ID: 977323073

View in Genome Browser
Species Human (GRCh38)
Location 4:95544455-95544477
Sequence TAGTAAACATAGGTGAAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 156}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977323073 Original CRISPR TAGTAAACATAGGTGAAGCT AGG (reversed) Intronic
907680655 1:56560362-56560384 TACCAAACATAGCTGATGCTGGG + Intronic
907908201 1:58804226-58804248 TAGTTAAGATATATGAAGCTAGG + Intergenic
908278301 1:62500092-62500114 TACTCAACATAGGATAAGCTGGG - Intronic
915044313 1:152999348-152999370 AAATAAACAGGGGTGAAGCTAGG + Intergenic
916019558 1:160780036-160780058 CAGTAACCATGGGAGAAGCTGGG - Intergenic
918271399 1:182904702-182904724 TGTTAAAAATATGTGAAGCTGGG - Intronic
918792995 1:188855326-188855348 TAGCTAACATTGGGGAAGCTAGG + Intergenic
919127408 1:193412158-193412180 TAGCAAATATAGATGAAGATGGG - Intergenic
924471619 1:244347853-244347875 TATTAAAAATTGGTGAAACTAGG + Intergenic
924657815 1:245989377-245989399 GCCTAAACATAGGTGAAGATAGG - Intronic
1067655001 10:48185078-48185100 TAGTAAGCACAGCTAAAGCTAGG + Intronic
1067823071 10:49547977-49547999 TTTTAAATATAGGTAAAGCTTGG + Intergenic
1069281915 10:66665153-66665175 TAGTAGAAATTGGGGAAGCTGGG - Intronic
1070049207 10:72870575-72870597 AAGAAAATATAGGTAAAGCTGGG - Intronic
1072776669 10:98203322-98203344 TATTAACCATAGGTGAATATGGG + Intronic
1076330976 10:129666120-129666142 TGGTAAAAACAGGTGAATCTAGG + Intronic
1078316645 11:10298885-10298907 TTGAAACCATCGGTGAAGCTGGG - Intergenic
1082202690 11:49391945-49391967 TAGTAAACCTAGGTGATACTGGG + Intergenic
1082910572 11:58369229-58369251 TAAAAAACTGAGGTGAAGCTGGG - Intergenic
1083976745 11:66128489-66128511 CATTAAACATCGTTGAAGCTGGG + Intronic
1086652345 11:89308130-89308152 TAGTAAACCTAGGTGATACTGGG - Intergenic
1086753983 11:90535053-90535075 TAGCAATCATAGGGGAAACTAGG - Intergenic
1090617600 11:128529853-128529875 GAGTTAGCATTGGTGAAGCTAGG - Intronic
1091580290 12:1783147-1783169 TATTAAAAATAGGTGATGCCAGG + Intronic
1091901566 12:4148421-4148443 TAGTTAAGGTGGGTGAAGCTGGG + Intergenic
1093316253 12:17654834-17654856 CATTAAACATAGATGAAGCCAGG + Intergenic
1093327221 12:17791922-17791944 TATTATACATAGGAGATGCTGGG + Intergenic
1094460645 12:30694412-30694434 TAGGAAACCTAGGTGGAGTTTGG - Intronic
1096597581 12:52706532-52706554 AAGGAAAGAGAGGTGAAGCTAGG + Intergenic
1099371167 12:81833006-81833028 TATTAAAGATAGATGAATCTGGG - Intergenic
1101851870 12:108409762-108409784 TAGTAAACAAAGGGGAGGGTGGG + Intergenic
1103372107 12:120427370-120427392 TAAAAAACATGGGTGAAGCCAGG - Intergenic
1106083532 13:26520344-26520366 TATTAACAATAGGTGAAACTGGG - Intergenic
1107157575 13:37187232-37187254 TATTAGACACATGTGAAGCTTGG - Intergenic
1109631347 13:65051844-65051866 TAGCAAACATAAGTGAACATAGG + Intergenic
1109915314 13:68977412-68977434 TAGTGAACAGAGGTAGAGCTAGG + Intergenic
1110032005 13:70627675-70627697 TAGTAAAAATAAGTGAAGACTGG - Intergenic
1110454497 13:75675422-75675444 TTGTAAACAAAGTTTAAGCTAGG + Intronic
