ID: 977325505

View in Genome Browser
Species Human (GRCh38)
Location 4:95570675-95570697
Sequence TGAGTTCAAACCTTACAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977325505_977325507 1 Left 977325505 4:95570675-95570697 CCAGCCTGTAAGGTTTGAACTCA No data
Right 977325507 4:95570699-95570721 AAGTCTGCTGCCAGATGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977325505 Original CRISPR TGAGTTCAAACCTTACAGGC TGG (reversed) Intergenic
No off target data available for this crispr