ID: 977323684

View in Genome Browser
Species Human (GRCh38)
Location 4:95549215-95549237
Sequence TCCGGGTCCCCTCGCCTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 103}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977323681_977323684 -5 Left 977323681 4:95549197-95549219 CCGAAGTCTGGACTGCTCTCCGG 0: 1
1: 0
2: 0
3: 2
4: 81
Right 977323684 4:95549215-95549237 TCCGGGTCCCCTCGCCTGTGAGG 0: 1
1: 0
2: 2
3: 10
4: 103
977323680_977323684 2 Left 977323680 4:95549190-95549212 CCGCACGCCGAAGTCTGGACTGC 0: 1
1: 0
2: 0
3: 1
4: 54
Right 977323684 4:95549215-95549237 TCCGGGTCCCCTCGCCTGTGAGG 0: 1
1: 0
2: 2
3: 10
4: 103
977323679_977323684 5 Left 977323679 4:95549187-95549209 CCGCCGCACGCCGAAGTCTGGAC 0: 1
1: 0
2: 0
3: 2
4: 26
Right 977323684 4:95549215-95549237 TCCGGGTCCCCTCGCCTGTGAGG 0: 1
1: 0
2: 2
3: 10
4: 103
977323676_977323684 29 Left 977323676 4:95549163-95549185 CCAGCAGCAGGAGCAGCCGCAGC 0: 1
1: 3
2: 130
3: 360
4: 1124
Right 977323684 4:95549215-95549237 TCCGGGTCCCCTCGCCTGTGAGG 0: 1
1: 0
2: 2
3: 10
4: 103
977323677_977323684 13 Left 977323677 4:95549179-95549201 CCGCAGCTCCGCCGCACGCCGAA 0: 1
1: 0
2: 0
3: 3
4: 67
Right 977323684 4:95549215-95549237 TCCGGGTCCCCTCGCCTGTGAGG 0: 1
1: 0
2: 2
3: 10
4: 103
977323675_977323684 30 Left 977323675 4:95549162-95549184 CCCAGCAGCAGGAGCAGCCGCAG 0: 1
1: 0
2: 48
3: 157
4: 687
Right 977323684 4:95549215-95549237 TCCGGGTCCCCTCGCCTGTGAGG 0: 1
1: 0
2: 2
3: 10
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977323684 Original CRISPR TCCGGGTCCCCTCGCCTGTG AGG Intergenic
900540302 1:3199389-3199411 TCCGGAGCCCCTTGCCAGTGGGG + Intronic
901017133 1:6238275-6238297 TCCCGGACCCCTCACCTCTGCGG + Intergenic
902187505 1:14736213-14736235 TCCTGGGCCCCTGGCCTGTTGGG + Intronic
906035208 1:42746568-42746590 GCAGGGTCCCCTCGGCTGAGTGG + Exonic
907385265 1:54121773-54121795 TCCGGGTCCCCCTGCCTCTCTGG - Intergenic
908053195 1:60255389-60255411 TCCTGGTCCCCATGCCTGTGTGG + Intergenic
915275266 1:154784080-154784102 ACCGGGTCCCCTCCTGTGTGGGG + Intronic
915343174 1:155187191-155187213 TCTGCTTCCCCTGGCCTGTGGGG + Intronic
918127283 1:181595704-181595726 CCTGGATACCCTCGCCTGTGGGG - Intronic
1068213439 10:53952391-53952413 TCTGGGTCTCCTCGCCACTGAGG - Intronic
1068443918 10:57095722-57095744 TCCAGGTCTCCTCTCCTCTGAGG + Intergenic
1069571730 10:69498345-69498367 CCCTGGACCCCTGGCCTGTGGGG + Exonic
1070301989 10:75210570-75210592 TCCCCGCCCCCTCGCCTCTGAGG + Intronic
1072219452 10:93315451-93315473 TCCGGGTGCTTTCGCCTGGGTGG + Intronic
1074618490 10:115093484-115093506 TCCGGGACGCCGCGGCTGTGGGG + Intronic
1076571808 10:131438153-131438175 TCCGAGTTCCCTGCCCTGTGGGG + Intergenic
1077222845 11:1425048-1425070 TCCGAGTCCCCACGCCTGGCAGG - Intronic
1083550827 11:63588939-63588961 GCCTGGTCCCCTGGCCTCTGTGG - Intronic
1084272909 11:68038632-68038654 TCCGGGACCCCTCCCTTGGGCGG - Intergenic
1084409387 11:68997576-68997598 TCCGTGTCACCTGCCCTGTGAGG + Intergenic
1084902183 11:72317923-72317945 CCCGGGTCTCCTCTTCTGTGCGG - Intronic
1090754661 11:129779306-129779328 TCCGGGACCCCTCTCCTCTGTGG - Intergenic
1091442442 12:521899-521921 TCCTAGTCCACTAGCCTGTGTGG - Intronic
1091558742 12:1594614-1594636 TCCTGGTCCCCCCGCCTGGGCGG - Intronic
