ID: 977326262

View in Genome Browser
Species Human (GRCh38)
Location 4:95578670-95578692
Sequence TCAAATGCACAGATGCACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977326262_977326265 9 Left 977326262 4:95578670-95578692 CCTATGTGCATCTGTGCATTTGA No data
Right 977326265 4:95578702-95578724 TCTGAATACAGCACACCAATGGG 0: 12
1: 398
2: 782
3: 6552
4: 2742
977326262_977326264 8 Left 977326262 4:95578670-95578692 CCTATGTGCATCTGTGCATTTGA No data
Right 977326264 4:95578701-95578723 TTCTGAATACAGCACACCAATGG 0: 14
1: 414
2: 794
3: 6835
4: 2798

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977326262 Original CRISPR TCAAATGCACAGATGCACAT AGG (reversed) Intergenic
No off target data available for this crispr