ID: 977325803

View in Genome Browser
Species Human (GRCh38)
Location 4:95573082-95573104
Sequence AAGGAAAGTGCAGTGACTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977325803_977325811 20 Left 977325803 4:95573082-95573104 CCTCCAGTCACTGCACTTTCCTT No data
Right 977325811 4:95573125-95573147 CTGTGCTACATGGCCGTTGCTGG No data
977325803_977325805 -7 Left 977325803 4:95573082-95573104 CCTCCAGTCACTGCACTTTCCTT No data
Right 977325805 4:95573098-95573120 TTTCCTTTCCCCAAGTGTACAGG No data
977325803_977325812 21 Left 977325803 4:95573082-95573104 CCTCCAGTCACTGCACTTTCCTT No data
Right 977325812 4:95573126-95573148 TGTGCTACATGGCCGTTGCTGGG No data
977325803_977325815 26 Left 977325803 4:95573082-95573104 CCTCCAGTCACTGCACTTTCCTT No data
Right 977325815 4:95573131-95573153 TACATGGCCGTTGCTGGGGGTGG No data
977325803_977325816 29 Left 977325803 4:95573082-95573104 CCTCCAGTCACTGCACTTTCCTT No data
Right 977325816 4:95573134-95573156 ATGGCCGTTGCTGGGGGTGGAGG No data
977325803_977325817 30 Left 977325803 4:95573082-95573104 CCTCCAGTCACTGCACTTTCCTT No data
Right 977325817 4:95573135-95573157 TGGCCGTTGCTGGGGGTGGAGGG No data
977325803_977325814 23 Left 977325803 4:95573082-95573104 CCTCCAGTCACTGCACTTTCCTT No data
Right 977325814 4:95573128-95573150 TGCTACATGGCCGTTGCTGGGGG No data
977325803_977325810 10 Left 977325803 4:95573082-95573104 CCTCCAGTCACTGCACTTTCCTT No data
Right 977325810 4:95573115-95573137 TACAGGTTCTCTGTGCTACATGG No data
977325803_977325813 22 Left 977325803 4:95573082-95573104 CCTCCAGTCACTGCACTTTCCTT No data
Right 977325813 4:95573127-95573149 GTGCTACATGGCCGTTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977325803 Original CRISPR AAGGAAAGTGCAGTGACTGG AGG (reversed) Intergenic
No off target data available for this crispr