ID: 977319256

View in Genome Browser
Species Human (GRCh38)
Location 4:95490184-95490206
Sequence ATGCACTTCCAGAAGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 231}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977319256 Original CRISPR ATGCACTTCCAGAAGATGGA AGG Intronic
900956406 1:5888780-5888802 CTGCACTTCCTGAAGACAGAGGG - Intronic
901040027 1:6358239-6358261 CTGCATCTCCAGAAGAGGGAAGG + Intronic
903153368 1:21428575-21428597 CTGCACATCCAGAAGACGGGCGG + Intergenic
903171736 1:21558664-21558686 AGACACTTCCAGAAGAGAGAGGG + Intronic
904622010 1:31781424-31781446 CTGCACGTCCAGAGGAGGGAGGG + Intergenic
905159352 1:36017946-36017968 ATGCCCATCCAGAAGAGTGAAGG + Intronic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
916339745 1:163718682-163718704 ATGGACTCCTAGAGGATGGAGGG + Intergenic
917644369 1:177015649-177015671 ATGAAATTCCAGAAGATTCATGG - Intronic
917983682 1:180293262-180293284 AAACACTTCCAGAAAATAGAAGG - Intronic
918559771 1:185850611-185850633 ATTCAATTCCAGAGGGTGGAGGG - Intronic
918823733 1:189294771-189294793 ATGCATTTCCAGATTATAGAAGG - Intergenic
918830635 1:189392824-189392846 GTGAACTACCAGAAGGTGGAGGG + Intergenic
921001933 1:211052914-211052936 ATGCACATCCTACAGATGGATGG + Intronic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922847428 1:228698653-228698675 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
922850085 1:228725368-228725390 ATTCAGTTCCAGAACACGGATGG + Intergenic
923448181 1:234092059-234092081 TTTCACTTCCAGGAGCTGGAAGG + Intronic
924798079 1:247307399-247307421 ATATACTTTTAGAAGATGGATGG - Intronic
1063912763 10:10848996-10849018 TTGCAATTTCAGAAGAAGGACGG - Intergenic
1065409328 10:25406284-25406306 CTGACTTTCCAGAAGATGGAAGG - Intronic
1066652015 10:37665305-37665327 ATACACTTCAAGAAAAAGGAAGG - Intergenic
1068596118 10:58904901-58904923 ATGCACCTGCAGGAGGTGGATGG - Intergenic
1070488560 10:76954098-76954120 CTGCACTTCCAGAAGTGGGGTGG - Intronic
1071020166 10:81044623-81044645 AGGGACTACCAGAAGGTGGAGGG - Intergenic
1071039976 10:81295914-81295936 ATGGACTGCTAGAAGGTGGAAGG - Intergenic
1071286846 10:84156723-84156745 AAGCAATTCAGGAAGATGGACGG + Intergenic
1071418134 10:85460133-85460155 CTGCACTACCAGATGATGGGAGG + Intergenic
1072513888 10:96157655-96157677 ATGGGCTTCAAGATGATGGATGG + Exonic
1072748290 10:97957668-97957690 ATCCACTTTCAGAAGACTGAAGG - Intronic
1072837105 10:98726948-98726970 ATGCACTGGCAAAAGGTGGAAGG + Intronic
1074314405 10:112348287-112348309 ATGCACCTCCAAAAGGTGTATGG - Intergenic
1076112009 10:127867273-127867295 ACACACTTCCAGATGATGCAGGG + Intergenic
1076120020 10:127928487-127928509 GAGCACTTCCAAAAGAAGGAAGG - Intronic
1078749248 11:14144209-14144231 ATACCCTTTTAGAAGATGGAAGG - Intronic
1080453374 11:32397093-32397115 CTGCACTTCCACAAGATAAAGGG - Intronic
1080534403 11:33207619-33207641 AGACATTTCCAGGAGATGGAGGG - Intergenic
1081647002 11:44797069-44797091 AGGAACATCCAGAATATGGAAGG - Intronic