1091782146 12:3220663-3220685 TCCTGCTGCCCTGGCCTGTGGGG + Intronic
1091801310 12:3326406-3326428 TCCAGGTTCCCTCCCCTGGGAGG + Intergenic
1093643551 12:21555852-21555874 TCTGGGTCCCCTTGCTGGTGGGG - Intronic
1094850584 12:34380619-34380641 CCCTGGGCCCCTCGCATGTGCGG + Intergenic
1094871797 12:34602941-34602963 CCCAGGTCCCCACGCATGTGTGG - Intergenic
1094872461 12:34605941-34605963 TCCTGGGCCCCACGCATGTGCGG - Intergenic
1095052613 12:37567686-37567708 TTCGGGTCCCCTCTCCGCTGGGG + Intergenic
1101777147 12:107805826-107805848 TCTGGGTCCCCTCTGCAGTGGGG - Intergenic
1103261478 12:119593087-119593109 TCCAGGTGCCCTCCCCAGTGTGG - Intergenic
1103317900 12:120071820-120071842 CCCAGGTAGCCTCGCCTGTGGGG - Intronic
1106117647 13:26831002-26831024 TCCAGGGCCCCTGGCCTGAGGGG - Intergenic
1106241583 13:27917749-27917771 CCCGGGTACCCGCGGCTGTGGGG - Intergenic
1112760434 13:102688770-102688792 TCCTGGTGCCCTGCCCTGTGAGG + Intronic
1113578632 13:111412452-111412474 TCCGGGTTACCTTTCCTGTGAGG + Intergenic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1118606995 14:67511789-67511811 TTCGGCTCTCCTCCCCTGTGAGG - Intronic
1119004127 14:70908312-70908334 GCCGGGGCCCCCCGCCCGTGGGG + Intronic
1119257141 14:73208483-73208505 TCCGGGTCTCCTCTCCACTGAGG - Intronic
1119257155 14:73208553-73208575 TCCGGGTCTCCTCTCCACTGAGG - Intronic
1119668385 14:76500288-76500310 TCCGGCTCCCCTTGCCTGTGGGG + Intronic
1126699928 15:51358481-51358503 TCCCGGTCCCCTTTTCTGTGTGG + Intronic
1129163149 15:73758848-73758870 TCCGGGTCCCCTGTCCTGTGTGG + Intergenic
1132547158 16:538603-538625 TCTGGATCCCCTCTCCTTTGAGG - Intronic
1132633683 16:932217-932239 TCCCCGTGCCCCCGCCTGTGAGG - Intronic
1136909873 16:34136279-34136301 TCCTGGTCCCCTGGTCTGTTCGG + Intergenic
1137678247 16:50315184-50315206 TCCAAGTCCCCTCACCTCTGGGG - Intronic
1138201350 16:55091182-55091204 TGCGGCTCCCCTGGCCTCTGAGG + Intergenic
1141611761 16:85185682-85185704 TCTGGCTCCCCTGGTCTGTGTGG + Intergenic
1141895911 16:86958738-86958760 TCCGACTCACCTCCCCTGTGGGG + Intergenic
1141903338 16:87006938-87006960 CACGGGACCCCTCTCCTGTGTGG + Intergenic
1144339020 17:14297640-14297662 TCCCGCTCCCCTCGCCAGCGAGG - Intergenic
1146183247 17:30710003-30710025 TCCCGGGCCCCTCGCCAGTGGGG - Intergenic
1146301591 17:31693796-31693818 CCTGGGTCCCCTCACCAGTGGGG - Intergenic
1146793710 17:35766854-35766876 TCCGGGGCCCCAAGCCAGTGTGG - Exonic
1147636351 17:41966817-41966839 TCCGGGGCCGCCCGCCTGCGCGG - Exonic
1152079775 17:78179529-78179551 GACGGGTCCCTTCCCCTGTGCGG - Intronic
1152760635 17:82105510-82105532 CCAGGGTCCCCACGCCTGGGAGG + Intronic
1160474159 18:79167546-79167568 TCCGGGTCCCCTCTACTCTGAGG - Intronic
1160798196 19:955262-955284 CCCGGTTCCGCTCCCCTGTGGGG - Intronic
1161237130 19:3203837-3203859 CCCGGGGCCGCTCACCTGTGTGG - Exonic
1161767778 19:6216568-6216590 TCCAGGGCCCCTCGCCCATGAGG + Intronic
1162975544 19:14205771-14205793 TCCCAGGCCCCTCGCCAGTGGGG + Intronic
1165016931 19:32888076-32888098 TCCCGTTCCCCTGGTCTGTGGGG - Intronic
1166732259 19:45065667-45065689 TTCCGGTCCCCTTGCCTGTTGGG + Intronic
1167686807 19:50961729-50961751 TCCGGGTCACCTCACCTGGCAGG + Exonic
925170494 2:1747357-1747379 TCCGGGTGCCATCGCCCCTGCGG + Intergenic