1110976463 13:81842015-81842037 AAGTAAATATAGCTGTAGCTGGG + Intergenic
1111970297 13:94907189-94907211 TGTTAATCATAGGGGAAGCTGGG - Intergenic
1113239583 13:108321843-108321865 TATTAAAAATAGGAGAAACTGGG - Intergenic
1114530875 14:23395250-23395272 TAGTAAACAAAGGCAAATCTTGG - Intronic
1116630186 14:47320739-47320761 TAGTAAACTTAAGTGAAGGATGG + Intronic
1118119605 14:62824423-62824445 TAGTAAACAAAGTTTTAGCTGGG + Intronic
1118196506 14:63631703-63631725 AAGTTAACATTAGTGAAGCTTGG + Intronic
1119608969 14:76045688-76045710 TGGAAAACAGAGGTGAGGCTTGG - Intronic
1121247054 14:92469216-92469238 TAGTAAACATAGGCCAGGCGCGG + Intronic
1121727030 14:96159910-96159932 TAGTAGACACAGGTGACCCTAGG - Intergenic
1122222008 14:100245428-100245450 TTCAAAACATAGTTGAAGCTGGG - Intronic
1122732950 14:103815124-103815146 TGCTAAACATGGATGAAGCTTGG + Intronic
1128589563 15:68882848-68882870 TCGTCAAAATGGGTGAAGCTGGG - Intronic
1131210738 15:90493614-90493636 TATTAAAAATGGGTGAATCTAGG - Intronic
1131344642 15:91634737-91634759 TATTAACAATAGGTGAATCTGGG - Intergenic
1133326379 16:4944765-4944787 TACAAAACAGGGGTGAAGCTGGG - Intronic
1133591554 16:7249174-7249196 TAGTCAACTTAGCTGAAGGTTGG - Intronic
1135073351 16:19371611-19371633 TAGAAAACTAAGGTGAAGCCGGG + Intergenic
1135588087 16:23686387-23686409 TAGTAAAAATAGATGAAACATGG - Intronic
1136143581 16:28302350-28302372 GAGTAAACAAAGGTGAAGGTCGG + Intronic
1144597324 17:16581826-16581848 TATTAAAAATATGTGAATCTAGG + Intergenic
1146236343 17:31167834-31167856 TATTCAACATAGGAGAAGCTGGG + Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1149880332 17:60283845-60283867 TAGGAAGGATAGGTGAAGCATGG + Intronic
1151223338 17:72630306-72630328 TAGTAGATATAGTTGCAGCTTGG + Intergenic
1154289352 18:13093536-13093558 TAGTAATTTTAGGTGAAGCCTGG + Intronic
1156495667 18:37523838-37523860 CAGTCAACAGAGGTGAAGGTGGG + Intronic
1161729237 19:5948795-5948817 TAATAAACATATCTGAAGCTCGG + Intronic
1164501958 19:28827686-28827708 GAATAAATATAGGTGAAGGTGGG - Intergenic
1165294839 19:34918283-34918305 TAATTAACATAGGAGGAGCTGGG - Intergenic
925107513 2:1305504-1305526 TTGTAAACATAGAGGAAGCCTGG + Intronic
925663518 2:6227624-6227646 TAATAAAGATAGATGAAGTTTGG - Intergenic
926404443 2:12536662-12536684 TAGTAAAATTAAATGAAGCTGGG + Intergenic
926614699 2:14984265-14984287 TAGTGAACAGAGCTGAATCTAGG - Intergenic
929221212 2:39466839-39466861 TAGAAAACAGAGTTGAGGCTGGG + Intergenic
929378512 2:41320669-41320691 AATTAAACATAGCTGAAGCTTGG + Intergenic
929623546 2:43382298-43382320 TAGTAACAATAGGAGAAACTAGG + Intronic
929745975 2:44659124-44659146 TAGAAAAAGTAGGTGAGGCTAGG + Intronic
931287543 2:60845361-60845383 TTTTAAAGATAGGAGAAGCTGGG - Intergenic
932175963 2:69602510-69602532 TATTAACCATCGGTGAATCTGGG + Intronic
932651909 2:73567010-73567032 TGGTGAACACAGGAGAAGCTGGG - Intronic
935784898 2:106539941-106539963 TAGTAAACATAAGTGAATTTTGG + Intergenic
937344170 2:121113246-121113268 TAGTAAACAGAGGCCAGGCTTGG - Intergenic