1082833993 11:57639034-57639056 CTGCACCTCCAGAAGTTGTAGGG + Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1087738977 11:101866304-101866326 TTGCGCTTGCAGAAGTTGGAGGG + Intronic
1088347403 11:108843312-108843334 ATAATCTTCCTGAAGATGGAGGG - Intronic
1089814709 11:121162136-121162158 GTGCACATCCAGAAGATGCAGGG + Exonic
1093232816 12:16568363-16568385 ATCCACATCCAGAGTATGGAGGG - Intronic
1093356236 12:18171840-18171862 ATGCCATTCTAGAAGATTGAAGG - Intronic
1096009456 12:48200811-48200833 GTGCACTTCCATAATATGAATGG - Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098435538 12:70464729-70464751 GTGAACCTTCAGAAGATGGAGGG - Intergenic
1098711973 12:73774195-73774217 ATGCCCATCCAGAAGAGTGAAGG - Intergenic
1100083933 12:90884445-90884467 ATGCACATTCATAAGAGGGAGGG - Intergenic
1100159163 12:91837651-91837673 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1101603051 12:106227107-106227129 ATTCACTTTCAGAAGATGCCGGG - Intergenic
1101740710 12:107497803-107497825 AGTCACTTCCAGGAGAAGGAAGG - Intronic
1102514455 12:113437008-113437030 GTGCACGTCGAGTAGATGGAAGG + Intronic
1103728972 12:123013528-123013550 TTGCCATTCCAGAAGATGCAGGG - Intronic
1111181822 13:84679055-84679077 ATCCAATTGCAGGAGATGGAAGG + Intergenic
1111594602 13:90395612-90395634 ATGCCCTTCTAGAAGACTGATGG - Intergenic
1113499332 13:110760784-110760806 CTGTACTTCCAGAGGATTGAGGG + Intergenic
1113968453 13:114168849-114168871 ATGCCCTTCCAGAAGAGTGAAGG + Intergenic
1115126802 14:30005308-30005330 ATAGACTTCCAGTAGATGGCAGG - Intronic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1118227080 14:63911766-63911788 TTTCACATCCAGAATATGGAGGG + Intronic
1120204690 14:81574939-81574961 ATGCACTTGCAAAAGATTGAGGG + Intergenic
1120673370 14:87389853-87389875 CTGGACTTCCAGAAAAAGGAAGG + Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1121440978 14:93949121-93949143 ATGTCCTTCCAGAACAAGGAAGG - Intronic
1121744547 14:96278036-96278058 ATGCAGAGCCACAAGATGGAAGG + Intergenic
1124656798 15:31515701-31515723 ATGCACAGACAGCAGATGGATGG - Intronic
1124847544 15:33306666-33306688 ATGCATTTTCAGCAAATGGATGG + Intergenic
1128152041 15:65369230-65369252 AGGCACGTCTTGAAGATGGATGG + Intronic
1128672621 15:69585963-69585985 CAGGACTTCCAGAACATGGAGGG - Intergenic
1129260280 15:74362982-74363004 ATGCCCTTTCAGAAGAGTGAAGG - Intronic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1133075800 16:3280329-3280351 ATGCAGTTCCAGAGGATCCATGG - Intronic
1133691490 16:8220038-8220060 AGGAACTTCCAGAAACTGGAAGG - Intergenic
1134284295 16:12846730-12846752 CAGTAATTCCAGAAGATGGAAGG + Intergenic
1135642884 16:24136326-24136348 ATCTACTTGCAGCAGATGGAAGG - Intronic
1135952227 16:26925553-26925575 AGGCTCTACCAGAGGATGGAGGG + Intergenic
1136931969 16:34426792-34426814 ATGCACATCCAGAAGAGTGAAGG + Intergenic
1136972603 16:34985023-34985045 ATGCACATCCAGAAGAGTGAAGG - Intergenic
1140696510 16:77539495-77539517 ATGCACTTTGGGAAAATGGATGG - Intergenic
1141756351 16:85993798-85993820 ATGCACTTTCAGAATGTGGTCGG + Intergenic
