ID: 977328516

View in Genome Browser
Species Human (GRCh38)
Location 4:95607114-95607136
Sequence CGTATTTAATCTCTTTCTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977328516_977328518 -3 Left 977328516 4:95607114-95607136 CCCGAAGAAAGAGATTAAATACG No data
Right 977328518 4:95607134-95607156 ACGTGCACTTTTACATAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977328516 Original CRISPR CGTATTTAATCTCTTTCTTC GGG (reversed) Intergenic
No off target data available for this crispr