ID: 977327951

View in Genome Browser
Species Human (GRCh38)
Location 4:95601118-95601140
Sequence GGGTAATAATATTCACCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977327945_977327951 26 Left 977327945 4:95601069-95601091 CCTGAGCAGATTATGTAGTCTCA No data
Right 977327951 4:95601118-95601140 GGGTAATAATATTCACCTCATGG No data
977327944_977327951 30 Left 977327944 4:95601065-95601087 CCTGCCTGAGCAGATTATGTAGT No data
Right 977327951 4:95601118-95601140 GGGTAATAATATTCACCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977327951 Original CRISPR GGGTAATAATATTCACCTCA TGG Intergenic
No off target data available for this crispr