1142145848 16:88492664-88492686 GTGGACATCCAGAAGGTGGACGG + Intronic
1146601782 17:34223551-34223573 ATACATTTCCAGAAGAATGATGG - Intergenic
1146792291 17:35758826-35758848 ATGCACATCCTAAGGATGGATGG + Intronic
1148776887 17:50101032-50101054 ATGTGCTTCCAGAAAATGCAGGG + Intronic
1150316369 17:64172479-64172501 ATGCCCAACCAGAAGCTGGAGGG - Intronic
1152315185 17:79576088-79576110 ATGAGCCTCCAGAAGGTGGATGG + Intergenic
1152504629 17:80740371-80740393 AAGCTCTTCCAGAAGATAGAAGG + Intronic
1153188951 18:2516968-2516990 AAGCACTTCCAGAGGAGGAACGG + Intergenic
1153261193 18:3226005-3226027 TTGCACTTCGAGAAGAGAGATGG + Intergenic
1153351362 18:4084024-4084046 AAGTAGCTCCAGAAGATGGATGG + Intronic
1155590329 18:27420230-27420252 ATGCATTTCAAGAAGACTGAAGG - Intergenic
1156295200 18:35783195-35783217 TTGCACTTGCTGAAGATGGCAGG + Intergenic
1156371732 18:36477235-36477257 GTGCAGTTCCTGAAGCTGGATGG + Intronic
1156458539 18:37308242-37308264 AGGCAGTTCCAGAAGATGATGGG - Intronic
1157013303 18:43678854-43678876 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1157376426 18:47171412-47171434 AAACTCTTCCAAAAGATGGAGGG - Intronic
1157623486 18:49029548-49029570 ATGCACTTACGGGAGATGGCTGG + Intergenic
1158882066 18:61789694-61789716 ATGCAGTTCCAGGATCTGGAGGG + Intergenic
1159639174 18:70843329-70843351 ATGAACTTAAAGAAGATGTAGGG - Intergenic
1159657927 18:71055205-71055227 ATTCACTTTCTGAAGGTGGATGG - Intergenic
1160069434 18:75612425-75612447 ATGGACTTCCAGAAAAAAGAAGG + Intergenic
1162321653 19:9974146-9974168 ATGCACTCCCAGAGGAAGGTGGG - Intronic
1162738071 19:12757667-12757689 ATGCAGTTCCAGCGGCTGGACGG + Exonic
1162933440 19:13968654-13968676 AAGCCCATCCAGAAGATGGAAGG - Exonic
1163121372 19:15220189-15220211 AGGCACTAGCAGAAGATGTAGGG + Intergenic
1166066220 19:40360664-40360686 ATGCGCCTCCAGAAGCTGGAGGG + Intronic
1168312530 19:55468105-55468127 CTGCACTTCCAGGTGCTGGAAGG + Intergenic
925063941 2:914782-914804 ACCCACATGCAGAAGATGGAAGG + Intergenic
925064039 2:915212-915234 ACCCACATGCAGAAGATGGAAGG + Intergenic
925064060 2:915298-915320 ACCCACATGCAGAAGATGGAAGG + Intergenic
927277457 2:21273938-21273960 CTGCCCTTCCTGATGATGGAAGG + Intergenic
927383230 2:22502874-22502896 ATGCTGTTCCATAAGATGGGTGG - Intergenic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
928693525 2:33824920-33824942 AGGCTCTTCCATAAGATGGCAGG + Intergenic
932309622 2:70729135-70729157 AGGCACTGCCTGAAGATGGGAGG + Intronic
932501332 2:72185433-72185455 ATGAACTTCCTGAAGCAGGATGG + Intronic
933289551 2:80422784-80422806 ATTCACTTCCAAAAAATAGAAGG - Intronic
936982361 2:118276446-118276468 CTCCACTGCCAGAAGAGGGAAGG + Intergenic
938073014 2:128318268-128318290 CTGCACATCCAGAAGACGGGCGG - Exonic
939674326 2:145053260-145053282 ATTCATGGCCAGAAGATGGAAGG - Intergenic
941474214 2:165928396-165928418 ATGGACTTCCAGAATAAGGGAGG + Intronic
943372763 2:187036275-187036297 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
943518868 2:188922460-188922482 ATGCACTTCCAGCACAATGAAGG + Intergenic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
