298097 GATCCCATCATCCAGGTAGTGGG - Intronic
1033809883 7:145000513-145000535 GATCCCAGCTACCTGGGGGTGGG - Intergenic
1033818906 7:145109634-145109656 GATGCCATTATCAAGGGAGTGGG + Intergenic
1034503723 7:151468684-151468706 GAGCCCACATTCAAGTGGGTGGG - Intronic
1035695217 8:1590931-1590953 GAAGCCATCTTCAATGGTGTTGG + Intronic
1042996323 8:74703546-74703568 AATCCCATCATGAAGGGGGATGG - Intronic
1043386093 8:79749058-79749080 GCTCTCTTCTGCAAGGGGGTGGG - Intergenic
1044575958 8:93769201-93769223 CAGCCCTTCTTCAAGGTGGTGGG - Intronic
1052633607 9:31071822-31071844 GCTCCAATCTTGGAGGGGGTTGG - Intergenic
1055247431 9:74264099-74264121 GCTCCCTTCTTCAAGCAGGTAGG - Intergenic
1056786299 9:89594850-89594872 GATCCCTGCTTCAAGGGTCTGGG - Intergenic
1056841593 9:90002366-90002388 GATCCCAGGATCAAGGGGGCTGG - Intergenic
1057081675 9:92178418-92178440 GGTCTCATCTTCAGGGTGGTGGG + Intergenic
1187398420 X:18938067-18938089 CATCCCATATTCAAGCGGGAGGG - Intronic
1188059151 X:25579054-25579076 GATTGCATCTTGAAGGAGGTAGG + Intergenic
1191859207 X:65652167-65652189 GCCCCCATCTTCCAGGGGGCTGG - Intronic
1193519056 X:82506714-82506736 GATTCCATCTTTTATGGGGTGGG + Intergenic
1193554027 X:82932026-82932048 GATGCCATCTGCAGTGGGGTAGG + Intergenic
1194424559 X:93720534-93720556 GATCCCATCACCAAGGTAGTGGG - Intergenic
1195849901 X:109271615-109271637 ACTCCAGTCTTCAAGGGGGTGGG + Intergenic
1200247982 X:154535929-154535951 GAGCCCTTCTTCAAGGTGGGTGG - Exonic