925170517 2:1747476-1747498 TCCGGGTGCCATCGCCCCTGCGG + Intergenic
925856957 2:8138243-8138265 GCGGAGTCCCCTCACCTGTGGGG - Intergenic
927156411 2:20224021-20224043 CCCGGGTCCCCTCGCGTGGAAGG + Intronic
940674581 2:156713120-156713142 TCCTGGGCCCCTCGCCTTTTAGG + Intergenic
943226542 2:185185611-185185633 TCTGGGTCCCCTCTCCACTGAGG + Intergenic
943624296 2:190181049-190181071 TCCGGGACCCCACGGCTGTCCGG + Exonic
945809009 2:214525256-214525278 TCCTGGTCCCCTCACCTGCCAGG - Intronic
947633888 2:231670530-231670552 TCCTGGTCCCCTCTGCCGTGAGG + Intergenic
948765279 2:240216238-240216260 GCCGGATCCCCACGCCTGTGGGG + Intergenic
1168914857 20:1477281-1477303 TCATGGCCCCCTTGCCTGTGGGG + Intronic
1170991270 20:21303614-21303636 CCCGCGTCCCATCGCGTGTGGGG - Intronic
1171448945 20:25222971-25222993 TCCGGGCCCCCTTACCTATGAGG - Exonic
1181123888 22:20690646-20690668 AAAGGCTCCCCTCGCCTGTGTGG - Intergenic
1185314229 22:50171787-50171809 TCAGGGTCTCCTGGCCTGTGTGG + Intronic
950446806 3:13043236-13043258 GCCAGGTCCCCTGGCCTGTGGGG - Intronic
952657331 3:35801883-35801905 TCCGGGTCTCCTCTCCACTGAGG - Intergenic
961562420 3:127739969-127739991 AGCGAGTCCCCTTGCCTGTGTGG + Intronic
967420819 3:189270517-189270539 CCCAGGTCCCCACGCCAGTGAGG + Intronic
968838300 4:2981464-2981486 TCCAGGTCTCCTCTCCTCTGAGG - Intronic
972511175 4:39770058-39770080 TCCGGGCCTCCACGCCTGCGCGG + Intronic
973893081 4:55387293-55387315 TCCAGGTCCCCTCTCCACTGTGG + Intergenic
977323684 4:95549215-95549237 TCCGGGTCCCCTCGCCTGTGAGG + Intergenic
981603971 4:146522658-146522680 TCCGGATCCCCTTCCCTCTGCGG + Intergenic
983222958 4:165060259-165060281 TGAGGGTCTCCTCGCCTTTGTGG - Intergenic
984588066 4:181585921-181585943 TGCAGGTCCCCTAGCCTCTGTGG - Intergenic
1011292905 6:85794949-85794971 TCAGGGTCCCCTCGTTTTTGAGG + Intergenic
1019772676 7:2893590-2893612 TGGGGGTCCCCTTGCATGTGGGG + Intergenic
1022528375 7:31052534-31052556 GCCGGGTCTCCGCGCCTGTGTGG - Exonic
1035282682 7:157787498-157787520 TCCTGGCCCCCTAGACTGTGGGG - Intronic
1042294745 8:67206695-67206717 TCTGGGTCCCCTGGGCTGCGTGG - Intronic
1045047695 8:98294478-98294500 AACGGGTCCCCGCGCCTGTCGGG + Intergenic
1047499482 8:125430642-125430664 TCCGGGAGCCCTTGCCTGCGGGG + Exonic
1048299188 8:133238979-133239001 TGCGGGTGCCCTCGCTGGTGTGG + Exonic
1048299196 8:133239009-133239031 TTCGGGTGCCCTCGCTGGTGTGG + Exonic
1049543042 8:143217120-143217142 TCAGGGTCCCCTTACCTGGGTGG + Intergenic
1050151571 9:2622830-2622852 TCCGGGTGCCCTCGGCTCCGCGG - Intronic
1052691475 9:31821178-31821200 TCTGGGTCTCCTCTCCTCTGAGG + Intergenic
1053797642 9:41740995-41741017 TTCGGGTCCCCTCTCCGCTGGGG - Intergenic
1054467293 9:65505000-65505022 TTCGGGTCCCCTCTCCGCTGGGG + Intergenic
1054652448 9:67635475-67635497 TTCGGGTCCCCTCTCCGCTGGGG + Intergenic
1057605891 9:96497334-96497356 TCGGGGGTCCCTGGCCTGTGTGG - Intronic
1060024886 9:120162516-120162538 TCCGGGTCTCTTCCTCTGTGGGG + Intergenic
1061245923 9:129401326-129401348 TCCGGGTCCCTTCTCCTCCGGGG + Intergenic
1061872639 9:133528895-133528917 TCGGGGTCCCCATGCCTGTCTGG + Intergenic
1062255549 9:135619135-135619157 TCCTGGTCCCCTCCCCTGCTGGG + Intergenic
1193802928 X:85958494-85958516 TCCGGGCCTCCTCCTCTGTGTGG + Intronic