945175075 2:207035954-207035976 ATTCACTCCCAGACGATTGATGG + Intergenic
945774527 2:214088538-214088560 ATTCACTTCCAAAATATGAAAGG + Intronic
945814366 2:214585902-214585924 TTTCACTTGCAGAAAATGGAAGG + Intergenic
946792918 2:223319669-223319691 AAGCACTTCCTGAAGACAGAGGG + Intergenic
948333656 2:237191429-237191451 TTGCGTTTCCTGAAGATGGAGGG - Intergenic
1170489669 20:16860122-16860144 ATGCACTTCCATGTGATGAATGG + Intergenic
1170871939 20:20214054-20214076 AGTCACTTCCAGAAGATGTAAGG + Intronic
1171152297 20:22837829-22837851 ATGCACTTACAGAAGGTGCATGG + Intergenic
1173554183 20:43953873-43953895 GTTGACTTCCAGAAGATGGGAGG - Intronic
1175677398 20:60958540-60958562 AAGTATTTCCAGGAGATGGAAGG + Intergenic
1178784050 21:35635841-35635863 AGGGATTGCCAGAAGATGGAGGG + Intronic
1182524765 22:30908202-30908224 CTGCACTTCCAGGTGAGGGATGG + Intergenic
1182821510 22:33220802-33220824 AAGCTCTTCCAGGAGATGGTAGG - Intronic
1184826777 22:46957891-46957913 ATCCATTTGCAGATGATGGAGGG + Intronic
1185159291 22:49213206-49213228 ATGGGCTTCCAGAAGCTGGAGGG - Intergenic
952011805 3:28908305-28908327 TTTCACTTCCTGCAGATGGATGG - Intergenic
952594413 3:34998773-34998795 ATTTACATGCAGAAGATGGAAGG - Intergenic
957468231 3:80623002-80623024 ATGCATTCCCACATGATGGAAGG + Intergenic
959574450 3:107919330-107919352 ATGCAATTTCAGAAGGTAGAAGG + Intergenic
960175570 3:114513801-114513823 ATGAAGTGCTAGAAGATGGAAGG - Intronic
960726143 3:120672343-120672365 AAGACCTTCCAGAAGCTGGAAGG + Intronic
963158972 3:142130676-142130698 ATGCAAGTTCTGAAGATGGATGG + Intronic
964162274 3:153659716-153659738 ATGCAATTGCAGGAGAGGGAGGG - Intergenic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
966282676 3:178251270-178251292 ATGGACATCCGGAAGGTGGAGGG + Intergenic
966838111 3:184065350-184065372 TTGGATTTCCAGAAGATGGAAGG - Intergenic
967941969 3:194773092-194773114 ATGCACTGCCAGTAGAGGGGTGG + Intergenic
968912035 4:3481310-3481332 ATTGAGGTCCAGAAGATGGAGGG + Intronic
970220420 4:13804784-13804806 ATGGAGTTCCAGCACATGGAGGG + Intergenic
971492227 4:27225269-27225291 TTGTACTTCCATAAAATGGAAGG + Intergenic
971735588 4:30445593-30445615 ATTCATTTCCAAAATATGGAAGG + Intergenic
975856696 4:78632447-78632469 TGGCACTTCCACAAGATGGATGG - Intergenic
975895897 4:79089816-79089838 ATGCACTTCTAAAAGAAGTAAGG - Intergenic
977319256 4:95490184-95490206 ATGCACTTCCAGAAGATGGAAGG + Intronic
978410354 4:108418343-108418365 CTGGACTTCCAGGAGATGGTGGG - Intergenic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979797470 4:124864119-124864141 GTGAACCTCCAGAGGATGGAGGG + Intergenic
985129750 4:186727172-186727194 ATTCACATCCAGAAGTTGGAGGG - Intergenic
985296515 4:188442729-188442751 ATTCACTTCCAGATAATGGGTGG - Intergenic
985296524 4:188442792-188442814 ATTCACTTCCAGATAATGGGGGG - Intergenic
985527233 5:412420-412442 AAGCAGCTCCAGAAAATGGAAGG + Intronic
990082002 5:51928480-51928502 ATGCCCTTCTAGAAGATCGAAGG - Intergenic
990162297 5:52955573-52955595 ATGAACTTGCAGGAGAAGGAAGG + Exonic