940595979 2:155793694-155793716 TATTAAATACAGGTTAAGCTTGG - Intergenic
943055114 2:182967844-182967866 TAGTAAAAATTGGTGTAGTTTGG + Intronic
943958297 2:194222612-194222634 TATTAAACATAAGTATAGCTAGG - Intergenic
946631505 2:221674204-221674226 TAGAAACCATAGATGAGGCTAGG + Intergenic
948147698 2:235720416-235720438 AAGTAACCACAGGTGAGGCTGGG - Intronic
1174326391 20:49782202-49782224 TAGTAAAGACAGGTGATTCTGGG - Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1174984587 20:55436474-55436496 TAGTAAACATAGCCTATGCTGGG + Intergenic
1175165792 20:57043536-57043558 AAGGTAACATAGGTGAAGATGGG - Intergenic
1177340098 21:19787290-19787312 TAGCAAACATAGGATAAACTGGG + Intergenic
1177462060 21:21425452-21425474 TACTAAAGATAAGTGAATCTGGG + Intronic
1177674647 21:24281025-24281047 TTGTAAACATAGGTGGAGTTAGG + Intergenic
1180912575 22:19462293-19462315 TAAAAAAGATAGCTGAAGCTGGG - Intronic
1182530319 22:30950619-30950641 TAGAAAACATTGGAGAACCTTGG - Intronic
950145260 3:10645159-10645181 TGTCAACCATAGGTGAAGCTGGG + Intronic
951090903 3:18573047-18573069 TAGAAAACAGAGGTAAAGCCAGG - Intergenic
954259385 3:49427829-49427851 TAGTAGACTAAGGTGAAGCCAGG - Intronic
956078874 3:65536244-65536266 TATTATACAAAGGTGAATCTAGG - Intronic
957801625 3:85091341-85091363 TAGCAAACATAGCTGTAGTTTGG + Intronic
958764071 3:98343655-98343677 TAGAAAACAGAGGAGAAGTTAGG + Intergenic
959169003 3:102822198-102822220 GAGCAAACATAGTTGAGGCTAGG - Intergenic
960520247 3:118646487-118646509 TAGTAAACAGTGGAGATGCTAGG - Intergenic
962742446 3:138371771-138371793 TGTTAAACACAGGTGCAGCTAGG - Intronic
963907523 3:150785087-150785109 TACTAATAATAGGAGAAGCTAGG - Intergenic
965153773 3:165017894-165017916 TAGTATACATAGATGAAAATGGG - Intronic
968259513 3:197308471-197308493 TGGTAAAAATTAGTGAAGCTGGG - Intergenic
969858318 4:10017634-10017656 TACAAAACATAGGGGAAGCCTGG - Intronic
971455436 4:26839848-26839870 CAGTCTACACAGGTGAAGCTGGG + Intergenic
971514020 4:27464281-27464303 GAGCAAACAGAGGGGAAGCTTGG + Intergenic
973831651 4:54765814-54765836 TATTAAAAACAGGTGAATCTGGG - Intergenic
973836481 4:54814970-54814992 TAGTCAGCATAGGTTAAGTTAGG - Intergenic
976008866 4:80462696-80462718 TGGTAAACAGATCTGAAGCTGGG - Intronic
977323073 4:95544455-95544477 TAGTAAACATAGGTGAAGCTAGG - Intronic
978021326 4:103816938-103816960 TGGTAAATATAGTTTAAGCTTGG - Intergenic
980742554 4:136971892-136971914 TATTAATTATAGGTGAACCTAGG - Intergenic
983339636 4:166443207-166443229 TATAAAACATCGATGAAGCTGGG + Intergenic
984225974 4:177035301-177035323 AAGTAAACATGGGTGAAGTGTGG + Intergenic
985873220 5:2575456-2575478 TTGTAAGCTCAGGTGAAGCTGGG - Intergenic
993555106 5:89326953-89326975 TATTAAACATAGTTGTAACTTGG + Intergenic
995206892 5:109490060-109490082 TTGAAGACAAAGGTGAAGCTGGG + Intergenic
998975299 5:147638784-147638806 TAGGAAACCTAGGTAAACCTAGG + Intronic
1000160058 5:158588644-158588666 TATTAAACATAGGTGATTATTGG - Intergenic
1001074281 5:168613971-168613993 TAGAAACAATAGGTGAATCTGGG + Intergenic
