ID: 977325507

View in Genome Browser
Species Human (GRCh38)
Location 4:95570699-95570721
Sequence AAGTCTGCTGCCAGATGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977325506_977325507 -3 Left 977325506 4:95570679-95570701 CCTGTAAGGTTTGAACTCAGAAG No data
Right 977325507 4:95570699-95570721 AAGTCTGCTGCCAGATGTGTTGG No data
977325504_977325507 2 Left 977325504 4:95570674-95570696 CCCAGCCTGTAAGGTTTGAACTC No data
Right 977325507 4:95570699-95570721 AAGTCTGCTGCCAGATGTGTTGG No data
977325502_977325507 11 Left 977325502 4:95570665-95570687 CCACTTTCTCCCAGCCTGTAAGG No data
Right 977325507 4:95570699-95570721 AAGTCTGCTGCCAGATGTGTTGG No data
977325505_977325507 1 Left 977325505 4:95570675-95570697 CCAGCCTGTAAGGTTTGAACTCA No data
Right 977325507 4:95570699-95570721 AAGTCTGCTGCCAGATGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977325507 Original CRISPR AAGTCTGCTGCCAGATGTGT TGG Intergenic
No off target data available for this crispr