990722653 5:58714469-58714491 ATGCACTTCAAAAACATGAAAGG + Intronic
992153021 5:73925172-73925194 AGGGACTTCCAGCACATGGAGGG - Intronic
993248789 5:85487644-85487666 ATGCCCTTCCAGAAGAGTGAAGG - Intergenic
993969889 5:94406300-94406322 GAGCAGTTACAGAAGATGGAGGG - Intronic
994567314 5:101466629-101466651 AGCCACATGCAGAAGATGGAAGG + Intergenic
996443765 5:123520320-123520342 ATATTCTTCCAGAAGATGGATGG - Intronic
997385651 5:133470029-133470051 ATGCCCTTCCAGAGTATGGAAGG - Intronic
997931622 5:138077272-138077294 ATTCACTGCCAGCAGATGGCAGG + Intergenic
998959197 5:147466735-147466757 AGTCCCTTCCTGAAGATGGAGGG - Intronic
999084241 5:148873014-148873036 ATGGTCTTCAAGAACATGGAGGG + Intergenic
999833778 5:155347189-155347211 AAGCCCATGCAGAAGATGGAGGG - Intergenic
999979292 5:156942461-156942483 ATGAACTTCCAGGGGATGTAGGG - Intronic
1000044794 5:157513323-157513345 ATTCCCTTTCAGAAGATGGCTGG + Intronic
1000573575 5:162946744-162946766 AGGCAATTTCAGAAGATTGAGGG + Intergenic
1000600278 5:163265613-163265635 ATGCATTTCCAGAAGGAGCAGGG + Intergenic
1001663100 5:173411238-173411260 ATGCAGTTCCAGCAAAAGGAAGG - Intergenic
1003625741 6:7739759-7739781 AAACACTTTCAGCAGATGGATGG - Intronic
1003969752 6:11287827-11287849 TTCAACTTCCAGAAGCTGGAAGG - Intronic
1004636030 6:17468695-17468717 ATCCTCTTCCAGTTGATGGAAGG + Intronic
1004942730 6:20577945-20577967 ATGGATGTCAAGAAGATGGATGG + Intronic
1005247099 6:23899332-23899354 AGGCTCTTCCAGAAAATAGAAGG - Intergenic
1005347396 6:24904074-24904096 ATGCACTTGCACAAGATTGAAGG + Intronic
1006290670 6:33133669-33133691 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1006506575 6:34492802-34492824 ATGGACTTCTAGAGGAGGGAAGG + Intronic
1007074990 6:39060646-39060668 AGGCATTGGCAGAAGATGGAAGG - Intronic
1007224124 6:40301051-40301073 ATACACTTCCAGCAGAAAGAAGG + Intergenic
1009183929 6:60551527-60551549 ATGCACTTCCAGAAGTGCCATGG - Intergenic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1017320157 6:153082315-153082337 TTGAACTTCCAGAATTTGGAAGG - Intronic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1021761492 7:23906382-23906404 ATTCACGTCCGGAAGAGGGAAGG + Intergenic
1021890586 7:25182251-25182273 ATGAACTACCAGAAATTGGAGGG - Intergenic
1022622168 7:31995882-31995904 CTGAACTTCAAGTAGATGGAGGG - Intronic
1026572605 7:71544550-71544572 CTGCACTTGCAGAGGATGAAAGG - Intronic
1026791693 7:73336855-73336877 AAGTACTTCCACAAAATGGATGG + Intronic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1027730254 7:81862143-81862165 AAGCACTGCCAGGAGATTGAAGG + Intergenic
1027933765 7:84575637-84575659 AGGCAATTACAGAAGGTGGAAGG + Intergenic
1028406614 7:90482102-90482124 CTGCCCTCCCAGAAGTTGGAAGG + Intronic
1030375162 7:108745657-108745679 ATGCACCTGCAGAAGGTGGTTGG + Intergenic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1034076019 7:148231864-148231886 ATGCAGTTCCAGAAAAAGGAAGG + Intronic
1035761983 8:2075252-2075274 AGGCACATGCAGAAGACGGAAGG - Intronic
1036761996 8:11515595-11515617 ATGCAGTTAAAGAAAATGGAAGG - Intronic