1001097300 5:168785753-168785775 TAGGAAACGGAGGTGAAGCGTGG + Intronic
1001380760 5:171304967-171304989 TAGTAGACAGGGGTGGAGCTGGG - Intergenic
1001500290 5:172226891-172226913 TAGTAAACATAAGTGAAAAGTGG + Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1007598171 6:43064746-43064768 TAGGACACATTGGTGAAGCTGGG + Intronic
1010485996 6:76415412-76415434 AATGAAACATAGGTAAAGCTGGG - Intergenic
1011069480 6:83364846-83364868 TATTAAACATAATGGAAGCTAGG - Intronic
1012988465 6:105899809-105899831 AAGTAAACAGTGGTGAGGCTAGG - Intergenic
1014841590 6:126225979-126226001 TAGTAAACATAGGCCAGGCGCGG - Intergenic
1019003252 6:168773497-168773519 TAGTCAAGAGAGCTGAAGCTGGG - Intergenic
1022354574 7:29600784-29600806 TAGTAAACATGACTGAAGATTGG - Intergenic
1024963095 7:54997904-54997926 TGGTAAACTGTGGTGAAGCTGGG + Intergenic
1027245680 7:76365706-76365728 TAAAAAACAGGGGTGAAGCTGGG - Intergenic
1032205927 7:129865380-129865402 ATGGAAAAATAGGTGAAGCTTGG - Intronic
1036749707 8:11436055-11436077 CAGTAAAGGTGGGTGAAGCTTGG - Intronic
1037153086 8:15662947-15662969 TATTCAACATAAGTGAAGCCTGG + Intronic
1038184754 8:25263511-25263533 TATTAAAAATATGGGAAGCTAGG - Intronic
1038354128 8:26811067-26811089 TAGCAAACATAGATGAACCTTGG + Intronic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1039456257 8:37709236-37709258 TAGGAAACACAGGTGCATCTGGG + Intergenic
1040623876 8:49122419-49122441 TAGTAAATATAAGTTAACCTAGG + Intergenic
1042083050 8:65077008-65077030 TAGTAACCATGGCTGAAGTTGGG + Intergenic
1042253696 8:66781796-66781818 TAGTAAACCTAGGAAAAACTGGG + Intronic
1042913512 8:73851144-73851166 TAAAAATCATAGGTGACGCTGGG - Intronic
1047267515 8:123320883-123320905 TAGTAATAATAGTTGAAGTTTGG - Exonic
1049538624 8:143194822-143194844 TAGTCAACATTTGCGAAGCTTGG - Intergenic
1051454806 9:17242945-17242967 TAGAAATCAGCGGTGAAGCTGGG + Intronic
1056977696 9:91274807-91274829 CAGGAACCTTAGGTGAAGCTTGG - Intronic
1058409274 9:104712961-104712983 TAGTAAACATGGGAGAAGAAGGG + Intergenic
1059284672 9:113162170-113162192 TATTAAGCACAGGTGAGGCTGGG - Intronic
1060284023 9:122233049-122233071 AAGTAAATAAATGTGAAGCTGGG - Intergenic
1060766702 9:126299443-126299465 TAGTAAATATAGCTGGAGCTTGG + Intergenic
1062693764 9:137860454-137860476 TAGTAAACATATATGAAACCAGG - Intronic
1190102686 X:47534430-47534452 TAGAAAATATAGTTGAGGCTGGG + Intergenic
1192730477 X:73798195-73798217 TATTAAACATATGTAAAGATAGG - Intergenic
1193148012 X:78097414-78097436 TAATAAACCTAGGTGAGGCCGGG + Intronic
1193342405 X:80365028-80365050 TGTTCTACATAGGTGAAGCTAGG - Intronic
1193826637 X:86234525-86234547 TGGTAACAATAGGGGAAGCTAGG - Intronic
1195450339 X:105004726-105004748 TATTAAAAATAGGTGAAAATAGG - Intronic
1195785109 X:108511086-108511108 TATTAAAAATTGGTGAATCTGGG - Intronic
1195877453 X:109557019-109557041 TAGTAACTGAAGGTGAAGCTTGG + Intergenic
1199014576 X:142799291-142799313 TAGGAAAAATAGGTGAAGAAAGG - Intergenic
1201902709 Y:19059651-19059673 TAGTAAAAATAAGAGAATCTGGG + Intergenic