1038945573 8:32355883-32355905 ATGGTCTTCCAGATGAAGGAGGG + Intronic
1039571209 8:38587860-38587882 CTGCACCTGCAGAAGATGAAGGG - Intergenic
1039848086 8:41340328-41340350 GTTCACATCCAGAAGCTGGAAGG - Intergenic
1039892267 8:41693748-41693770 GTGCTCTTCCAAGAGATGGAAGG - Intronic
1039896722 8:41721716-41721738 TCACACTTCCAGAAGCTGGAGGG - Intronic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1040501802 8:48011608-48011630 ATTCTCTTCCAGTAGAAGGAAGG - Intronic
1041195541 8:55398116-55398138 GCGCACTTTCAGAGGATGGAAGG + Intronic
1042018573 8:64344745-64344767 ATACACTTCCAGAAAATGGAGGG + Intergenic
1042979694 8:74511839-74511861 CTGCAGTCCTAGAAGATGGATGG + Intergenic
1043779367 8:84312584-84312606 ATGCACATCCAAAACATGGTGGG + Intronic
1044127243 8:88473930-88473952 AGGCACTTCAAGTAGACGGAGGG + Intergenic
1044153169 8:88808067-88808089 ATGTATTTCCAGAGGATGTAGGG + Intergenic
1049717336 8:144099166-144099188 CAGCACCCCCAGAAGATGGACGG - Exonic
1050211517 9:3263829-3263851 AGGCACTGGCAGGAGATGGAAGG + Intronic
1050232728 9:3544949-3544971 ATGCACTTCAAGGTGAAGGAAGG + Intergenic
1050398203 9:5222591-5222613 ATGCACCTGCAGGAGATGGCTGG - Intergenic
1050674816 9:8040001-8040023 AAGTACTTCCAGAAGATTGATGG + Intergenic
1052456622 9:28707414-28707436 ATGCATTTCAGGAGGATGGATGG - Intergenic
1053145476 9:35709060-35709082 ATGCATTTTCAGAAGGTGGGGGG + Intronic
1053416211 9:37948422-37948444 CTGCCCTTCCAGAAGATGAGGGG - Intronic
1055763657 9:79637763-79637785 ATGAAATTCCAGAAGATCCAAGG - Intronic
1056565342 9:87767165-87767187 ATGCCCTCCCAGAAGCTGGTGGG - Intergenic
1058227558 9:102383941-102383963 AATCACCTCCCGAAGATGGAGGG + Intergenic
1058312744 9:103525751-103525773 ATGCTCTTTCAGAAGAGTGATGG - Intergenic
1059251253 9:112889853-112889875 TTGCTTTTCCAGGAGATGGAGGG + Exonic
1059768447 9:117405570-117405592 CTGCCCTTCCCTAAGATGGAAGG + Intronic
1061926607 9:133808960-133808982 ATGCACTCCCAGGAGATAGGTGG + Intronic
1185886644 X:3789270-3789292 CTGCATTTCCAGATGATTGAGGG - Intergenic
1186833702 X:13416833-13416855 TTCCACTTCCGCAAGATGGAGGG - Intergenic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1187516200 X:19973570-19973592 ATGCTCGTCCAGCACATGGATGG + Intergenic
1188147453 X:26630798-26630820 AGGCACTGACAGTAGATGGATGG - Intergenic
1188698074 X:33222010-33222032 ATTCTTTTCCAGAACATGGAAGG + Intronic
1189809518 X:44768337-44768359 ATGGACTCCTAGAGGATGGAGGG + Intergenic
1193429817 X:81388016-81388038 AATCTCTTCCAGAAGATAGAAGG - Intergenic
1193459161 X:81769600-81769622 ATGGACTACCAGAAGAGGAAGGG + Intergenic
1193598388 X:83477218-83477240 AGCCATTTGCAGAAGATGGAAGG + Intergenic
1194616609 X:96111357-96111379 AGGAACTACCAGAAGCTGGAGGG - Intergenic
1195707936 X:107751617-107751639 AGGCACTTACGGAAGATGTAGGG - Intronic
1197728407 X:129791579-129791601 ATGGACTTCTAGAAGATGCCAGG - Intronic
1198507250 X:137312930-137312952 AAGCACTGGCAGAAGATTGAAGG - Intergenic
1199547347 X:149019862-149019884 TGGCACTTCCACAAGATGGAAGG + Intergenic